Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xlk70g07ex.3                         43 END     11         50       25                (no blast hit)
     2   2.0    0Xl3.1-xlk64e11ex.3                         12 END     1           4        8                (no blast hit)
     3   2.0    0Xl3.1-XL495k08ex.5                         11 END     4          18       36                receptor tyrosin kinase [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     4   0.0    0Xl3.1-IMAGE:6633302.5                       7 PI      76        300      702                hypothetical protein LOC734241 [Xenopus laevis]
     5   0.0    0Xl3.1-IMAGE:8539195.5                       6 PI      76         75      702                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012775332 Xl3.1-XL047f20.3 - 22 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL047f20.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGTAGGTGAATTTGGTGAAGTGTGCAGTGGGCGTCTGAAGGTCCCTGGAAAGAGAGAGATTTATGTTGCAATTAAGACCCTGAAAGCTGGTTACACCGATAAGCAGAGGAGAGACTTTCTCAGTGAGGCCAGCATCATGGGTCAGTTTGACCATCCTAACATCATCCACCTTGAAGGTGTTGTCACCAAATGCAAGCCAGTGATGATAATCACCGAGTACATGGAGAACGGATCCTTGGATGCATTCCTTCGGAAGAATGATGGTCGGTTTACAGTAATACAGCTTGTGGGAATGCTGCGTGGCATTGGGTCTGGAATGAAATACCTTTCGGACATGAGTTATGTGCACCGGGACCTAGCTGCTCGTAATATCCTTGTGAACAGCAACCTAGTCTGTAAGGTCTCTGACTTTGGCATGTCTCGGGTGCTGGAAGATGACCCTGAAGCAGCCTACACAACCAGGGGTGGCAAGATCCCAATCCGATGGACTGCACCAGAAGCTATTGCATACAGGAAATTCACTTCTGCTAGTGATGTCTGGAGCTATGGCATTGTCATGTGGGAAGTCATGTCTTATGGAGAGAGGCCTTACTGGGATATGTCCAATCAAGATGTAATTAAAGCAATCGAGGAAGGATACAGGCTGCCCCCGCCTATGGACTGCCCTATTGCACTGCATCAGCTCATGTTGGACTGCTGGCAGAAGGATCGTAGTGACCGACCAAAATTTGGGCAGATAGTCAGCATGCTGGATAAACTCATCAGGAACCCAAACAGTTTGAAAAGGACTGGGCTGGAGAATTCAAGCAGAACAAATACGGCTCTGCTGGACCCCAGTTCGCCTGAATGGTCCCAGGTGGCTTCTGTGCTTGATTGGCTGCAGGCCATCAAAATGGAAAGATACAAAGATAACTTCACAGCAGCCGGATACACCAGCTTGGAAGCAGTCGTGCATGTGAATCAAGATGACTTGACCAGGATTGGCATTAGTTCCCCTTCACACCAGAACAAGATCCTGAGCAGCGTCCAAGGAATGAGGACCCAGTTGCAGCAAATGCAAGGCAGGATGGTTCCTGTTTGAAGCTGCAGGACGTCAAAGGGGGGGCAATTTCTCAGAACTCTTGAAAGAAAAATTAGTTTACCTCATCCATGCACTTTAATTGAAGAACTGCACTTTTTTTACATTATCCTCACCCCGTGGGACAAGGACTCTGCAGAAGTATTTGGGGATAAGCTGAAACTCATTTAACATGGAGCATTTGTGCAACACAGTTTTGGAAGATCGTGCGTCAGCAACTTAAGGATGTAGACAAAAAAAAAAAGACAACGTTGACATTTTAGAAACTTGGCTGAGTGTTTTCGTTCATGCGATTTACAAGACTTTAACCTTCTTCTCATGGATTATTTTACATGTAACATGGATATGTTTAAGCAATCAGTAAAAACAAGATTAAAAGGAAACCTTCACCAGGGTGGCGAAGTGAACCATCTTGTGATCTGCTGTTAAAGAGACAGAGCATTCTTGTGGGGAGGGAGGCAAACGATTATTGGCTGATCCTGGAAACCTTCTGTGCTCATTGGCTGGCTGACAGATTATCATTGGATAGTGCCTGAACTCCTTGGAGATAAAAGATATATATTTTGCCTGTGCTTCTGCTGCTAGAGAATATCAGATGTCA
                                                  Xl3.1-CHK-1012689347                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGAATTTGGTGAAGTGTGCAGTGGGCGTCTGAAGGTCCCTGGAAAGAGAGAGATTTATGTTGCAATTAAGACCCTGAAAGCTGGTTACACCGATAAGCAGAGGAGAGACTTTCTCAGTGAGGCCAGCATCATGGGTCAGTTTGACCATCCTAACATCATCCACCTTGAAGGTGTTGTCACCAAATGCAAGCCAGTGATGATAATCACCGAGTACATGGAGAACGGATCCTTGGATGCATTCCTTCGGAAGAATGATGGTCGGTTTACAGTAATACAGCTTGTGGGAATGCTGCGTGGCATTGGGTCTGGAATGAAATACCTTTCGGACATGAGTTATGTGCACCGGGACCTAGCTGCTCGTAATATCCTTGTGAACAGCAACCTAGTCTGTAAGGTCTCTGACTTTGGCATGTCTCGGGTGCTGGAAGATGACCCTGAAGCAGCCTACACAACCAGGGGTGGCAAGATCCCAATCCGATGGACTGCACCAGAAGCTATTGCATACAGGAAATTCACTTCTGCTAGTGATGTCTGGAGCTATGGCATTGTCATGTGGGAAGTCATGTCTTATGGAGAGAGGCCTTACTGGGATATGTCCAATCAAGATGTAATTAAAGCAATCGAGGAAGGATACAGGCTGCCCCCGCCTATGGACTGCCCTATTGCACTGCATCAGCTCATGTTGGACTGCTGGCAGAAGGATCGTAGTGACCGACCAAAATTTGGGCAGATAGTCAGCATGCTGGATAAACTCATCAGGAACCCAAACAGTTTGAAAAGGACTGGGCTGGAGAATTCAAGCAGAACAAATACGGCTCTGCTGGACCCCAGTTCGCCTGAATGGTCCCAGGTGGCTTCTGTGCTTGATTGGCTGCAGGCCATCAAAATGGAAAGATACAAAGATAACTTCACAGCAGCCGGATACACCAGCTTGGAAGCAGTCGTGCATGTGAATCAAGATGACTTGACCAGGATTGGCATTAGTTCCCCTTCACACCAGAACAAGATCCTGAGCAGCGTCCAAGGAATGAGGACCCAGTTGCAGCAAATGCAAGGCAGGATGGTTCCTGTTTGAAGCTGCAGGACGTCAAAGGGGGGGCAATTTCTCAGAACTCTTGAAAGAAAAATTAGTTTACCTCATCCATGCACTTTAATTGAAGAACTGCACTTTTTTTACATTATCCTCACCCCGTGGGACAAGGACTCTGCAGAAGTATTTGGGGATAAGCTGAAACTCATTTAACATGGAGCATTTGTGCAACACAGTTTTGGAAGATCGTGCGTCAGCAACTTAAGGATGTAGACAAAAAAAAAAAGACAACGTTGACATTTTAGAAACTTGGCTGAGTGTTTTCGTTCATGCGATTTACAAGACTTTAACCTTCTTCTCATGGATTATTTTACATGTAACATGGATATGTTTAAGCAATCAGTAAAAACAAGATTAAAAGGAAACCTTCACCAGGGTGGCGAAGTGAACCATCTTGTGATCTGCTGTTAAAGAGACAGAGCATTCTTGTGGGGAGGGAGGCAAACGATTATTGGCTGATCCTGGAAACCTTCTGTGCTCATTGGCTGGCTGACAGATTATCATTGGATAGTGCCTGAACTCCTTGGAGATAAAAGATATATATTTTGCCTGTGCTTCTGCTGCTAGAGAATATCAGATGTCAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     5     5     5     5     6     5     7     4     7     5     7     5     7     6     8     6     9     6     9     6     9     6     9     5     8     5     8     6     8     6     8     5     7     5     8     5     8     6     8     6     9     6     9     7     9     9     9     9     9     8     8     8     8     9     9     9     9     9     9     9     9     9     9    10    10     9    10    10    10    10    10     9     9     9     9     9     9     9     9     9     9     9     9     8     9     9     9     9     9     9     9     9    10    11    12    11    12    12    12    11    12    12    13    12    13    11    13    10    13    11    14    12    15    12    15    11    14    10    14    10    13     9    12     9    10     9    10     6     6     4     6     4     6     6     6     4     5     4     4     4     4     3     4     3     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     2     2     2     2     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----------G-
                                                                       ...PROTEIN --- Ce ---- 4e-081     NP_494807.1 ephrin receptor type-A, Variable ABnormal morphology VAB-1 (124.7 kD) (vab-1)[Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 3e-119     NP_726591.2 CG1511-PB, isoform B [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ag ---- 1e-119     XP_310604.4 AGAP000489-PA [Anopheles gambiae str. PEST] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ci ---- 1e-128     NP_001121576.1 ephrin receptor delta [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 2e-132     XP_001196893.1 PREDICTED: similar to Cek8, partial [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Bt ---- 4e-152     XP_611161.3 PREDICTED: similar to receptor protein-tyrosine kinase [Bos taurus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - ?? ---- 9e-155     XP_618422.4 PREDICTED: similar to ephrin receptor EphA5, partial [Bos taurus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 0          NP_001005919.1 epha4a [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 0          XP_536084.2 PREDICTED: similar to Ephrin type-A receptor 4 precursor (Tyrosine-protein kinase receptor SEK) (Receptor protein-tyrosine kinase HEK8) [Canis familiaris] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 0          NP_990112.1 Cek8 [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 0          NP_031962.2 Eph receptor A4; rabbit [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_004429.1 EphA4; Hek8; TYRO1 protein tyrosine kinase; ephrin receptor EphA4 [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 0          NP_001079461.1 receptor tyrosine kinase [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-XL047f20.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATG---------------------------------------------------------------ATG---------------ATG---------------------------------------------------------------------ATG---------------------ATG---------------ATG------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG---------------------------ATG------------------------------------------------------ATG---------------------------ATG---------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG---------ATG---------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------ATGTAG---------------------TGA---------------------------------------------------------------ATG------------------ATG---ATG------------------------------------------------------------------------------TAA---------------------------------------------TGA---------------------------------------------------------------------------------------------------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  5   1   2       bld Ga15                               XL491m18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGGCTGTCCGCGAATTTGCAAAGGAAATCGATGCCTCTTGTATTAAGATCGAAAAAGTAATTGGAGTAGGTGAATTTGGTGAAGTGTGCAGTGGGCGTCTGAAGGTCCCTGGAAAGAGAGAGATTTATGTTGCAATTAAGACCCTGAAAGCTGGTTACACCGATAAGCAGAGGAGAGACTTTCTCAGTGAGGCCAGCATCATGGGTCAGTTTGACCATCCTAACATCATCCACCTTGAAGGTGTTGTCACCAAATGCAAGCCAGTGATGATAATCACCGAGTACATGGAGAACGGATCCTTGGATGCATTCCTTCGGAAGAATGATGGTCGGTTTACAGTAATACAGCTTGTGGGAATGCTGCGTGGCATTGGGTCTGNAATGAAATACCTTTCGGACATGAGTTATGTGCACCGGGACCTANCTGCTCGTANTATCCTTGTGAACANCAACCTANT
  5   1   2       bld Te2       out                   IMAGE:7391348.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAAAGTAATTGGAGTAGGTGAATTTGGTGAAGTGTGCAGTGGGCGTCTGAAGGTCCCTGGAAAGAGAGAGATTTATGTTGCAATTAAGACCCTGAAAGCTGGTTACACCGATAAGCAGAGGAGAGACTTTCTCAGTGAGGCCAGCATCATGGGTCAGTTTGACCATCCTAACATCATCCACCTTGAAGGTGTTGTCACCAAATGCAAGCCAGTGATGATAATCACCGAGTACATGGAGAACGGATCCTTGGATGCATTCCTTCGGAAGAATGATGGTCGGTTTACAGTAATACAGCTTGTGGGAATGCTGCGTGGCATTGGGTCTGGAATGAAATACCTTTCGGACATGAGTTATGTGCACCGGGACCTAGCTGCTCGTAATATCCTCGTGAACAGCAACCTAGTCTGTAAGGTCTCTGACTTTGGCATGTCTCGGGTGCTGGAAGATGACCCTGAAGCAGCCTACACAACCAGGGGTGGCAAGATCCCAATCCGATGGACTGCACCAGAAGCTATTGCATACAGGAAATTCACTTCTGCTAGTGATGTCTGGAGCTATGGCATTGTCATGTGGGAAGTCATGTCTTATGGAGAGAGGCCTTACTGGGATATGTCCAATNCAGATGTAATTAAAGNCATCGAGGAAGGATACAGGCTGCCCCCGCCTATGGACTGCCCTATTGCACTGCATCAGCTCATGTTGGACTGCTGGCAGAAG
  5   1   2       bld DMZ       out                        xl313n11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCATACTGAGTATCTGTTGGCTTTGTGCAGTTGTTTTTTGTAATGGTCATATCTGTGCTTTGAATTGGCAGGCAAGCCAGTGATGATAATCACCGAGTACATGGAGAACGGATCCTTGGATGCATTCCTTCGGAAGAATGATGGTCGGTTTACAGTAATACAGCTTGTGGGAATGCTGCGTGGCATTGGGTCTGGAATGAAATACCTTTCGGACATGAGTTATGTGCACCGGGACCTAGCTGCTCGTAATATCCTTGTGAACAGCAACCTAGTCTGTAAGGTCTCTGACTTTGGCATGTCTCGGGTGCTGGAAGATGACCCTGAAGCAGCCTACACAACCAGGGGTGGCAAGATCCCAATCCGATGGACTGCACCAGAAGCTATTGCATACAGGAAATTCACTTCTGCTAGTGATGTCTGGAGCTATGGCATTGTCATGTGGGAAGTCATGTCTTATGGAGAGAGGCCTTACTGGGATATGTCCAATCAAGATGTAATTAAAGCAATCGAGGAAGGATACAGGCTGCCCCCGCCTATGGACTGCCCTATTGCACTACATCAGCTCATGTTGGACTGCTGGCAGAAGGATCGTAGTGACCGACCAAAATTTGGGCAGATAGTCAGCATGCTGGATAAACTCATCAGGAACCCAAACAGTTTGAAAAGGACTGGGCTGGAGAATTCAAGCAGAACAAATACGGCTCTGCTGGACCCCAGTTCGCCTGAATGGTCCCAGGT
  5   1   2       bld DMZ       out                        xl327i17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CATGGAGAACGGATCCTTGGATGCATTCCTTCNGAAGAATGATGGTCGGTTTACAGTAATACAGCTTGTGGGAATGCTGCGTGGCATTGGGTCTGGAATGAAATACCTTTCGGACATGAGTTATGTGCACCGGGACCTAGCTGCTCGTAATATCCTTGTGAACAGCAACCTAGTCTGTAAGGTCTCTGACTTTGGCATGTCTCGGGTGCTGGAAGATGACCCTGAAGCANCCTACACAACCAGGGGTGGCAAGATCCCAATCCGATGGACTGCACCANAAGCTATTGCATACAGGAAATTCACTTCTGCTAGTGATGTCTGGAGCTATGGCATTGTCATGTGGGAAGTCATGTCTTATGGANAGAGGCCTTACTGGGATATGTCCAATCAAGATGTAATTAAAGCAATCGAGGAAGGATACAGGCTGCCCCCGCCTATGGACTGCCCTATTGCACTACATCAGCTCATGTTGGACTGCTGGCAGAAGGATCGTAGTGACCGACCAAAATTTGGGCAGATAGTCAG
  5   1   2       bld Ga12      out                        XL176h21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCGAGTGCTGGAAGATGACCCTGAAGCAGCCTACACAACCGGGGTGGCAAGATCCCGATCCGATGGACAGCACCAGAAGCTATTGCGTACAGGAAATTCACCTCTGCCAGCGATGTCTGGAGCTATGGCATTGTCATGTGGGAAGTCATGTCTTATGGAGAGAGGCCCTACTGGGATATGTCCAATCAAGACGTTATTAAAGCAATCGAGGAAGGATACAGGCTGCCCCCACCAATGGACTGCCCTATCGCACTGCATCAGCTCATGTTGGACTGCTGGCAGAAGGAGCGTAGTGACCGACCAAAGTTTGGGCAAATAGTCAGCATGCTGGATAAGCTCATCAGGAACCCAAACAGTTTGAAAAGGACTGGTCTGGACAATTCAAGCAGAACAAATACGACTCTGCTGGACCCCAGCTCGCCTGAATGGTCCCAGGTGGCTTCTGTGCTTGATTGGCTGCAGGCCATCAAAATGGAAAGATACAAAGATAACTTCACAGCGGCCGGATACACCAGCTTGGAAGCAGACGTGCATGTAAATCAAGATGACCTGACCAGGATTGGCATTAGTTC
  5   1   2       bld Ga12      out                        XL163j04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGATGTCTGGAGCTATGGCATTGTNTGTGGGAAGTCATGTCTTATGGAGAGAGGCCTTACTGGGATATGTCCAATCNAGATGTAATTAAAGCAATCGAGGAAGGATACAGGCTGCCCCCGCCTATGGACTGCCCTATTGCACTGCATCAGCTCATGTTGGACTGCTGGCAGAAGGATCGTAGTGACCGACCAAAATTTGGGCAGATAGTCAGCATGCTGGATAAACTCATCAGGAACCCAAACAGTTTGAAAAGGACTGGGCTGGAGAATTCAAGCAGAACAAATACGGCTCTGCTGGACCCCAGTTCGCCTGAATGGTCCCAGGTGGCTTCTGTGCTTGATTGGCTGCAGGCCATCAAAATGGAAAGATACAAAGATAACTTCACAGCAGCCGGATACACCAGCTTGGAAGCAGTCGTGCATGTGAATCAAGATGACTTGACCAGGATTGGCATTAGTTCCCCTTCACACCAGAACAAGATCCTGAGCAGCGTCCAAGGAATGAGGACCCAGTTGCAGCAAATGCAAGGCAGGATGGTTCCTGTTTGAAGCTGCAGGACGTCAAAGGGGGGGCAATTTCTCAGAACTCTTGAAAGAAA
  3   1   2       bld Ga18      in                      xlk152g20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GNNCGCTTATGGAGAGAGGCCTTACTGGGATATGTCCAATCAAGATGTAATTAAAGCAATCGAGGAAGGATACAGNCNNNNCCCGCCTATGGACTGNCCTATTGCACTACATCAGCTCATGTTGGACTGCTGGCAGAAGGATCGTAGTGNCCGACCAAAATTTGGGCAGATAGTCAGCATGCTGGATAAACTCATCAGGAACCCAAACAGTTTGAAAAGGACTGGGCTGGAGAATTCAAGAACAAATANNNNNTGCTGGACCCCAGTTCGCCTGAATGGTCCCAGGTGGCTTCTGTGCTTGATTGGCTGCAGGCCATCAAAATGGAAAGATACAAAGATAACTTCACAGCGGCCGGATACACCAGCTTGGAAGCAGTCGTGCATGTGAATCAAGATGACTTGACCAGGATTGGCATTAGTTCCCCTTCACACCAGAACAAGATCCTGAGCAGCGTCCAAGGAATGAGGACCCAGTTGCAGCAAATGCAAGGCAGGATGGTTCCTGTTTGAAGCTGCAGGACGTCAAAGGGGGGGCAATTTCTCAGAACTCTTGAAAGAAAAATTAGTTTACCTCATCCATGCACTTTAATTGAAGAACTGCACTTTTTTTACATTATCCTCACCCGTGGGACAAGGACTCTGCAGAAGTATTTGGGGATAAGCTGAAACTCATTTAACATGGAGCATTTGTNCAANACAGTNNNNGAAGA
  5   1   2       bld Ga18      in                      xlk152g20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATGGAGAGAGGNCTTACTGGGATATGTCCAATCAAGATGTAATTAAAGCAATCGAGGAAGGATACAGGCTGCCCCCGCCTATGGACTGCCCTATTGCACTACATCAGCTCATGTTGGACTGCTGGCAGAAGGATCGTAGTGACCGACCAAAATTTGGGCAGATAGTCAGCATGCTGGATAAACTCATCAGGAACCCAAACAGTTTGAAAAGGACTGGGCTGGAGAATTCAAGAACAAATACGGCTCTGCTGGACCCCAGTTCGCCTGAATGGTCCCAGGTGGCTTCTGTGCTTGATTGGCTGCAGGCCATCAAAATGGAAAGATACAAAGATAACTTCACAGCGGCCGGATACACCAGCTTGGAAGCAGTCGTGCATGTGAATCAAGATGACTTGACCAGGATTGGCATTAGTTCCCCTTCACACCAGAACAAGATCCTGAGCAGCGTCCAAGGAATGAGGACCCAGTTGCAGCAAATGCAAGNNAGGATGGTTCCTGTTTGAAGCTGCAGGACGTCAAAGGGGGGGCAATTTCTCAGAACTCTTGAAAGAAAAATTAGTTTACCTCATCCATGCACTTTAATTGAAGAACTGCACTTTTTTTACATTATCCTCACCCCGTGGGNCAAGGACTCTGCAGAAGNATTTGGGGATAAGCTGAAACTCATTTAACATGGAGCATTTGTGCANNNNAGTTTTNGGAAGATCGTGCGT
  3   1   2      seed Neu7      out                        XL047f20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGAAGGATACAGGCTGCCCCCGCCTATGGACTGCCCTATTGCACTGCATCAGCTCATGTTGGACTGCTGGCAGAAGGATCGTAGTGACCGACCAAAATTTGGGCAGATAGTCAGCATGCTGGATAAACTCATCAGGAACCCAAACAGTTTGAAAAGGACTGGGCTGGAGAATTCAAGCAGAACAAATACGGCTCTGCTGGACCCCAGTTCGCCTGAATGGTCCCAGGTGGCTTCTGTGCTTGATTGGCTGCAGGCCATCAAAATGGAAAGATACAAAGATAACTTCACAGCAGCCGGATACACCAGCTTGGAAGCAGTCGTGCATGTGAATCAAGATGACTTGACCAGGATTGGCATTAGTTCCCCTTCACACCAGAACAAGATCCTGAGCAGCGTCCAAGGAATGAGGACCCAGTTGCAGCAAATGCAAGGCAGGATGGTTCCTGTTTGAAGCTGCAGGACGTCAAAGGGGGGGCAATTTCTCAGAACTCTTGAAAGAAAAATTAGTTTACCTCATCCATGCACTTTAATTGAAGAACTGCACTTTTTTTACATTATCCTCACCCCGTGGGACAAGGACTCTGCAGAAGTATTTGGGGATAAGCTGAAACTCATTTAACATGGAGCATTTGTGCAACACAGTTTGGAAGATCGTGCGTCAGCAAC
  3   1   2       bld Ga12      out                        XL220e15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTGCCCCCGCCTATGGACTGCCCTATTGCACTGCATCAGCTCATGTTGGACTGCTGGCCAGAAGGATGGTAGTGACCGACCAAAATTTGGGCAGATAGTCAGCATGCTGGATAAACTCATCAGGAACCCAAACAGTTTGAAAAGGACTGGGCTGGAGAATTCAAGCAGAACAAATACGGCTCTGCTGGACCCCAGTTCGCCTGAATGGTCCCAGGTGGCTTCTGTGCTTGATTGGCTGCAGGCCATCAAAATGGAAAGATACAAAGATAACTTCACAGCAGCCGGATACACCAGCTTGGAAGCAGTCGTGCATGTGAATCAAGATGACTTGACCAGGATTGGCATTAGTTCCCCTTCACACCAGAACAAGATCCTGAGCAGCGTCCAAGGAATGAGGACCCAGTTGCAGCAAATGCAAGGCAGGATGGTTCCTGTTTGAAGCTGCAGGACGTCAAAGGGGGGGCAATTTCTCAGAACTCTTGAAAGAAAAATTAGTTTACCTCATCCATGCACTTTAATTGAAGAACTGCACTTTTTTTACATTATCCTCACCCCGTGGGACAAGGACTCTGCAGAAGTATTTGGGGATAAGCTGAAACTCATTTAACATGGAGCATTTGTGCAACACAGTTTTGGAAGATTCGTGCGTCAGCAAC
  3   1   2       bld Ga12      out                        XL219o10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAACTCATCAGGGAANCCAAACAGTNTGAAAAGGACTGGGCTGGAGAATTCAAGCAGAACAAATNCGGCTNTGCTGGACCCCAGTTCGCCTGAATGGTCCCAGGTGGCTTCTGTGCTTGATTGGCTGCAGGCCATCAAAATGGAAAGATACAAAGATAACTTCACAGCAGCCGGATACACCAGCTTGGAAGCAGTCGTNCATGTGAATCAAGATGACTTGACCAGGATTGGCATTAGTTCCCCTTCACACCAGAACAAGATCNTGAGCAGCGTCCAAGGAATGAGGACCCAGTTGCAGCAAATGCAAGGCAGGATGGTTCCTGTTTGAAGCTGCAGGACGTCAAAGGGGGGGCAATTTCTCAGAACTCTTGAAAGAAAAATTAGTTTACCTCATGCCATGCACTTTAATTGAAGAACTGCACTTTTTTTACATTANGCCTCACCCCGTGGGACAAGGACTCTGCAGAAGTATTTGGGGATAAGCTGAAACTCATTTAACATGGAGCATTTGTGCAACACAGTTTTG
  5   1   2       bld Tad1                            IMAGE:6937466.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGGACTGGGCTGGAGAATTCAAGAACAAATACGGCTCTGCTGGACCCCAGTTCGCCTGAATGGTCCCAGGTGGCTTCTGTGCTTGATTGGCTGCAGGCCATCAAAATGGAAAGATACAAAGATAACTTCACAGCAGCCGGATACACCAGCTTGGAAGCAGTCGTGCATGTGAATCAAGATGACTTGACCAGGATTGGCATTAGTTCCCCTTCACACCAGAACAAGATCCTGAGCAGCGTCCAAGGAATGAGGACCCAGTTGCAGCAAATGCAAGGCAGGATGGTTCCTGTTTGAAGCTGCAGGACGTCAAAGGGGGGGCAATTTCTCAGAACTCTTGAAAGAAAAATTAGTTTACCTCATCCATGCACTTTAATTGAAGAACTGCACTTTTTTTACATTATCCTCACCCCGTGGGACAAGGACTCTGCAGAAGTATTTGGGGATAAGCTGAAACTCATTTAACATGGAGCATTTGTGCAACACAGTTTTGGAAGATCGTGCGTCAGCAACTTAAGGATGTAGACCaaaaaaaaaaGACAACGTTGACATTTTAGAAACTTGGCTGAATGTTTTCGTTCATGCGATTTACAAAACTTTTAACTTCTTCTCATGGATTTATTTTACATGTAACATGGGATATGGTTTAAGCCATTCAGTAAAAACCAAGATTTAAAAGGAAAACCTTTCACCAGGGTGGGCGCAAGTGAACCATCCTTGGGGATCCTGCCGTTTAAAGAA
  3   1   2       bld Ga15      out                      XL495k08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGCTGCAGGCCATCAAAATGGAAAGATNCAAAGATAACTTCACAGCAGCCGGATACACCAGCTTGGAAGCAGTCGTGCATGTGAATCAAGATGACTTGACCAGGATTGGCATTAGTTCCCCTTCACACCAGAACAAGATCCTGAGCAGCGTCCAAGGAATGAGGACCCAGTTGCAGCAAATGCAAGGCAGGATGGTTCCTGTTTGAAGCTGCAGGACGTCAAAGGGGGGGCAATTTNTCAGAACTCTTGAAAGAAAAATTAGTTTACCTCATCCATGCACTTTAATTGAAGAACTGCACTTTTTTTACATTATCCTCAGCCCCGTGGGANCAAGGGAGCTCTGCACGAAGTATTTGGGGATAAGCTGAAANCTCATTT
  5   1   2       bld Emb1                            IMAGE:6633183.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACCAGCTTGGAAGCAGTCGTGCATGTGAATCAAGATGACTTGACCAGGATTGGCATTAGTTCCCCTTCACACCAGAACAAGATCCTGAGCAGCGTCCAAGGAATGAGGACCCAGTTGCAGCAAATGCAAGGCAGGATGGTTCCTGTTTGAAGCTGCAGGACGTCAAAGGGGGGGCAATTTCTCAGAACTCTTGAAAGAAAAATTAGTTTACCTCATCCATGCACTTTAATTGAAGAACTGCACTTTTTTTACATTATCCTCACCCCGTGGGACAAGGACTCTGCAGAAGTATTTGGGGATAAGCTGAAACTCATTTAACATGGAGCATTTGTGCAACACAGTTTTGGAAGATCGTGCGTCAGCAACTTAAGGATGTAGACaaaaaaaaaaaGACAACGTTGACATTTTAGAAACTTGGCTGAGTGTTTTCGTTCATGCGATTTACAAGACTTTAACCTTCTTCTCATGGATTATTTTACATGTAACATGGATATGTTTAAGCAATCAGTAAAAACAAGATTAAAAGGAAACCTTCACCAGGGTGGCGAAGTGAACCATCTTGTGATCTGCTGTTAAAGAGACAGAGCATTCTTGTGGGGAGGGAGGCAAACGATTATTGGCTGATCCTGGAAACCTTCTGTGCTCATTGGCTGGCTGACAGATTATCATTGGATAGTGCCTGAACTCCTTGGAGATAAAAGATATATATTTTGCCTGTGCTTCTGCTGCTAGAGAATATCAGATGTCAAAAAAATGTTTATAAAGGGAATCCTCGTTTTTGCTTCCCCTTCAGCGAACCCATGGGGAAAACTGGGAGCAAGGAAGGGCATCCAGAGAATCAGAAGCCCATTTCATTTT
  3  -1   2       bld Tbd4                            IMAGE:4059845.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAAACGCTCAACTTTGGCAGATCTGAATTCCCCGGGAATTAGTTTACCTCATCCATGCACTTTAATTGAAGAACTGCACTTTTTTTACATTATCCTCACCCCGTGGGACAAGGACTCTGCAGAAGTATTTGGGGATAAGCTGAAACTCATTTAACATGGAGCATTTGTGCAACACAGTTTTGGAAGATCGTGCGTCAGCAACTTAAGGATGTAGACAAAAAAAAAAAGACAACGTTGACATTTTAGAAACTTGGCTGAGTGTTTTCGTTCATGCGATTTACAAGACTTTAACCTTCTTCTCATGGATTATTTTACATGTAACATGGATATGTTTAAGCCATC
  5   1   2       bld DMZ       out                        xl273h16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAACTCTTGAAAGAAAAATTAGTTTACCTCATCCATGCACTTTAATTGAAGAACTGCACTTTTTTTACATTATCCTCACCCCGTGGGACAAGGACTCTGCAGAAGTATTTGGGGATAAGCTGAAACTCATTTAACATGGAGCATTTGTGCAACACAGTTTTGGAAGATCGTGCGTCAGCAACTTAAGGATGTAGACaaaaaaaaaa
  5   1   2       bld DMZ       out                        xl292n04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAACTCTTGAAAGAAAAATTAGTTTACCTCATCCATGCACTTTAATTGAAGAACTGCACTTTTTTTACATTATCCTCACCCCGTGGGACAAGGACTCTGCAGAAGTATTTGGGGATAAGCTGAAACTCATTTAACATGGAGCATTTGTGCAACACAGTTTTGGAAGATCGTGCGTCAGCAACTTAAGGATGTAGACaaaaaaaaaa
  5   1   2       bld DMZ       out                        xl232p10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTGAAAGAAAAATTAGTTTACCTCATCCATGCACTTTAATTGAAGAACTGCACTTTTTTTACATTATCCTCACCCCGTGGGACAAGGACTCTGCAGAAGTATTTGGGGATAAGCTGAAACTCATTTAACATGGAGCATTTGTGCAACACAGTTTTGGAAGATCGTGCGTCAGCAACTTAAGGATGTAGACaaaaaaaaaa
  5   1   2       bld Tbd7      out                        XL064f01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGAACTGCACTTTTTTTACATTATCCTCACCCCGTGGGACAAGGACTCTGCAGAAGTATTTGGGGATAAGCTGAAACTCATTTAACATGGAGCATTTGTGCAACACAGTTTTGGAAGATCGTGCGTCAGCAACTTAAGGATGTAGACaaaaaaaaaaaGACANCGTTGNCATTTTANAAACTNGGCTGAGNGTTTTCGTTCATGCNATTTACAAGACTTTAACCTT
  5   1   2       bld DMZ       out                        xl301p23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGACAAGGACTCTGCAGAAGTATTTGGGGATAAGCTGAAACTCATTTAACATGGAGCATTTGTGCAACACAGTTTTGGAAGATCGTGCGTCAGCAACTTAAGGATGTAGACaaaaaaaaaa
  5   1   2       bld Neu7      out                        XL047b01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTTGGGGATAAGCTGAAACTCATTTAACATGGNAACATTTGTGCAACACAGTTTTGGAAGATCATGCGTCAGCAACTTAAGGATGTAGACaaaaaaaaaaGACAACGTTGACATTTTAGAAACTTGGCTGAGTGTTTTTGTTCATGCGATTTACAAGACTTTAACCTTCTTCTCATGGATTATTTTACATGTAACATGGATATTTTTAAGCAATCAATAAAANCAAGATTAAAAGGAAACCTTCACCAGGGTGGCGAAGTGAACCATCTTGTGATCTGCTGTTAAAGAGACAGAGCATTCTTGTGGGGAGGGTGGCAAACAATTATTGGCTGATTCTGGAAACCTTCTGTGCTCATTGGCTGGCTGACAGATTATCATTGGATAGTGCCTGAACTCCTTGGNGATAAAAGAATATATATTTGCCTGTGCTTCTGCTGCTAGAGAATATCAGATGTCAAAAAAATG
  5   1   2       bld Tbd7      out                        XL098k18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTGCAACACAGTTTTGGAAGATCGTGCGTCAGCAACTTAAGGATGTAGACaaaaaaaaaaaGACAACGTTGNCATTTTANAAACTTGGCTGAGNGTTTTCGTTCAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)