Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xlk70g07ex.3                         43 END     3          27        6                (no blast hit)
     2   2.0    0Xl3.1-XL047f20.3                           22 END     4          36       18                receptor tyrosine kinase [Xenopus laevis]
     3   2.0    0Xl3.1-xlk64e11ex.3                         12 END     2          18       16                (no blast hit)

 This cluster: approximate FL confidence score = 88%

 1012775266 Xl3.1-XL495k08ex.5 - 11 ESTs
                                                                       ...-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL495k08ex.5                                                                GCGGGCACGGTGTGTATAGGCATCTCTTAATCCACCTCCGGCCCCTTAGCTGCAGCCACCATGGCTGGGATTGTACATGGCATCTTGTTTTGTGGCCTCTTTGGACTTTGTTGGGCAGTGACGGGATCTAGGATTTACCCAGCCAGTGAAGTTACCCTGCTGGATTCCAGGTCAGTGCAAGGAGAGCTTGGCTGGATAGCAAGTCCTTTGGAAGGAGGGTGGGAAGAAGTGAGTATCATGGATGAAAAGAATACACCTATACGAACTTACCAAGTCTGCAATGTCATGGAATCGAGCCAAAACAACTGGTTACGGACTGACTGGATTCCCCGAAGTGGAGCTCAGAGAGTATATGTTGAAATTAAATTTACATTAAGGGACTGCAACAGCTTGCCTGGGGTAATGGGTACCTGCAAAGAGACCTTTAATCTGTATTATTATGAGTCCAACAATGACAAAGAGCGTTTCATTCGTGAAACCCAGTATGTGAAAATCGATACCATTGCAGCCGATGAGAGCTTCACCCAGGTTGATATTGGGGACCGTATTATGAAGCTGAACACTGAGGTTAGAGATGTTGGTCCACTCAGTAAGAAGGGCTTCTACTTGGCCTTCCAGGATGTGGGAGCATGCATTGCCCTTGTGTCTGTCCGAGTGTTCTACAAGAAGTGTCCATTGACTGTAAGAAACTTGGCACAGTTCCCTGACACCATTACAGGTTCAGACACCTCTTCCTTGGTGGAAGTTCGAGGCTCT
                                                  Xl3.1-CHK-1012694495                                                                      ACGGTGTGTATAGGCATCTCTTAATCCACCTCCGGCCCCTTAGCTGCAGCCACCATGGCTGGGATTGTACATGGCATCTTGTTTTGTGGCCTCTTTGGACTTTGTTGGGCAGTGACGGGATCTAGGATTTACCCAGCCAGTGAAGTTACCCTGCTGGATTCCAGGTCAGTGCAAGGAGAGCTTGGCTGGATAGCAAGTCCTTTGGAAGGAGGGTGGGAAGAAGTGAGTATCATGGATGAAAAGAATACACCTATACGAACTTACCAAGTCTGCAATGTCATGGAATCGAGCCAAAACAACTGGTTACGGACTGACTGGATTCCCCGAAGTGGAGCTCAGAGAGTATATGTTGAAATTAAATTTACATTAAGGGACTGCAACAGCTTGCCTGGGGTAATGGGTACCTGCAAAGAGACCTTTAATCTGTATTATTATGAGTCCAACAATGACAAAGAGCGTTTCATTCGTGAAACCCAGTATGTGAAAATCGATACCATTGCAGCCGATGAGAGCTTCACCCAGGTTGATATTGGGGACCGTATTATGAAGCTGAACACTGAGGTTAGAGATGTTGGTCCACTCAGTAAGAAGGGCTTCTACTTGGCCTTCCAGGATGTGGGAGCATGCATTGCCCTTGTGTCTGTCCGAGTGTTCTACAAGAAGTGTCCATTGACTGTAAGAAACTTGGCACAGTTCCCTGACACCATTACAGGTTCAGACACCTCTTCTTTGGTGGAAGTxCGA
                                                      consensus depths                                                                     2     5     5     7     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     5     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9    10     9    10     9    10     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     8    10    10    10    10    10    11    11    11    11    11    11    10    11    10    11    11    11    10    11    11    11    11    11    10    11    10    11     9    11     9    11     8    10     7     9     6     9     5     9     7     9     6     6     2     4     3     4
                                               BLH ATG      60     424                                                                
                                               BLH MIN      30     122                                                                
                                                                                                                                                                                               PROTEIN --- Ce ---- 2e-016     NP_494807.1 ephrin receptor type-A, Variable ABnormal morphology VAB-1 (124.7 kD) (vab-1)[Caenorhabditis elegans] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                   PROTEIN --- Dm ---- 3e-029     NP_726591.2 CG1511-PB, isoform B [Drosophila melanogaster] ------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                          PREDICTED - Sp ---- 4e-032     XP_001199672.1 PREDICTED: similar to Ephrin type-B receptor 2 precursor (Tyrosine-protein kinase receptor CEK5), partial [Strongylocentrotus purpuratus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                    PROTEIN --- Ci ---= 1e-051     NP_001121577.1 ephrin receptor epsilon [Ciona intestinalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                       PREDICTED - Xt ---- 3e-078     NP_001090817.1 hypothetical protein LOC100037915 [Xenopus tropicalis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                       
                                                                       PREDICTED - Cf ---- 4e-111     XP_536084.2 PREDICTED: similar to Ephrin type-A receptor 4 precursor (Tyrosine-protein kinase receptor SEK) (Receptor protein-tyrosine kinase HEK8) [Canis familiaris] ------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                  PROTEIN === Dr ==== 9e-112     NP_001005919.1 epha4a [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                  PROTEIN === Hs ==== 8e-123     NP_004429.1 EphA4; Hek8; TYRO1 protein tyrosine kinase; ephrin receptor EphA4 [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                  PROTEIN === Gg ==== 7e-123     NP_990112.1 Cek8 [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                  PROTEIN === Bt ==== 5e-123     NP_001076910.1 ephrin receptor EphA4 [Bos taurus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                  PROTEIN === Mm ==== 5e-123     NP_031962.2 Eph receptor A4; rabbit [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                  PROTEIN === Xl ==== 2e-134     NP_001090183.1 receptor tyrosin kinase [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xl3.1-XL495k08ex.5                                                                                           TAA------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG
  5   1   2       bld Ga18      out                      xlk58b19ex.5p                                                  TTGAAGGGAAGNGGAGNGNNNACGGTGTGTATAGGCATCTCTTAATCCACCTCCGGCCCCTTAGCTGCAGCCACCATGGCTNGGATTGTACATGGCATCTTGTTTTGTGGCCTCTTTGGACTTTGTTGGGCAGTGACGGGATCTAGGATTTACCCAGCCAGTGAAGTTACCCTGCTGGATTCCAGGTCAGTGCAAGGAGAGCTTGNTNGATAGCAAGTCCTTTGGAAGGAGGGTGGGAAGAAGTGAGTATCATGGATGAAAAGAATACACCTATACGAACTTACCAAGTCTGCAATGTCATGGAATCGAGCCAAAACAACTGGTTACGGACTGACTGGATTCCCCGAAGTGGAGCTCAGAGAGTATATGTTGAAATTAAATTTACATTAAGGGACTGCAACAGCTTGCCTGGGGTAATGGGTACCTGCAAAGAGACCTTTAATCTGTATTATTATGAGTCCAACAATGACAAAGAGCGTTTCATTCGTGAAANCCAGTATGTGAAAATCGATACCATTGCAGCCGATGAGAGCTTCACCCAGGNTGATATTGGGGACCGTATTATGAAGCTGAACACTGAGGTTAGAGATGNTGGTCCACTCAGTAAGAAGGGCTTCTACTTGGCNTTCCAGGATGTGGGAGCATGCATTGNCCTTGTGTCTGTCCGAGTGTNCTACAAGAAGTGTCCATTGACTGTAAGAAANTTGGNACAGNTNNCCTGANACCATTACANGT
  5   1   2      seed Emb4                   IMAGE:5537382-IMAGp.IMAGp                                                    AAGGGAAGTGGAGCGGGCACGGTGTGTATAGGCATCTCTTAATCCACCTCCGGCCCCTTAGCTGCAGCCACCATGGCTGGGATTGTACATGGCATCTTGTTTTGTGGCCTCTTTGGACTTTGTTGGGCAGTGACGGGATCTAGGATTTACCCAGCCAGTGAAGTTACCCTGCTGGATTCCAGGTCAGTGCAAGGAGAGCTTGGCTGGATAGCAAGTCCTTTGGAAGGAGGGTGGGAAGAAGTGAGTATCATGGATGAAAAGAATACACCTATACGAACTTACCAAGTCTGCAATGTCATGGAATCGAGCCAAAACAACTGGTTACGGACTGACTGGATTCCCCGAAGTGGAGCTCAGAGAGTATATGTTGAAATTAAATTTACATTAAGGGACTGCAACAGCTTGCCTGGGGTAATGGGTACCTGCAAAGAGACCTTTAATCTGTATTATTATGAGTCCAACAATGACAAAGAGCGTTTCATTCGTGAAACCCAGTATGTGAAAATCGATACCATTGCAGCCGATGAGAGCTTCACCCAGGTTGATATTGGGGACCGTATTATGAAGCTGAACACTGAGGTTAGAGATGTTGGTCCACTCAGTAAGAAGGGCTTCTACTTGGCCTTCCAGGATGTGGGAGCATGCATTGCCCTTGTGTCTGTCCGAGTGTTCTACAA
  5   1   2       bld Emb4                            IMAGE:5537382.5p                                                     AGGGAAGTGGAGCGGGCACGGTGTGTATAGGCATCTCTTAATCCACCTCCGGCCCCTTAGCTGCAGCCACCATGGCTGGGATTGTACATGGCATCTTGTTTTGTGGCCTCTTTGGACTTTGTTGGGCAGTGACGGGATCTAGGATTTACCCAGCCAGTGAAGTTACCCTGCTGGATTCCAGGTCAGTGCAAGGAGAGCTTGGCTGGATAGCAAGTCCTTTGGAAGGAGGGTGGGAAGAAGTGAGTATCATGGATGAAAAGAATACACCTATACGAACTTACCAAGTCTGCAATGTCATGGAATCGAGCCAAAACAACTGGTTACGGACTGACTGGATTCCCCGAAGTGGAGCTCAGAGAGTATATGTTGAAATTAAATTTACATTAAGGGACTGCAACAGCTTGCCTGGGGTAATGGGTACCTGCAAAGAGACCTTTAATCTGTATTATTATGAGTCCAACAATGACAAAGAGCGTTTCATTCGTGAAACCCAGTATGTGAAAATCGATACCATTGCAGCCGATGAGAGCTTCACCCAGGTTGATATTGGGGACCGTATTATGAAGCTGAACACTGAGGTTAGAGATGTTGGTCCACTCAGTAAGAAGGGCTTCTACTTGGCCTTCCAGGATGTGGGAGCATGCATTGCCCTTGTGTCTGTCCGAGTGTTCTACAAGAAGTGTCCATTGACTGGTAGAAACTTGGCACAGTTCCCTGACACCATTACAGGTTCAGACACCTCTTTCTTTGGTGGAAAAGTCGAGGGCTCTTTGTGTAGACAAACTCAGAAAGAGAAAGATGTGCCCTAAGGATGTACCTGTGGTGCCTTGAATGGAAAAGTGGNCTTTGGTGGCCCATTTGGNNAAACTGGCTTTATGTTAAACCCCCTGGGGTTTTTGAAGGGAGCGCCCCAGTGGGAGGGTATGGCCAAAAGCCCCTGGCCAAAAG
  5   1   2       bld Ga18      out                       xlk5f12ex.5p                                                       GGAAGNGGAGNGGGNNCGGTGTGTATAGGCATCTCTTAATCCACCTCCGGCCCCTTAGCTGCAGNCACCATGGCTGGGATTGTACATGGCATCTTGTTTTGTGGCCTCTTTGGACTTTGTTGGGCAGTGACGGGATCTAGGATTTACCCAGCCAGTGAAGTTACCCTGCTGGATTCCAGGTCAGTGCAAGGAGAGCTTGGNTGGATAGCAAGTCCTTTGGAAGGAGGGTGGGAAGAAGTGAGTATCATGGATGAAAAGAATACACCTATACGAACTTACCAAGTCTGCAATGTCATGGAATCGAGCCAAAACAACTGGTTACGGACTGACTGGATTCCCCGAAGTGGAGCTCAGAGAGTATATGTTGAAATTAAATTTACATTAAGGGACTGCAACAGCTTGCCTGGGGTAATGGGTACCTGCAAAGAGACCTTTAATCTGTATTATTATGAGTCCAACAATGACAAAGAGCGTTTCATTCGTGAAANCCAGTATGTGAAAATCGATACCATTGCAGCCGATGAGAGCTTCACCCAGGTTGATATTGGGGACCGTATTATGAAGCTGAACACTGAGGNTAGAGATGTTGGTCCACTCAGTAAGAAGGGCTTCTACTTGGCCTTCCAGGATGTGGGANCATGCATTNNCCTTGTGTCTNTCCGAGTGTTCTACAAGAAGTGTCCATTGANTGTAAGAAANTTGGCACAGTNCCCTGACACCATTACAGGTTCNGACANCT
  5   1   2       add Ga18      out                     xlk107e05ex.5p                                                       GGAAGTGGAGNGGGNACGGTGTGTACAGGCATCTCTTCATCCACCTCCAGCCCCTTAGCTGCAGNCACCATGGCTGGGATTGTACATGGCGTCTTGTTTTGTGGCCTCTTTGGATTTTGTTGGGCAGTGACGGGATCTAGGATTTACCCAGCCAGTGAAGTTACCCTGCTGGATTCCAGGTCAGTGCAAGGAGAGCTTGACTGGATAGCAAGTCCTTTGGAAGGAGGGTGGGAAGAAGTGAGTATCATGGATGAAAAGAATACACCTATACGAACTTATCAAGTCTGCAATGTGATGGAATCANGCCAAAACAATTGGTTACGGACTGATTGGATTCCCCGAAGTGGAGCTCAGAGAGTGTATGTTGAAATTAAATTTACCTTAAGGGACTGCAACAGCTTGCCTGGGGTAATGGGTACCTGCAAAGAGACTTTTAATCTTTACTATTACGAGTCCAACAATGACAAAGAGCGTTTTATTCGTGAGACCCAGTATGTAAAAATTGATACCATTGCAGCCGATGAGAGCTTCACCCAGGTTGATATTGGGGNNCGTATTATGAAGNTGAACACTGAGGTTAGAGATGTTGGGCCCCTCAGTAAGANGGGCTTCTACTTGGCCTTNCAGGATGTANGAGCATGCATTNNCCTTGTGTCTGTNCGAGTGTTCTACAAGAAGTGNCCATTGANTNTAAGAAANTTGNANNATTCCCTGACANCATTACNNNNNCAGACNNTT
  5   1   2       bld Ga15      out                      XL495k08ex.5p                                                                 CGGGCACGGTGTGTATAGGCATCTCTTAATCCACCTCCGGCCCCTTAGCTGCAGCCACCATGGCTGGGATTGTACATGGCATCTTGTTTTGTGGCCTCTTTGGACTTTGTTGGGCAGTGACGGGATCTAGGATTTACCCAGCCAGTGAAGTTACCCTGCTGGATTCCAGGTCAGTGCAAGGAGAGCTTGGCTGGATAGCAAGTCCTTTGGAAGGAGGGTGGGAAGAAGTGAGTATCATGGATGAAAAGAATACACCTATACGAACTTACCAAGTCTGCAATGTCATGGAATCGAGCCAAAACAACTGGTTACGGACTGACTGGATTCCCCGAAGTGGAGCTCAGAGAGTATATGTTGAAATTAAATTTACATTAAGGGACTGCAACAGCTTGCCTGGGGTAATGGGTACCTGCAAAGAGACCTTTAATCTGTATTATTATGAGTCCAACAATGACAAAGAGCGTTTCATTCGTGAAACCCAGTATGTGAAAATCGATACCATTGCAGCCGATGAGAGCTTCACCCAGGTTGATATTGGGGACCGTATTATGAAGCTGAACACTGAGGTTAGAGATGTTGGTCCACTCAGTAAGAAGGGCTTCTACTTGGCCTTCCAGGATGTGGGAGCATGCATTGCCCTTGTGTCTGTCCGAGTGTTCTACAAGAAGTGTCCATTGACTGTAANAAACTTGGCACAGTTCCCTGACACCATTACAGGTTCAGACACCTCTTCTTTGGTGGAAGTTCGAGGCTCTTGT
  5   1   2       bld Ga18      out                       xlk1o02ex.5p                                                                      GCACGTGTGTATAGNCNTCTCTTAATCCACCTCCGGCCCCTTAGCTGCAGNCACCATGGCTNGGATTGTACATGGCATCTTGTTTTGTGGCCTCTTTGGACTTTGTTGGGCAGTGACGGGATCTAGGATTTACCCAGCCAGTGAAGTTACCCTGCTGGATTCCAGGTCAGTGCAAGGAGAGCTNNNTNGATAGCAAGTCCTTTGGAAGGAGGGTGGGAAGAAGTGAGTATCATGGATGAAAAGAATACACCTATACGAACTTACCAAGTCTGCAATGTCATGGAATCGAGCCAAAACAACTGGTTACGGACTGACTGGATTCCCCGAAGTGGAGCTCAGAGAGTATATGTTGAAATTAAATTTACATTAAGGGACTGCAACAGCTTGCCTGGGGTAATGGGTACCTGCAAAGAGACCTTTAATCTGTATTATTATGAGTCCAACAATGACAAAGAGCGTTTCATTCGTGAAACCCAGTATGTGAAAATCGATACCATTGCAGCCGATGAGAGCTTCACCCAGGTTGATATTGGGGACCGTATTATGAAGCTGAACACTGAGGTTAGAGATGTTGGTCCACTCAGTAAGAAGGGCTTCTACTTGGCCTTCCAGGATGTGGGAGCATGCATTGNCCTTGTGTCTGTCCGAGTGTTCTACAAGAAGNGTCCATTGACTGTAAGAAACTTGGCACAGTTCCCTGACACCATTACAGGNTCAGACACCTCTTNNTTGGNGNAAGTTCGAGGCTCTTNNNNAGNCNACTCAGAAGNGAAAG
  5   1   2       bld Ga12      out                        XL219o10.5p                                                                                    GAGGTCTTAATCCACCTCCGGCCCCTTAGCTGCAGCCACCATGGCTGGGATTGTACATGGCATCTTGTTTTGTGGCCTCTTTGGACTTTGTTGGGCAGTGACGGGATCTAGGATTTACCCAGCCAGTGAAGTTACCCTGCTGGATTCCAGGTCAGTGCAAGGAGAGCTTGGCTGGATAGCAAGTCCTTTGGAAGGAGGGTGGGAAGAAGTGAGTATCATGGATGAAAAGAATACACCTATACGAACTTACCAAGTCTGCAATGTCATGGAATCGAGCCAAAACAACTGGTTACGGACTGACTGGATTCCCCGAAGTGGAGCTCAGAGAGTATATGTTGAAATTAAATTTACATTAAGGGACTGCAACAGCTTGCCAGGGGTAATGGGTACCTGCAAAGAGACCTTTAATCTGTATTATTATGAGTCCAACAATGACAAAGAGCGTTTCATTCGTGAAACCCAGTATGTGAAAATCGATACCATTGCAGCCGATGAGAGCTTCACCCAGGTTGATATTGGGGACCGTATTATGAAGCTGAACACTGAGGTTAGAGATGTTGGTCCACTCAGTAAGAAGGGCTTCTACTTGGCCTTCCAGGATGTGGGAGCATGCATTGCCCTTGTGTCTGTCCGAGTGTTCTACAAGAAGTGTCCA
  5   1   2       add DMZ       out                        xl335f07.5p                                                                                                                                                                                                                                                                                                                                                             ATGGAATCAAGCCAAAACAATTGGTTACGGACTGATTGGATTCCCCGAAGTGGAGCTCANAGAGTGTATGTTGAAATTAAATTTACCTTAAGGGACTGCAACAGCTTGCCTGGGGTAATGGGTACCTGCAAAGAGACTTTTAATCTTTACTATTACGAGTCCAACAATGACAAAGAGCGTTTTATTCGTGAGACCCAGTATGTAAAAATTGATACCATTGCAGCCGATGAGAGCTTCACCCAGGTTGATATTGGGGACCGTATTATGAAGTTGAACACTGAGGTTAGAGATGTTGGGCCCCTCAGTAAGAAGGGCTTCTACTTGGCCTTCCAGGATGTAGGAGCATGCATTGCCCTTGTGTCTGTCCGAGTGTTCTACAAGAAGTGCCCATTGACTGTAAGAAACTTGGCACAATTCCCTGACACCATTACAGGTTCAGACACTTCTTCCTTGGTGGAAGTCCGAGGCTCTTGCGTAGACAACTCAGAAGAGAAAGATGTGCCTAAAATGTATTGTGGTGCTGATGGAGAGTGGCTGGTGCCTATTGGGAACTGCTTGTGTAACACTGGGTTTGAGGAGCGCAATGGAGGATGCCAAGCCTGTAAAGTTGGACACTACAAAGCCCTCTCAACAGATGCCACTTGCTCCAAGTGTCCCCCCCACAGTTATGCGCTCCGGGAAGGCTCGACATCCTGCACCTGTGACCGTGGCTATTT
  5   1   2       bld Neu7      out                        XL047f20.5p                                                                                                                                                                                                                                                                                                                                                                       CAAAACAACTGGTTACGGNACTGACTGGNTTCCCCGAGTGGNAGCTCAGNANAGTATATGTTGAAATTAAATTTACATTAAGGGACTGCAACAGCTTGCCTGGGGTAATAGGTACCTGCAAAGAGACCTTTAATCTGTATTATTATGAGTCCAACAATGACAAAGAGCGTTTCATTCGTGAAACCCAGTATGTGAAAATCGATACCATTGCAGCCGATGAGAGCTTCACCCAGGTTGATATTGGGGACCGTATTATGAAGCTGAACACTGAGGTTAGAGATGTTGGTCCACTCAGTAAGAAGGGCTTCTACTTGGCCTTCCAGGATGTGGGAGCATGCATTGCCCTTGTGTCTGTCCGAGTGTTCTACAAGAAGTGTCCATTGACTGTAAGAAACTTGGCACAGTTCCCTGACACCATTACAGGTTCAGACACCTCTTC
  5   1   2       bld Ga12      out                        XL220e15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGGGCCGATGAGAGCTTCACCCAGGTTGATATTGGGGACCGTATTATGAAGCTGAACACTGAGGTTAGAGATGTTGGTCCACTCAGTAAGAAGGGCTTCTACTTGGCCTTCCAGGATGTGGGAGCATGCATTGCCCTTGTGTCTGTCCGAGTGTTCTACAAGAAGTGTCCATTGACTGTAAGAAACTTGGCACAGNTCCNTGACACCATTACAGGTTCAGACACCTCTTCTTTGGCGGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)