Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL419m11ex.5                         12 END     1          10        8                Homeobox protein Hox-D1 (Hox.lab1)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xlk104b07ex.3.5                      16 PI      84          1      777                Homeobox D1 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012775263 Xl3.1-XL457h21ex.5 - 10 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL457h21ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCTCAACGATACCCAGGTTAAGATCTGGTTCCAGAACAGAAGAATGAAACAAAAGAAAAGGGAAAGGGAGGGAACTTTGCCCAACTCTCCCCCATCCGGACCCGCGTCTAACTTCTGCGTAAAACCTCCACATTTGAAGTCTGTAAATGAGACTGCGACACTGTCGCCATCCAAGGACGCTTCACCCTAGAGACTCAAAGCAAGAAACCAAATATGTGGGATTGTCTGCTGCACCCCAAGCAGCCAAAACTAAGGGGACTTTGCACTATAGTTCGTTACTTGCAGTATTCCCTATTGAATGTACAGTATCTATGTATATACAGACTTTAGAAGTTCAATACTATATCTATGCATTAAATACAAATATAGGGTCTGGGTTGTTTATAGAGAGAACAACATGAAGGGTGGAGATTTACAAGTCCTCACATATATCTCTATATATTTCTGGTTCAGTATGTAAGATTACACATGCCATGTATGTGCAACAGAACAAAGTCCTGTAGCCAGACACCCATGTACTGCACATACTGTATAAAGTCACAACTGACATTACCAAAGATGGATAGGAGTCTGCCATCTCCTCAACTTTATCGACTGAATTTGCACTACTCGATTTTATGTTGCTGTTGTTCCCTGTGCCTCAAATCCATGCGGTTTCTCCTTCTGCAAAACTGACTGAACTCATTCTGGGACATACACTAGGAAGCTATTATTTTAAGGCGAATTTTATAAGATTTTACTGCTGTATATATCTATTTTTTTATAAACTAATAAAAATCCAATTTACTATGC
                                                  Xl3.1-CHK-1012695970                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGATACCCAGGTTAAGATCTGGTTCCAGAACAGAAGAATGAAACAAAAGAAAAGGGAAAGGGAGGGAACTTTGCCCAACTCTCCCCCATCCGGACCCGCGTCTAACTTCTGCGTAAAACCTCCACATTTGAAGTCTGTAAATGAGACTGCGACACTGTCGCCATCCAAGGACGCTTCACCCTAGAGACTCAAAGCAAGAAACCAAATATGTGGGATTGTCTGCTGCACCCCAAGCAGCCAAAACTAAGGGGACTTTGCACTATAGTTCGTTACTTGCAGTATTCCCTATTGAATGTACAGTATCTATGTATATACAGACTTTAGAAGTTCAATACTATATCTATGCATTAAATACAAATATAGGGTCTGGGTTGTTTATAGAGAGAACAACATGAAGGGTGGAGATTTACAAGTCCTCACATATATCTCTATATATTTCTGGTTCAGTATGTAAGATTACACATGCCATGTATGTGCAACAGAACAAAGTCCTGTAGCCAGACACCCATGTACTGCACATACTGTATAAAGTCACAACTGACATTACCAAAGATGGATAGGAGTCTGCCATCTCCTCAACTTTATCGACTGAATTTGCACTACTCGATTTTATGTTGCTGTTGTTCCCTGTGCCTCAAATCCATGCGGTTTCTCCTTCTGCAAAACTGACTGAACTCATTCTGGGACATACACTAGGAAGCTATTATTTTAAGGCGAATTTTATAAGATTTTACTGCTGTATATATCTATTTTTTTATAAACTAATAAAAATCCAATTTA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     3     2     3     2     3     2     3     2     3     4     5     3     5     3     5     3     5     3     5     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     9     9    10    10    10    10    10    10    10    10    10    10     9    10     9    10    10    10    10    10     8    10     8    10     9     9     9     9     8     8     7     8     7     8     7     7     7     7     7     7     4     7     4     7     4     7     4     7     4     7     3     3     2     3     2     3
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Ci ---- 4e-007     CAD59667.1 putative homeobox protein hox1 [Ciona intestinalis] -----------------------------------------------------------------------=======================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 5e-007     NP_476613.1 labial CG1264-PA [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ag ---- 3e-007     XP_316745.4 AGAP004650-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================
                                                                                                                                                                                                                                                                                           PROTEIN --- Dr ---- 1e-008     NP_571611.1 homeo box A1a [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================
                                                                                                                                                                                                                                                                                     PREDICTED - Bt ---- 5e-010     XP_618076.2 PREDICTED: hypothetical protein [Bos taurus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Gg ---- 5e-010     XP_001234920.1 PREDICTED: similar to Hoxa2 protein [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================
                                                                                                                                                                                                                                                                               PROTEIN --- Hs ---- 1e-010     NP_005513.1 homeobox A1 protein isoform a; homeobox protein HOX-A1; class I homeobox;homeobox 1F; Hox 1.6-like protein; lab-like protein [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Cf ---- 1e-010     XP_864527.1 PREDICTED: similar to Homeobox protein Hox-A1 (Hox-1.6) (Homeotic protein ERA-1-993) (Early retinoic acid 1) (Homeoboxless protein ERA-1-399) isoform 4 [Canis familiaris] =====================================================================================================================================================
                                                                                                                                                                                                                                                                            PROTEIN --- Mm ---- 8e-011     NP_034579.3 homeobox A1 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Xt ---- 4e-024     AAI60395.1 Homeobox D1 [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Xl ---- 4e-031     AAI06403.1 HoxD1 protein [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================
                                                    Xl3.1-XL457h21ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATG---------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------TAA---------------TAG------------------------TGAATG------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATGTAA------------------------------------------------------------------------TAA---------TGA------------------------------------------------TGA------------------------------------------------------------------------------TGA------------------------------------TAA---------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ... open reading frame                                                                                                                         ]
  5   1   2       bld Ga15      in                       XL457h21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCGCATCGAAATCGCAAACTCTCTCCAGCTCAACGATACCCAGGTTAAGATCTGGTTCCAGAACAGAAGAATGAAACAAAAGAAAAGGGAAAGGGAGGGAACTTTGCCCAACTCTCCCCCATCCGGACCCGCGTCTAACTTCTGCGTAAAACCTCCACATTTGAAGTCTGTAAATGAGACTGCGACACTGTCGCCATCCAAGGACGCTTCACCCTAGAGACTCAAAGCAAGAAACCAAATATGTGGGATTGTCTGCTGCACCCCAAGCAGCCAAAACTAAGGGGACTTTGCACTATAGTTCGTTACTTGCAGTATTCCCTATTGAATGTACAGTATCTATGTATATACAGACTTTAGAAGTTCAATACTATATCTATGCATTAAATACAAATATAGGGTCTGGGTTGTTTATAGAGAGAACAACATGAAGGGTGGAGATTTACAAGTCCTCACATATATCTCTATATATTTCTGGTTCAGTATGTAAGATTACACATGCCATGTATGTGCAACAGAACAAAGTCCTGTAGCCAGACACCCATGTACTGCACATACTGTATAAAGTCACAACTGACATTACCAAAGATGGATAGGAGTCTGCCATCTCCTCAACTTTATCGACTGAATTTGCACTACTCGATTTTATGTTGCTGTTGTTCCCTGTGCCTCAAATCCATGCGGTTTCTCCTTCTGCAAAACTGACTGAACTCATTCTGGGACATACACTAGGGAAGCTattattttaaggcgaattttataagattttactgctgtatatatctatttttttatAA
  3   1   2       bld DMZ       out                        xl312m02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCTCAACGATACCCAGGTTAAGATCTGGTTCCAGANCAGAAGAATGAANCAAAAGAAAAGGGAAAGGGAGGGAACTTTGCCCAACTCTCCCCCATCCGGACCCGCGTCTAACTTCTGCGTAAAACCTCCACATTTGAAGTCTGTAAATGAGACTGCGACACTGTCGCCATCCAAGGACGCTTCACCCTAGAGACTCAAAGCAAGAAACCAAATATGTGGGATTGTCTGCTGCACCCCAAGCAGCCAAAACTAAGGGGACTTTGCACTATAGTTCGTTACTTGCAGTATTCCCTATTGAATGTACAGTATCTATGTATATACAGACTTTAGAAGTTCAATACTATATCTATGCATTAAATACAAATATAGGGTCTGGGTTGTTTATAGAGAGAACAACATGAAGGGTGGAGATTTACAAGTCCTCACATATATCTCTATATATTTCTGGTTCAGTATGTAAGATTACACATGCCATGTATGTGCAACAGAACAAAGTCCTGTAGCCAGACACCCATGTACTGCACATACTGTATAAAGTCACAACTGACATTACCAAAGATGGATAGGAGTCTGCCATCTCCTCAACTCCCAAGCNTGANTTAG
  3   1   2       bld Ga15                               XL519f09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACCCAGGTTAAGATTGTGGGTTCCAGAACAGANGAATGAAACAAAAGAAAAGGGAAAGGGAGGGGAACTTTGCCCAACTCTCCCCCATCCGGACCCGCGTCTAACTTCTGCGTAAAACTTCCACATTTGAAGTCTGTAAATGAGACTGCGACACTGTCGCCATCCAAGGACGCTTCACCCTAGAGANTCAAAGCAAGAAACCAAATATGTGGGATTGTCTGCTGCACCCCAAGCAGCCAAAACTAAGGGGACTTTGCACTATAGTTCGTTACTTGCAGTATTCCCTATTGAATGTACAGTATCTATGTATATACAGACTAGAAGTTCAATACTATATCTATGCATTAAATACAAATATAGGGTCTGGGTTGTTTATAGAGAGAACAACATGAAGGGTGGAGATTTACAAGTCCTCACATATATCTCTATATATTTCTGGTTCAGTATGTAAGATTACACATGCCATGTATGTGCAACAGAACAAAGTCCTGTAGCCAGACACCCATGTACTGCACATACTGTATAAAGTCACAACTGACATTACCAAAGATGGATAGGAGTCTGCCATCTCCTCAACTTTATCGACTGAATTTGCACTACTCGATTTTATGTTGCTGTTGTTCCCTGTGCCTCAAATCCATGCGGTTTCTCCTTCTGCAAAACTGACTGAACTCATTCTGGGACATACACTAGGAAGCTATTATTTTAAGGCGAATTTTATAAGATTTTACTGCTGTATATATCTATTT
  3   1   2       bld Ga15 5g3  out                      XL419m11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AACTNTGCCCAAGCTCTCCCCCATCCGGACCCGGCGTNTAANTTCGGCGTAAAACTTCCACATTTGAAGTCTGTAAATGAGACTGCGACACTGTCGCCATCCAAGGACGCTTCNCCCTAGAGACTCAAAGCAAGAAACCAAATATGTGGGATTGTCTGCTGCACCCCAAGCAGCCAAAACTAAGGGGACTTTGCACTATAGTTCGTTACTTGCAGTATTCCCTATTGAATGTACAGTATCTATGTATATACAGACTAGAAGTTCAATACTATATCTATGCATTAAATACAAATATAGGGTCTGGGTTGTTTATAGAGAGAACAACATGAAGGGTGGAGATTTACAAGTCCTCACATATATCTCTATATATTTCTGGTTCAGTATGTAAGATTACACATGCCATGTATGTGCAACAGAACAAAGTCCTGTAGCCAGACACCCATGTACTGCACATACTGTATAAAGTCACAACTGACATTACCAAAGATGGATAGGAGTCTGCCATCTCCTCAACTTTATCGACTGAATTTGCACTACTCGATTTTATGTTGCTGTTGTTCCCTGTGCCTCAAATCCATGCGGTTTCTCCTTCTGCAAAACTGACTGAACTCATTCTGGGACATACACTAGGAAGCTATTATTTTAAGGCGAATTTTATAAGATTTTACTGCTGTATATATCTATT
  3   1   2       bld Ga15      in                       XL457h21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AACTTTGCCCAACTCTCCCCCATCCGGACCCGCGTNTAANTTCTGCGTAAAACCTCCACATTTGAAGTCTGTAAATGAGACTGCGACACTGTCGCCATCCAAGGACGCTTCACCCTAGAGACTCAAAGCAAGAAACCAAATATGTGGGATTGTCTGCTGCACCCCAAGCAGCCAAAACTAAGGGGACTTTGCACTATAGTTCGTTACTTGCAGTATTCCCTATTGAATGTACAGTATCTATGTATATACAGACTTTAGAAGTTCAATACTATATCTATGCATTAAATACAAATATAGGGTCTGGGTTGTTTATAGAGAGAACAACATGAAGGGTGGAGATTTACAAGTCCTCACATATATCTCTATATATTTCTGGTTCAGTATGTAAGATTACACATGCCATGTATGTGCAACAGAACAAAGTCCTGTAGCCAGACACCCATGTACTGCACATACTGTATAAAGTCACAACTGACATTACCAAAGATGGATAGGAGTCTGCCATCTCCTCAACTTTATCGACTGAATTTGCACTACTCGATTTTATGTTGCTGTTGTTCCCTGTGCCTCAAATCCATGCGGTTTCTCCTTCTGCAAAACTGACTGAACTCATTCTGGGACATACAGCTAGGAAGCTATTATTTTAAGGCGAATTTTATAAGATTTTACTGCTGTATATATCTATT
  5   1   2      seed Emb1                   IMAGE:3403144-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACATTTGAAGTCTGTAAATGAGACTGCGACACTGTCGCCATCCAAGGACGCTTCACCCTAGAGACTCAAAGCAAGAAACCAAATATGTGGGATTGTCTGCTGCACCCCAAGCAGCCAAAACTAAGGGGACTTTGCACTATAGTTCGTTACTTGCAGTATTCCCTATTGAATGTACAGTATCTATGTATATACAGACTTTAGAAGTTCAATACTATATCTATGCATTAAATACAAATATAGGGTCTGGGTTGTTTATAGAGAGAACAACATGAAGGGTGGAGATTTACAAGTCCTCACATATATCTCTATATATTTCTGGTTCAGTATGTAAGATTACACATGCCATGTATGTGCAACAGAACAAAGTCCTGTAGCCAGACACCCATGTACTGCACATACTGTATAAAGTCACAACTGACATTACCAAAGATGGATAGGAGTCTGCCATCTCCTCAACTTTATCGACTGAATTTGCACTACTCGATTTTATGTTGCTGTTGTTCCCTGTGCCTCAAATCCATGCGGTTTCTCCTTCTGCAAAACTGACTGAACTCATTCTGGGACATACACTAGGAagctattattttaaggcgaattttataagattttactgctgtatatatctatttttttataaactaataaaaatccaatttactatgcaaaaaaaaaaaaaaa
  5   1   2       bld Emb1      in                    IMAGE:3403144.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATTTGAAGTCTGTAAATGAGACTGCGACACTGTCGCCATCCAAGGACGCTTCACCCTAGAGACTCAAAGCAAGAAACCAAATATGTGGGATTGTCTGCTGCACCCCAAGCAGCCAAAACTAAGGGGACTTTGCACTATAGTTCGTTACTTGCAGTATTCCCTATTGAATGTACAGTATCTATGTATATACAGACTTTAGAAGTTCAATACTATATCTATGCATTAAATACAAATATAGGGTCTGGGTTGTTTATAGAGAGAACAACATGAAGGGTGGAGATTTACAAGTCCTCACATATATCTCTATATATTTCTGGTTCAGTATGTAAGATTACACATGCCATGTATGTGCAACAGAACAAAGTCCTGTAGCCAGACACCCATGTACTGCACATACTGTATAAAGTCACAACTGACATTACCAAAGATGGATAGGAGTCTGCCATCTCCTCAACTTTATCGACTGAATTTGCACTACTCGATTTTATGTTGC
  3   1   2       bld Neu7                                 XL017b08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAAGTCCTCACATATATCTCTATATATTTCTGGTTCAGTATGTAAGATTACACATGCCATGTATGTGCAACAGAACAAAGTCCTGTAGCCAGACACCCATGTACTGCACANACTGTATAAAGTCNCANCTGNCATTNCCAAAGATGGATAGGAGTCTGCCATCTCCTCGACTTNATCGACTGNNTTTGCACTACTCGATTTTATGTTGCTGTTGTTACCCTGTGCCTCAAATCCATGCGGTTTCTCC
  3   1   2       bld Emb1      in                    IMAGE:3403144.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGTTCAGTATGTAAGATTACACATGCCATGTATGTGCAACAGAACAAAGTCCTGTAGCCAGACACCCATGTACTGCACATACTGTATAAAGTCACAACTGACATTACCAAAGATGGATAGGAGTCTGCCATCTCCTCAACTTTATCGACTGAATTTGCACTACTCGATTTTATGTTGCTGTTGTTCCCTGTGCCTCAAATCCATGCGGTTTCTCCTTCTGCAAAACTGACTGAACTCATTCTGGGACATACACTAGGAAGCTATTATTTTAAGGCGAATTTTATAAGATTTTACTGCTGTATATATCTATTTTTTTATAAACTAATAAAAATCCAATTTACTATGCAAA
  5   1   2       bld Ga15                               XL519h09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATGCCATGTATGTGCAACNGAACAGAGTCCTGTAGCCAGACNCCCATGTACTGCACATACTGTATANAGTCACAACTGACATTACCAAAGATGGATAGGAGTCTGCCATCTCCTCNGCTTTATCGACTGAATTTGCACTACTCGATTTTATGTTGCTGTTGTTCCCTGTGCCTCAAATCCATGCGGTTTCTCCTTCTGCAAAACTGACTGAACTCATTCTGGGACATACACTANGGAAGCTATTATTTTAAGGCGAATTTTATAAGATTTTACTGCTGNATATATCTAttttttttataaactaataaaaatcccaatttactatgaaaaaaaaaa

In case of problems mail me! (mike.gilchrist@crick.ac.uk)