Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xl264h03.3                            9 END     2          20       22                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6860267.5.5                    29 PI      93         76     1176                MAD homolog 1 [Xenopus tropicalis]
     3   0.0    0Xl3.1-IMAGE:6643837.5                       7 PI      100      1006     1176                (no blast hit)
     4   0.0    0Xl3.1-IMAGE:3437397-IMAGp.5                 5 PI      80        303      639                (no blast hit)

 This cluster: approximate FL confidence score = 98%

 1012775318 Xl3.1-xl264h03.5 - 10 ESTs
                                                                       ......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl264h03.5                                                                                                                                                                                                                                                                                                                                                                                         GGGAGAGAGGAGGAGGAGGGAGCCTCACATCCCGGGCTGCTGGGGAAAGGCATGCGACTTTTTGCTTACGTTATTAGACACCGACAAGCTGCGACAGTGTAACCGGGCACCGAGAAAGGGCGTTTTGTCCAGCAGATGCTGCTGGCCTGCTGGGAACCACTGGCTGTGATTACTGCACTGGATAGCTATTGTCTGTAACTGGGAAGAATCTCCATTAACCGGCATTAACAATATTGGTCTGGAACCATTTCACAGCAGTCAAAATATAAAGTTGACTAGTCACAATGAATGTGACAAGCCTTTTCTCCTTCACAAGCCCAGCTGTGAAGAGGCTGCTTGGTTGGAAACAGGGAGACGAAGAAGAGAAATGGGCAGAGAAAGCGGTGGATGCCTTGGTGAAAAAGCTGAAGAAGAAAAAAGGAGCCATGGAAGAACTTGAAAAGGCCCTGAGTTGTCCTGGACAGCCCAGTAACTGTGTCACCATTCCTCGTTCCTTGGATGGCCGACTGCAAGTGTCTCACCGTAAGGGCCTACCGCATGTCATTTATTGCAGAGTGTGGCGTTGGCCTGATCTACAGAGTCACCATGAACTGAAACCCTTGGAGTGTTGCGAGTATCCCTTTGGTTCCAAACAGAAGGAGGTCTGCATCAACCCATATCATTATAAACGAGTGGAGAGTCCTGTCTTGCCGCCTGTCCTTGTTCCACGGCACAGTGAGTACAACCCTCAACACAGTCTCCTTGCGCAATTCCGAAACTTGGAGCCAAGTGAGCCACACATGCCTCACAACGCAACTTTTCCCGACTCTTTCCAGCAGCCAAACAGCCATCCGTTCCCTCACTCGCCCAACAGCAGCTACCCAAACTCTCCGGGAAGCAGCAGTACTTACCCTCACTCACCGGCGAGCTCTGATCCTGGAAGCCCTTTTCAAATACCAGCTGACACCCCTCCTCCAGCTTATATGCCTCCTGAGGATCAGATGACGCAAGACAACTCTCAGCCGATGGACACAAATATGATGGTGCCTAACATCTCTCAAGATATCAATAGAGCAGATGTACAAGCTGTTGCCTATGAAGAGCCAAAACACTGGTGCTCCATTGTCTATTATGAGCTGAACAACCGTGTAGGAGAAGCTTTCCATGCCTCCTCCACAAGTGTATTGGTGGACGGCT
                                                  Xl3.1-CHK-1012695789                                                                                                                                                                                                                                                                                                                                                                                               GAGGAGGAGGAGGGAGCCTCACATCCCGGGCTGCTGGGGAAAGGCATGCGACTTTTTGCTTACGTTATTAGACACCGACAAGCTGCGACAGTGTAACCGGGCACCGAGAAAGGGCGTTTTGTCCAGCAGATGCTGCTGGCCTGCTGGGAACCACTGGCTGTGATTACTGCACTGGATAGCTATTGTCTGTAACTGGGAAGAATCTCCATTAACCGGCATTAACAATATTGGTCTGGAACCATTTCACAGCAGTCAAAATATAAAGTTGACTAGTCACAATGAATGTGACAAGCCTTTTCTCCTTCACAAGCCCAGCTGTGAAGAGGCTGCTTGGTTGGAAACAGGGAGACGAAGAAGAGAAATGGGCAGAGAAAGCGGTGGATGCCTTGGTGAAAAAGCTGAAGAAGAAAAAAGGAGCCATGGAAGAACTTGAAAAGGCCCTGAGTTGTCCTGGACAGCCCAGTAACTGTGTCACCATTCCTCGTTCCTTGGATGGCCGACTGCAAGTGTCTCACCGTAAGGGCCTACCGCATGTCATTTATTGCAGAGTGTGGCGTTGGCCTGATCTACAGAGTCACCATGAACTGAAACCCTTGGAGTGTTGCGAGTATCCCTTTGGTTCCAAACAGAAGGAGGTCTGCATCAACCCATATCATTATAAACGAGTGGAGAGTCCTGTCTTGCCGCCTGTCCTTGTTCCACGGCACAGTGAGTACAACCCTCAACACAGTCTCCTTGCGCAATTCCGAAACTTGGAGCCAAGTGAGCCACACATGCCTCACAACGCAACTTTTCCCGACTCTTTCCAGCAGCCAAACAGCCATCCGTTCCCTCACTCGCCCAACAGCAGCTACCCAAACTCTCCGGGAAGCAGCAGTACTTACCCTCACTCACCGGCGAGCTCTGATCCTGGAAGCCCTTTTCAAATACCAGCTGACACCCCTCCTCCAGCTTATATGCCTCCTGAGGATCAGATGACGCAAGACAACTCTCAGCCGATGGACACAAATATGATGGTGCCTAACATCTCTCAAGATATCAATAGAGCAGATGTACAAGCTGTTGCCTATGAAGAGCCAAAACACTGGTGCTCCATTGTCTATTATGAGCTGAACAACCGTGTAGGAGAAGCTTTCCATGCCTCCTCCACAAGTGTATTGGTGGACGGCTTCACTG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                              2     3     5     6     5     6     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     7     5     7     6     8     7     9     6     9     6     9     7     9     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     6     8     6     8     5     8     5     7     5     7     5     7     5     7     5     7     4     6     4     6     4     6     5     7     5     7     5     7     4     6     4     6     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3
                                               BLH ATG     284    1777                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     284     219                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MPR     242     219                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     284    1210                                                                                                                                                                                                                                                                                                                                                                                         
                                               CDS MIN     284     219                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     284      64                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Ce ---- 5e-057     NP_498931.2 SMAll body size SMA-2, dwarfin; affects body size and the arrangement ofperipheral sense organs in the male tail; transforming growth factor betapathway component (47.9 kD) (sma-2) [Caenorhabditis elegans] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Dm ---- 1e-105     NP_477017.1 Mothers against dpp CG12399-PA [Drosophila melanogaster] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Ag ---- 3e-111     XP_314661.3 AGAP008551-PA [Anopheles gambiae str. PEST] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Ci ==== 5e-116     NP_001071815.1 Smad1/5 protein [Ciona intestinalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Sp ==== 1e-120     XP_001178940.1 PREDICTED: similar to SMAD5 isoform 5 [Strongylocentrotus purpuratus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Dr ==== 1e-143     NP_571443.2 MAD homolog 5 [Danio rerio] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Mm ==== 3e-169     NP_032565.2 MAD homolog 1; Smad 1 [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = Cf ==== 4e-170     XP_867346.1 PREDICTED: similar to Mothers against decapentaplegic homolog 1 (SMAD 1) (Mothers against DPP homolog 1) (Mad-related protein 1) (Transforming growth factor-beta signaling protein-1) (BSP-1) (hSMAD1) (JV4-1) isoform 14 [Canis familiaris] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Bt ==== 2e-170     NP_001069691.2 Sma- and Mad-related protein 1 [Bos taurus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Hs ==== 2e-170     NP_001003688.1 Sma- and Mad-related protein 1 [Homo sapiens] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = Gg ==== 1e-172     XP_420428.1 PREDICTED: similar to Smad1 [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Xt ==== 0          NP_001007481.1 MAD homolog 1 [Xenopus tropicalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Xl ==== 0          NP_001079973.1 mothers against DPP [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-xl264h03.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAG---------------------------------------------------------------------------------------------------------TAG------------------------------TAA------------------------------------------------TAA---TGA---------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG---------------------ATG---------ATGATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ...
  5   1   2       bld Sp1  5g                         IMAGE:5511102.5p CCCACGCGTCCGAGAAATATAAGGGCAAGGCACAATTAGAGAAAAGAGGAGAAAAGCAGGCCAGTGCAGGAGGAGTGTTAAACGTGTTGTGTGAGTGGATAAGGGAACGTGTAGGGGGGGTTTTAGTTGTACTTTAGCAGTGACTTGGGTCAGAGCCACGAGCTGACGAGATTTCTGTTGTACACGGCGGCCCAGTTCTTCACAAACCCCCTCCCCCTCCTGTCTCTTTTAAGACGGGCCCCAAGTCAGCAGTGCGCCGTGTGATTAGGGTTGTGCTTTGCAGACGCTCCCTGCCTGGGGTGTGTATGTTGTGTATTGGCAGCTGGGCGGCTTCGACTCCCTGACGCCAGAGAGTCCAGATCAATCCAGGCAGCCGGggagagaggaggaggagggagCCTCACATCCCGGGCTGCTGGGGAAAGGCATGCGACTTTTTGCTTACGTTATTAGACACCGACAAGCTGCGACAGTGTAACCGGGCACCGAGAAAGGGCGTTTTGTCCAGCAGATGCTGCTGGCCTGCTGGGAACCACTGGCTGTGATTACTGCACTGGATAGCTATTGTCTGTAACTGGGAAGAATCTCCATTAACCGGCATTAACAATATTGGTCTGGAACCATTTCACAGCAGTCAAAATATAAAGTTGACTAGTCACAATGAATGTGACAAGCCTTTTCTCCTTCATNCAGCCAGCTGTGAAGAGGCTGCTTGGTTGAANCAGGNAGACGAGAAGAGAATGGGCAAGAAAGCNGTGATGCTTTGTGAAAGCTGAAGAGAAAN
  5   1   2       bld Oo1  5x                         IMAGE:5079791.5p                                                                                                                                                                                                                                                                                                                 GTGTATTGGCAGCTGGGCGGCTTCGACTCCCTGACGCCAGAGAGTCCAGATCAATCCAGGCAGCCGGggagagaggaggaggaggaggagggagCCTCACATCCCGGGCTGCTGGGGAAAGGCATGCGACTTTTTGCTTACGTTATTAGACACCGACAAGCTGCGACAGTGTAACCGGGCACCGAGAAAGGGCGTTTTGTCCAGCAGATGCTGCTGGCCTGCTGGGAACCACTGGCTGTGATTACTGCACTGGATAGCTATTGTCTGTAACTGGGAAGAATCTCCATTAACCGGCATTAACAATATTGGTCTGGAACCATTTCACAGCAGTCAAAATATAAAGTTGACTAGTCACAATGAATGTGACAAGCCTTTTCTCCTTCACAAGCCCAGCTGGTGAAGAGGCTGCTTGGTTGGAACAGGGAGACGAAGAAGAGAAAATGGGCagagaaaaagcggtggatgcccttggtgaaaaaagctggaagaagaaaaaaaggagcccatggaaagaaacttgaaaaaagGCCCCTGGAGTTGGTCCCTGGAACAAGCCCCAGTTAACCTGGGGTTCCCCCATTTCCCCTCGGTTTCCCCTTGGGGAATGGGCCCCAACTTGGCCAAAGTTGGTCCTTCCCCCCGGATAAAGGGGGCCCCTACCCCGCCATGTGGCCAATTTTTAATTTGGCCAAAAAAGTGGTGGGGCGCGTTTTGGGGCCCCTTGAATTCTTTTAACCGGAGAGAGTcccccccccTTGGGAAAACTGTGGGAAAACCCCCCCTCTTGGGAAAGTGGTGTTTTCCCaaaaaaaaaaaCCTCCCCCCTTTTTGGGGGTTCCCCCCCCAACACCCCCAAAAGAgggggggggggggTCTTGGGTGCAATATTAAAAAACACCA
  5   1   2       bld Oo1  5g                         IMAGE:3404417.5p                                                                                                                                                                                                                                                                                                                                                                                        GGggagagaggaggaggagggagCCTCACATCCCGGGCTGCTGGGGAAAGGCATGCGACTTTTTGCTTACGTTATTAGACACCGACAAGCTGCGACAGTGTAACCGGGCACCGAGAAAGGGCGTTTTGTCCAGCAGATGCTGCTGGCCTGCTGGGAACCACTGGCTGTGATTACTGCACTGGATAGCTATTGTCTGTAACTGGGAAGAATCTCCATTAACCGGCATTAACAATATTGGTCTGGAACCATTTCACAGCAGTCAAAATATAAAGTTGACTAGTCACAATGAATGTGACAAGCCTTTTCTCCTTCACAAGCCCAGCTGTGAAGAGGCTGCTTGGTTGGAAACAGGGAGACGAAGAAGAGAAATGGGCATAGAAAGCGGTGGATGCCTTGGTGAAAAAGCTGAATAAGACAAAAGGAGCCATGGAAGATCTTGAAAAGGCCCTGAGTTGTCCTGGACAGCCCAGTAACTGTGTTACCATTCCTCGTTCCTTGGATGGCCGACTGCAAGTGTCTCACCGTAAGGGCCTACCGCATTGTCATTATTGCAGAATGTGGCGT
  5   1   2      seed DMZ  5g                              xl258o01.5p                                                                                                                                                                                                                                                                                                                                                                                          ggagagaggaggaggagggagCCTCACATCCCGGGCTGCTGGGGAAAGGCATGCGACTTTTTGCTTACGTTATTAGACACCGACAAGCTGCGACAGTGTAACCGGGCACCGAGAAAGGGCGTTTTGTCCAGCAGATGCTGCTGGCCTGCTGGGAACCACTGGCTGTGATTACTGCACTGGATAGCTATTGTCTGTAACTGGGAAGAATCTCCATTAACCGGCATTAACAATATTGGTCTGGAACCATTTCACAGCAGTCAAAATATAAAGTTGACTAGTCACAATGAATGTGACAAGCCTTTTCTCCTTCACAAGCCCAGCTGTGAAGAGGCTGCTTGGTTGGAAACAGGGAGACGAAGAAGAGAAATGGGCAGAGAAAGCGGTGGATGCCTTGGTGAAAAAGCTGAAGAAGAAAAAAGGAGCCATGGAAGAACTTGAAAAGGCCCTGAGTTGTCCTGGACAGCCCAGTAACTGTGTCACCATTCCTCGTTCCTTGGATGGCCGACTGCAAGTGTCTCACCGTAAGGGCCTACCGCATGTCATTTATTGCAGAGTGTGGCGTTGGCCTGATCTACAGAGTCACCATGAACTGAAACCCTTGGAGTGTTGCGAGTATCCCTTTGGTTCCAAACAGAAGGAGGTCTGCATCAACCCATATCATTATAAACGAGTGGAGAGTCCTGTCTTGCC
  5   1   2       add Ga18 5g                           xlk166h22ex.5p                                                                                                                                                                                                                                                                                                                                                                                           ggagagaggaggaggagggagNCTCACATCCCGGGCTGCTGGGGAAAGGNATGCGACTTTTTGCTTACGTTATTAGACACCGACAAGCTGCGACAGTGTAACCGGGCACCGAGAAAGGGCGTTTTGTCCAGCAGATGCTGNNNNNTGCTGGGAACCACTGGCTGTGATTACTGCACTGGATAGCTATTGTCTGTAACTGGGAAGAATCTCCATTAACCGGCATTAACAATATTGGTCTGGAACCATTTCACAGCAGTCAAAATATAAAGTTGACTAGTCACAATGAATGTGACAAGCCTTTTCTCCTTCACAAGCCCAGCTGTGAAGAGGCTGCTTGGTTGGAAACAGGGAGACGAAGAAGAGAAATGGGCAGAGAAAGCGGTGGATGCCTTGGTGAAAAAGCTGAAGAAGAAAAAAGGAGCCATGGAAGAACTTGAAAAGGCCCTGAGTTGTCCTGGACAGCCCAGTAACTGTGTCACCATTCCTCGTTCCTTGGATGGCCGACTGCAAGTGTCTCACCGTAANNCCTACCGCATGTCATTTATTGCAGAGTGTGGCGTTGGNNGATCTACAGAGTCACCATGAACTGAAACCCTTGGAGTGTTGCGAGTATNCCTTTGGTTCCAAACAGAAGGAGGNCTGCATCAACCCATATCATTATAAACGAGTGGAGAGTCCTGTCTTGCCGCCTGNNCTTGTTCCACGGCACAGT
  5   1   2       bld DMZ  5g3  out                        xl264h03.5p                                                                                                                                                                                                                                                                                                                                                                                             GAGAGGAGGAGGAGGGAGCCTCACATCCCGGGCTGCTGGGGAAAGGCATGCGACTTTTTGCTTACGTTATTAGACACCGACAAGCTGCGACAGTGTAACCGGGCACCGAGAAAGGGCGTTTTGTCCAGCAGATGCTGCTGGCCTGCTGGGAACCACTGGCTGTGATTACTGCACTGGATAGCTATTGTCTGTAACTGGGAAGAATCTCCATTAACCGGCATTAACAATATTGGTCTGGAACCATTTCACAGCAGTCAAAATATAAAGTTGACTAGTCACAATGAATGTGACAAGCCTTTTCTCCTTCACAAGCCCAGCTGTGAAGAGGCTGCTTGGTTGGAAACAGGGAGACgaagaagagaaatgggcagagaaagcggtggatgccttggtgaaaaagctgaagaagaaaaaaggagccatggaagaacttgaaaagGCCCTGAGTTGTCCTGGACAGCCCAGTAACTGTGTCACCATTCCTCGTTCCTTGGATGGCCGACTGCAAGTGTCTCACCGTAAGGGCCTACCGCATGTCATTTATTGCAGAGTGTGGCGTTGGCCTGATCTACAGAGTCACCATGAACTGAAACCCTTGGAGTGTTGCGAGTATCCCTTTGGTTCCNAACAGAAGGAGGTCTGCATCAACCCATATCATTATAAACGAGTGGAGAGTCCTGTCTTGCCGCCTGTCCTTGTTCCACGGCACAGTG
  5   1   2       bld Ov1  5g3  out                   IMAGE:5047316.5p                                                                                                                                                                                                                                                                                                                                                                                                                     CACGCGTCCGGTTGGCGAAAGGCATGCGACTTTTTGCTTACGTTATTAGACACCGACAAGCTGCGACAGTGTAACCGGGCACCGAGAAAGGGCGTTTTGTCCAGCAGATGCTGCTGGCCTGCTGGGAACCACTGGCTGTGATTACTGCACTGGATAGCTATTGTCTGTAACTGGGAAGAATCTCCATTAACCGGCATTAACAATATTGGTCTGGAACCATTTCACAGCAGTCAAAATATAAAGTTGACTAGTCACAATGAATGTGACAAGCCTTTTCTCCTTCACAAGCCCAGCTGTGAAGAGGCTGCTTGGTTGGAAACAGGGAGACGAAGAAGAGAAATGGGCAGAGAAAGCGGTGGATGCCTTGgtgaaaaagctgaagaagaaaaaaggagccatggaagaacttgaaaagGCCCTGAGTTGTCCTGGACAGCCCAGTAACTGTGTCACCATTCCTCGTTCCTTGGATGGCCGACTGCAAGTGTCTCACCGTAAGGGCCTACCGCATGTCATTTATTGCAGAGTGTGGCGTTGGCCTGATCTACAGAGTCACCATGAACTGAAACCCTTGGAGTGTTGCGAGTATCCCTTT
  5   1   2       bld Oo1                             IMAGE:6643144.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGGACCGGTCCGGAATTCCCTGCATGGGCAGAGAAAGCGGTGGATGCCTTTGGTGAAAAAGCTGAAGAAGAAAAAAGGAGCCATGGAAGAACTTGAAAAGGCCCTGAGTTGTCCTGGACAGCCCAGTAACTGTGTCACCATTCCTCGTTCCTTGGATGGCCGACTGCAAGTGTCTCACCGTAAGGGCCTACCGCATGTCATTTATTGCAGAGTGTGGCGTTGGCCTGATCTACAGAGTCACCATGAACTGAAACCCTTGGAGTGTTGCGAGTATCCCTTTGGTTCCAAACAGAAGGAGGTCTGCATCAACCCATATCATTATAAACGAGTGGAGAGTCCTGTCTTGCCGCCTGTCCTTGTTCCACGGCACAGTGAGTACAACCCTCAACACAGTCTCCTTGCGCAATTCCGAAACTTGGAGCCAAGTGAGCCACACATGCCTCACAACGCAACTTTTCCCGACTCTTTCCAGCAGCCAAACAGCCATCCGTTCCCTCACTCGCCCAACAGCAGCTACCCAAACTCTCCGGGAAGCAGCAGTACTTACCCTCACTCACCGGCGAGCTCTGATCCTGGAAGCCCTTTTCAAATACCAGCTGACACCCCTCCTCCAGCTTATATGCCTCCTGAGGATCAGATGACGCAAGACAACTCTCAGCCGATGGACACAAATATGATGGTGCCTAACATCTCTCAAGATATCAATAGAGCAGATGTACAAGCTGTTGCCTATGAAGAGCCAAAACACTGGTGCTCCATTGTCTATTATGAGCTGAACAACCGTGTAGGAGAAGCTTTCCATGCCTCCCTCACAAGTGTATTGGTGGACGGCTTCACTGAATCCTTCAAACAACCAGGACAGATTTTGCCTTTGGGCTTCCTGTCCATGTCAACCGGAAACTCGACCATTGAGAAACACCAGGCCGGCATAATT
  5   1   2       bld Emb1                            IMAGE:6636068.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAGAGAAATGGGCAGAGAAAGCGGTGGATGCCTTGgtgaaaaagctgaagaagaaaaaaggagccatggaagaacttgaaaagGCCCTGAGTTGTCCTGGACAGCCCAGTAACTGTGTCACCATTCCTCGTTCCTTGGATGGCCGACTGCAAGTGTCTCACCGTAAGGGCCTACCGCATGTCATTTATTGCAGAGTGTGGCGTTGGCCTGATCTACAGAGTCACCATGAACTGAAACCCTTGGAGTGTTGCGAGTATCCCTTTGGTTCCAAACAGAAGGAGGTCTGCATCAACCCATATCATTATAAACGAGTGGAGAGTCCTGTCTTGCCGCCTGTCCTTGTTCCACGGCACAGTGAGTACAACCCTCAACACAGTCTCCTTGCGCAATTCCGAAACTTGGAGCCAAGTGAGCCACACATGCCTCACAACGCAACTTTTCCCGACTCTTTCCAGCAGCCAAACAGCCATCCGTTCCCTCACTCGCCCAACAGCAGCTACCCAAACTCTCCGGGAAGCAGCAGTACTTACCCTCACTCACCGGCGAGCTCTGATCCTGGAAGCCCTTTTCAAATACCAGCTGACACCCCTCCTCCAGCTTATATGCCTCCTGAGGATCAGATGACGCAAGACAACTCTCAGCCGATGGACACAAATATGATGGTGCCTAACATCTCTCAAGATATCAATAGAGCAGATGTACAAGCTGTTGCCTATGAAGAGCCAAAACACTGGTGCTCCATTGTCTATTATGAGCTGAACAACCGGTGTAGAGAAGCTTTCCATGCCTCCTCACAAAGGGNATTTGGGGGAACGGCTTCCCTGATCCTTCAACCAACAGAACAGATTTTGCCCTTGGGCTTCTGTCCAATGTCAACCGGGAACTCT
  5   1   2       bld Oo1                             IMAGE:6640231.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTCTGCATCAACCCATATCATTATAAACGAGTGGAGAGTCCTGTCTTGCCGCCTGTCCTTGTTCCACGGCACAGTGAGTACAACCCTCAACACAGTCTCCTTGCGCAATTCCGAAACTTGGAGCCAAGTGAGCCACACATGCCTCACAACGCAACTTTTCCCGACTCTTTCCAGCAGCCAAACAGCCATCCGTTCCCTCACTCGCCCAACAGCAGCTACCCAAACTCTCCGGGAAGCAGCAGTACTTACCCTCACTCACCGGCGAGCTCTGATCCTGGAAGCCCTTTTCAAATACCAGCTGACACCCCTCCTCCAGCTTATATGCCTCCTGAGGATCAGATGACGCAAGACAACTCTCAGCCGATGGACACAAATATGATGGTGCCTAACATCTCTCAAGATATCAATAGAGCAGATGTACAAGCTGTTGCCTATGAAGAGCCAAAACACTGGTGCTCCATTGTCTATTATGAGCTGAACAACCGTGTAGGAGAAGCTTTCCATGCCTCCTCCACAAGTGTATTGGTGGACGGCTTCACTGATCCTTCAAACAACAGGAACAGATTTTGCCTTGGGCTTCTGTCCAATGTCAACCGGGAACTCGACCATTGAGAACACCAGGGCGGCATATTGGGGAAAGGTGTGCATTTATACTACGTCCGGGGGTGAGGTCTATGCTGAATGCTTTAAGCGACAGCAGCAATTTTTGTTCAGAGTCGGAATTGTAACTTCCACCAGGGTTTTCATCCCTACACTGTGTGTAAAATCCCCANCGGGTGGCAAGTCTGGAAGATCTTTAACCAACCAGGGAATTTGGCTCAGCTTTTGTGCCCAATCCTGGAAACCAATGGCCTTTGAAAACGGCCTATGAAAACTGACAAAGATGGGGCACTTATTCCCAAATGGAATTTTGGTCCAGGGGCTggggggggggAAAATACATTCCGGAGGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)