Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.5    0Xl3.1-IMAGE:6864060.5                       8 END     4          20       50                Unknown (protein for IMAGE:8532410) [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:8528236.5                      10 PI      86        176     1025                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012775296 Xl3.1-rxl246f16.3 - 20 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  2     2     3     3     3     3     3     3     3     3     4     4     4     4     4     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     5     7     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     4     5     5     6     5     6     5     6     5     6     5     6     5     7     5     7     5     7     5     7     5     7     6     8     6     8     7     9     7     9     7     9     7     8     7     8     7     8     7     9     7    10     8    10     7    10     7    10     8    10     9    11     9    11    10    12    10    12    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11     9    11     9    11     8    10     8    10     8    10     8    10     7     9     7     9     7     9     7    10     7     9     7     9     7     9     7     9     6    10     6    10     6    10     6    11     7    10     7    10     7    10     6    10     6    10     7    10     7    10     8    10     9    10     8    10     9    10     8    10     8    10     9    10     8    10     8    10     8    10     8    10     8    10     8    10     8    10     8    10     7     9     7     8     4     7     2     4     2     2
  3   1   2       bld Neu7      out                        XL015p22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAAGCCGACATGCAGGAGGAGAAAAACAGGATTGAACGGGTTATGGGAGCGATCGCAGATCAGGAGCTGATCAAGAAGGTGTTGAGTTTCTCTCTATCGGAANATGTTCGTCCCCAGGACACGGTGTCTGTCATTGGGGGAGTGGCAGGTGGCAGTAAACTTGGAANAAAATGTGCCTGGAGCTTTGTGAAGGATAATTGGGAGGAACTGTATAACCGTTACCAGGGTGGCTTCCTCATCTCTAGGCTCATAAAGCTTTCATTGGATGGATTTGCAAGTGATAAAATGGCAACCGAGATTAAGGCGTTTTTTGATGCCCATCCAGTTCCGTNTGCANAGCGCACGGTGCANCAGTGCTGTGAGAATATTCTGTTGAATGCTGACTGGCTGAAACGTGATGCANAAGCCATCCNCCATTATCTACTGCAGCGCAAGGCATCTTCCTC
  5   1   2       bld Brn3                            IMAGE:8537788.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGTATAACCGTTACCAGGGTGGCTTCCTCATCTCTAGGCTCATAAAGCTTTCATTGGATGGATTTGCAAGTGATAAAATGGCAACCGAGATTAAGGCGTTTTTTGATGCCCATCCAGTTCCCTCTGCAGAGCGCACGGTGCAGCAGTGCTGTGAGAATATTCTGTTGAATGCTGACTGGCTGAAACGTGATGCAGAAGCCATCCACCATTATCTACTGCAGCGCAAGGCATCTTCCTCCACTGTGTGATTGTGCACACTCATCTCACCACCTGCTGTTTCACCACCCCAACAGGCTAGACCCTAGGCTTCCATCATTGGAGGCTCAGTACCTATCTTTCCTGATATCCTCCCCCAAATTCCTCTCCCTGCCAGGTGAGTGGGTGCTAAAAGTGGGCCCCCTCCATTCGGCACCTGCTCAGTCCCCAGTCAACTCCTTAGGGAATTTATTCAATTGCTCAGCCTTCCTAAAGAGGCAGCATACAACtgtgtgtgtgtgtgtgACAACTGTGAATTTACTAGGTGGCCTATAAACAAAGGAACTCTGAGAGCTCTGTAAGTTAGAGGTTCCAGGCACAAGCGCAGAGGATTATTTGCANGTAAAGGGGCTGTAACCTGACAGGTTATAACAGTTATGTGCTTTACTCATATAAGAGGATTGTTGGCTTCCCTTTTTCTTNNATANGAGATACCCTCCNNNTACCTATGTGCTCTGTCAAATCTAACATATGCTGCTGTGTGTTGTCTGNAGTTNACTGACCTTATCTGACTAAAGTTACTGAGGCACAAAGTTGCCGTCTGACCCC
  5   1   2      seed DMZ                                  xl337o05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATAAAGCTTTCATTGGATGGATTTGCAAGTGATAAAATGGCAACCGAGATTAAGGCGTTTTTTGATGCCCATCCAGTTCCCTCTGCAGAGCGCACGGTGCAGCAGTGCTGTGAGAATATTCTGTTGAATGCTGACTGGCTGAAACGTGATGCAGAAGCCATCCACCATTATCTACTGCAGCGCAAGGCATCTTCCTCCACTGTGTGATTGTGCACACTCATCTCACCACCTGCTGTTTCACCACCCCAACAGGCTAGACCCTAGGCTTCCATCATTGGAGGCTCAGTACCTATCTTTCCTGATATCCTCCCCCAAATTCCTCTCCCTGCCAGGTGAGTGGGTGCTAAAAGTGGGCCCCCTCCATTCGGCACCTGCTCAGTCCCCAGTCAACTCCTTAGGGAATTTATTCAATTGCTCAGCCTTCCTAAAGAGGCAGCATACAACtgtgtgtgtgtgtgtgACAACTGTGAATTTACTAGGTGGCCTATAAACAAAGGAACTCTGAGAGCTCTGTAAGTTAGAGGTTCCAGGCACAAGCGCAGAGGATTATTTGCAGGTAAAGGGGCTGTAACCTGACAGGTTATAACAGTTATGTGCTTTACTCATATAAGAGGATTGTTGGCTTCCCTTTTTCTTTAATAAGGAGATACCCCTCCCTACCCTATTGTTGCTTCTGTCAAAATCTAACCATATGCTGGCTGTTGTGTTTGTCCT
  5   1   2       bld FaBN      in                    IMAGE:8075122.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCCCATCCAGTTCCCTCTGCAGAGCGCACGGTGCAGCAGTGCTGTGAGAATATTCTGTTGAATGCTGACTGGCTGAAACGTGATGCAGAAGCCATCCACCATTATCTACTGCAGCGCAAGGCATCTTCCTCCACTGTGTGATTGTGCACACTCATCTCACCACCTGCTGTTTCACCACCCCAACAGGCTAGACCCTAGGCTTCCATCATTGGAGGCTCAGTACCTATCTTTCCTGATATCCTCCCCCAAATTCCTCTCCCTGCCAGGTGAGTGGGTGCTAAAAGTGGGCCCCCTCCATTCGGCACCTGCTCAGTCCCCAGTCAACTCCTTAGGGAATTTATTCAATTGCTCAGCCTTCCTAAAGAGGCAGCATACAACtgtgtgtgtgtgtgtgACAACTGTGAATTTACTAGGTGGCCTATAAACAAAGGAACTCTGAGAGCTCTGTAAGTTAGAGGTTCCAGGCACAAGCGCAGAGGATTATTTGCAGGTAAAGGGGCTGTAACCTGACAGGTTATAACAGTTATGTGCTTTACTCATATAAGAGGATTGTTGGCTTCCCTTTTTCTTTAATAAGGAGATACCCCTCCCTACCCTATTGTTGC
  5   1   2       bld Emb4                            IMAGE:5543347.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGATTGTGCACACTCATCTCACCACCTGCTGTTTCACCACCCCAACAGGCTAGACCCTAGGCTTCCATCATTGGAGGCTCAGTACCTATCTTTCCTGATATCCTCCCCCAAATTCCTCTCCCTGCCAGGTGAGTGGGTGCTAAAAGTGGGCCCCCTCCATTCGGCACCTGCTCAGTCCCCAGTCAACTCCTTAGGGAATTTATTCAATTGCTCAGCCTTCCTAAAGAGGCAGCATACAACtgtgtgtgtgtgtgtgACAACTGTGAATTTACTAGGTGGCCCATAAACAAAGGAACTCTGAGAGCTCTGTAAGTTAGAGGTTCCAGGCACAAGCGCAGAGGATTATTTGCAGGTAAAGGGGCTGTAACCTGACAGGTTATAACAGTTATGTGCTTTACTCATATAAGAGGATTGTTGGCTTCCCTTTTTCTTTAATAAGGAGATACCCCTCCCTACCCTATTGTTGCTTCTGTCAAAATCTAACCATATGCTGGCTGTTGTGTTTGTCCTGGAGTTTAACCTGACCCTTTACTCTGGACATAGAGTTTAACCTGAGGGGCAGCAGAAGTTTTGCACGTTCGTGTACTCACACTTAACCCCCATTTCCAACTGCTCTGTACCTTTCAGTGGCCTGAAcccctcccccccccAACAGTACAGAAAATGCTTGCACAGTGGGTATTGAAGGGTCTACTTAAATGTAAATGTCTCCTCTTAGCCAAGCTGAGAGGGACAAGTGCCAAAAGTCTCTTGTTCCTGAAGCCAGGAAAATCTACCAGTTCACATTAAACCCCCTAGGTAACCCGTTTGCAGGTAATTGGTGAACCTTAACAAAACTAAAACCGGTTGGGCAATTAAAGCCTTGGGGTACAAAACTTGCTTTACCTGAATTTTCCTCTTTTGGGGAAATTTGGTTTT
  5  -1   2       bld Emb1                            IMAGE:6633760.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGGGGTTTGAGGAAGGACGGAGGGCCATGTGACCGGCGTGTTAAGGGCGTGAATATgggggggtgggggggCGGAAATGTTTTGAGACGGTCCGCTAAGCGGAGTAGGGCACAGGGGCATGCGGGTGAGGAggggggggTGGGAACAGCGCGGAAACTAAGTCGGCGGGGGTGGTCCCCGTTGAGGCGAAGGGGAGCTGGGGGGGAGGCTTATGTAAAGGTGAGAGATTCGCCAAGGCAGCATGCGCATAAGGAGTATCTTGGCAGGGGAAAAGGGACAGGGAACATAACCGGGGTGAGAAGCAATTAATCTCCTTTAATCCAAGGTAAGGGGAGTGGTGGGTGTCCCTATTTTCTTTAGTAAGGAGGACCCCCTTCCCTTCCTTCCTAGTCCTTGTTGTGGTTTGGGTCAAAATCTAACCATATGCTGGCTGTTGGGTTTGTCCTGGAGTTTAACCTGACCCTTTGCTGGGGACATAGAGTTTACCCTGAGGGGCAGCAGAAGTTTTGCACATTCGGGTACTCACACTTAACCCCCGTTTCCAACTGCTCTGTACCTTTCAGTGGCCTGAAcccctccccccccccccACAGTACAGAAAATGCTTGCACAGTGGTATTGAAGGGTCTACTTCAATGTAGATTTCTCCTCTTAGCCAGGCTGAAGAGGGACAAAGTGCAAAAGTTCTCTTGTTCCTGAAGTCAACTAGATCTACCAGTTCCACATTAAACCCTAGGTTAGCCAGTTTGCAGGTATTGTGCAGTCTTAACAGACTATAGCGGTTGGGCAATAAGCCTTGGTTATCAGACTTGCTTACCTGAGTTCTCTCTTTTGTGCAATTTGTTTTAAATGacaaaaacaacaacaacaaaaaatggaaaaaagttggcgttaataaaaacaaaaatgttcgtgtt
  5   1   2       bld Ga18                               xlk77d11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTCCTCTCCCTGCCAGGTGAGTGGGTNCTAAAAGTGGGCCCCCTCCATTCGGCACCTGCTCAGTCCCCAGTCAACTCCTTAGGGAATTTATTCAATTGCTCAGCCTTCCTAAAGAGGCAGCATACAACtgtgtgtgtgtgtgtgACAACTGTGAATTTACTAGGTGGCCTATAAACAAAGGAACTCTGAGAGCTCTGTAAGTTAGAGGTTCCAGGCACAAGCGCAGAGGATTATTTGCAGGTAAAGGGGCTGTAACCTGACAGGTTATAACAGTTATGTGCTTTACTCATATAAGAGGATTGTTGGCTTCCCTTTTTCTTTAATAAGGAGATACCCCTCCCTACCCTATTGTTGCTTCTGTCAAAATCTAACCATATGCTGGCTGTTGTGTTTGTCCTGGAGTTTAACCTGACCCTTTACTCTGGACATAGAGTTTAACCTGAGGGGCAGCAGAAGTTTTGCACGTTCGTGTACTCACACTTAACCCCCATTTCCAACTGCTCTGTACCTTTCAGTGGNCTGAAcccccccccccccc
  5   1   2       bld Ga15                               XL403p21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGTCCGGTGGGCCCCCTCCATTCGGCACCTGCTCAGTCCCCAGTCAACTCCTTAGGGAATTTATTCAATTGCTCAGCCTTCCTAAAGAGGCAGCATACAACtgtgtgtgtgtgtgtgACAACTGTGAATTTACTAGGTGGCCTATAAACAAAGGAACTCTGAGAGCTCTGTAAGTTAGAGGTTCCAGGCACAAGCGCAGAGGATTATTTGCAGGTAAAGGGGCTGTAACCTGACAGGTTATAACAGTTATGTGCTTTACTCATATAAGAGGATTGTTGGCTTCCCTTTTTCTTTAATAAGGAGATACCCCTCCCTACCCTATTGTTGCTTCTGTCAAAATCTAACCATATGCTGGCTGTTGTGTTTGTCCTGGAGTTTAACCTGACCCTTTACTCTGGACATAGAGTTTAACCTGAGGGGCAGCAGAAGTTTTGCACGTTCGTGTACTCACACTTAACCCCCATTTCCAACTGCTCTGTACCTTTCAGTGGCCTGAAcccccccccccccacanaaaaaaaaa
  3   1   2       bld FaBN      in                    IMAGE:8075122.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCTCAGCTTCCTAAAGGGGAGCATACAACTGTGGTGTGTGTGGACCACTGTGAATTATTAGGTGGCCTATAAACAAAAGAACTCTGAGAGCTCTGTAAGTTAGAGGTTCCAGGCACAAGCGCAGAGGATTATTTGCAGGTAAAGGGGCTGTAACCTGACAGGTTATAACAGTTATGTGCTTTACTCATATAAGAGGATTGTTGGCTTCCCTTTTTCTTTAATAAGGAGATACCCCTCCCTACCCTATTGTTGCTTCTGTCAAAATCTAACCATATGCTGGCTGTTGTGTTTGTCCTGGAGTTTAACCTGACCCTTTACTCTGGACATAGAGTTTAACCTGAGGGGCAGCAGAAGTTTTGCACGTTCGTGTACTCACATTTACCCCGTTTCCAACTGCTCTGTACCTTTCAGTGGCCTGAACCCCCGCCCCCCCCCCCACAGTACAGAAAATGCTTGCACAGTGGTATTGAAGGGTCTCCTTAAATGTCGATGTCTCCTCTTAGCCAGGCTGAAGAGGGACAAAGTGCAAAAGTTCTCTTGTTCCTGAAGTCAACTAGATCTACCAGTTCCACATTAAACCCTAGGTTAGCCAGTTTGCAGGTATTGTGCAGTCTTAACAGACTATAGCGGTTGGGCAATAAGCCTAGGTTATCAGACTTGCTTACCTGAGTTCTCTCTTTTGTGCAATTGGTTTAAATGACAAAAACAACAACAACAAAAAAGGAGAAAAGNGGCNTTTTAGATACCTATTTTTCC
  3   1   2       bld DMZ                                 rxl246f16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAAAGAGGCAGCATACAACTGTGTGTGTGTGTGTGTGACAACTGTGAATTTACTAGGTGGCCCATAAACAAAGGAACTCTGAGAGCTCTGTAAGTTAGAGGTTCCAGGCACAAGCGCAGAGGATTATTTGCAGGTAAAGGGGCTGTAACCTGACAGGTTATAACAGTTATGTGCTTTACTCATATAAGAGGATTGTTGGCTTCCCTTTTTCTTTAATAAGGAGATACCCCTCCCTACCCTATTGTTGCTTCTGTCAAAATCTAACCATATGCTGGCTGTTGTGTTTGTCCTGGAGTTTAACCTGACCCTTTACTCTGGACATAGAGTTTAACCTGAGGGGCAGCAGAAGTTTTGCACGTTCGTGTACTCACACTTAACCCCCATTTCCAACTGCTCTGTACCTTTCAGTGGCCTGAACCCCCGCCCCCCCCACAGTACAGAAAATGCTTGCACAGTGGTATTGAAGGGTCTCCTTAAATGTAGATGTCTCCTCTTAGCCAGGCTGAAGAGGGACAAAGTGCAAAAGTTCTCTTGTTCCTGAAGTCAACTAGATCTACCAGTTCCACATTAAACCCTAGGTTAGCCAGTTTGCAGGTATTGTGCAGTCTTAACAGACTATAGCGGTTGGGCAATAAGCCTTGGTTATCAGACTTGCTTACCTGAGTTCTCTCTTTTGTGCAATTTGTTTTAAATGACAAAAACAGCAACAACAAAAAATGGAAAAAAGTGGCGTA
  3   1   2       bld Ga12      out                        XL200l01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCATAAACAAAGGAACTCTGAGAGCTCTGTAAGTTAGAGGTTCCAGGCACAAGCGCAGAGGATTATTTGCAGGTAAAGGGGCTGTAACCTGACAGGTTATAACAGTTATGTGCTTTACTCATATAAGAGGATTGTTGGCTTCCCTTTTTCTTTAATAAGGAGATACCCCTCCCTACCCTATTGTTGCTTCTGTCAAAATCTAACCATATGCTGGCTGTTGTGTTTGTCCTGGAGTTTAACCTGACCCTTTACTCTGGACATAGAGTTTAACCTGAGGGGCAGCAGAAGTTTTGCACGTTCGTGTACTCACACTTAACCCCCATTTCCAACTGCTCTGTACCTTTCAGTGGCCTGAACCCCCGCCCCCCCCACAGTACAGAAAATGCTTGCACAGTGGTATTGAAGGGTCTCCTTAAATGTAGATGTCTCCTCTTAGCCAGGCTGAAGAGGGACAAAGTGCAAAAGTTCTCTTGTTCCTGAAGTCAACTAGATCTACCAGTTCCACATTAAACCCTAGGTTAGCCAGTTTGCAGGTATTGTGCAGTCTTAACAGACTATAGCGGTTGGGCAATAAGCCTTGGTTATCAGACTTGCTTACCTGAGTTCTCTCTTTTGTGCAATTTGTTTTAAATGACAAAAACAACAACAACAAAAAATGGAAAAAAGT
  3   1   2       bld DMZ                                 rxl276p11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCTGTAAGTTAGAGGTTCCAGGCACAAGCGCAGAGGATTATTTGCAGGTAAAGGGGCTGTAACCTGACAGGTTATAACAGTTATGTGCTTTACTCATATAAGAGGATTGTTGGCTTCCCTTTTTCTTTAATAAGGAGATACCCCTCCCTACCCTATTGTTGCTTCTGTCAAAATCTAACCATATGCTGGCTGTTGTGTTTGTCCTGGAGTTTAACCTGACCCTTTACTCTGGACATAGAGTTTAACCTGAGGGGCAGCAGAAGTTTTGCACGTTCGTGTACTCACACTTAACCCCCATTTCCAACTGCTCTGTACCTTTCAGTGGCCTGAACCCCCGCCCCCCCCACAGTACAGAAAATGCTTGCACAGTGGTATTGAAGGGTCTCCTTAAATGTAGATGTCTCCTCTTAGCCAGGCTGAAGAGGGACAAAGTGCAAAAGTTCTCTTGTTCCTGAAGTCAACTAGATCTACCAGTTCCACATTAAACCCTAGGTTAGCCAGTTTGCAGGTATTGTGCAGTCTTAACAGACTATAGCGGTTGGGCAATAAGCCTTGGTTATCAGACTTGCTTACCTGAGTTCTCTCTTTTGTGCAATTTGTTTTAAATGACAAAAACAGCAACAACAAAAAATGGAAAAAAGTGGCGTAA
  3   1   2       bld Lmb1      out                   IMAGE:8532410.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGGAGGGAACTAAATATCATACAATTTCTGCATACAGATATAAGCAGGAATTTTAATTTCTTTAAAATCTAAAATAATAAAAAATTTAGGAGCCCCCCCCCCCCCCCCCCCACAGTACAGAAAATGCTTGCACAGTGGTATTGAAGGGTCTCCTTAAATGTAGATGTCTCCTCTTAGCCAGGCTAAAGAGGGACAAAGTGCAAAAGTTCTCTTGTTCCTGAAGTCAACTAGATCTACCAGTTCCACATTAAACCCTAGGTTAGCCAGTTTGCAGGTATTGTGCAGTCTTAACAGACTATAGCGGTTGGGCAATAAGCCTTGGTTATCAGACTTGCTTACCTGAGTTCTCTCTTTTGTGCAATTTGTTTTAAATGACAAACCAACAACAAAAA
  3   1   2       bld DMZ       in                         xl266l05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ANCCCCNTTTNCAAATGNTTTGNNCCNTTCAGNGGNCTGAACCCCCCCCCCCCCACAGTACAGAAAATGCTTGCACAGTGGTATTGAACGGTCTCCTTAAATGTCGATGTCTCCTCTTAGCCAGGCTGAAGAGGGACAAAGTGCAAAAGTTCTCTTGTTCCTGAAGTCAACTAGATCTACCAGTTCCACATTAAACCCTAGGTTAGCCAGTTTGCAGGTATTGTGCAGTCTTAACAGACTATAGCGGTTGGGCAATAAGCCTTGGTTATCAGACTTGCTTACCTGAGTTCTCTCTTTTGTGCAATTTGTTTTAAATGACAAAAACAACAACAACAAAAAATnGAAAAAAGTG
  3   1   2       bld Neu7      out                        XL016n18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TNAACCCCCCCCCCCCCACAGTACAGAAAATGCTTGCACAGTGGTATTGAACGGTCTCCTTAAATGTCGATGTCTCCTCTTAGCCAGGCTGAAGAGGGACAAAGTGCAAAAGTTCTCTTGTTCCTGAAGTCAACTAGATCTACCAGTTCCACATTAAACCCTAGGTTAGCCAGTTTGCAGGTATTGTGCAGTCTTAACAGACTATAGCGGTTGGGCAATAAGCCTTGGTTATCAGACTTGCTTACCTGAGTTCTCTCTTTTGTGCAATTTGTTTTAAAGACAAAAACAACAACAACAAAAAAnGAAAAAAGTGGCGTTAATAAAAACAAAAAT
  5   1   2       bld Gas6                            IMAGE:3438580.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAATCTCCAGCATCTGCTACAGTAAAGATTCTGATGGATAAGCCAGATATGACTGTGGTGCTGGAAGGTGTTAAGCCACACCAGTGGGTGAAGTTCTCTTGTTCCTGAAGTCAACTAGATCTACCAGTTCCACATTAAACCCTAGGTTAGCCAGTTTGCAGGTATTGTGCAGTCTTAACAGACTATAGCGGTTGGGCAATAAGCCTTGGTTATCAGACTTGCTTACCTGAGTTCTCTCTTTTGTGCAATTTGTTTTAAATGacaaaaacaacaacaacaaaaaatggaaaaaagttggcgttaataaaaacaaaaaTGTTCGTGTTTAAAAGTTTGGACTTCAACTACTTTCTTCAAAGGCCGACCCATTGGttttttttttACCCTAGGCCGAAAATACGTGTTGCCTAATTTCAAGGGGTCaaaaaaaaaaaaaaGAATGGGTGCAATTAATATGAAATATCTACTCTGGTTTTTGACCTATGGCAGCTTTCACTTATGATTTATCATCAATGG

In case of problems mail me! (