Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:6949052.5                      24 PI      94          9      804                myelin proteolipid protein (PLP) [Xenopus laevis]

 This cluster: approximate FL confidence score = 96%

 1012775621 Xl3.1-IMAGE:6946470.5 - 6 ESTs
                                                                       ....-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6946470.5               AAGAATCAGGGCTAGCCACACAAGCAGGTCCTCTTCCAAGAAGTCTATTTCCTGAACCATGGGTTGGCATGATGGCTGCATACGCTGCATGGTTGGGGTACCATTTGCTTCAGTCATTGCCACAGTCCTGTGTTTTGCCGGAGTGGCCCTATTCTGTGGCTGCGGACATGAGGCTTTGAGTGGAACAGAGAAGTTGATAGAGACATATTTTTCCAAAAACTACCAGGAGTATGAATACCTCATTCATGTAATTAATGCCTTTCAGTTTGTGATCTATGGAATTGCCATTTTCTTCTTTCTGTATGGGATCCTACTTTTGGCTGAGGGATTCTATACAACAACTGCCATCAAACACATCCTAGGAGAGTTCAAACCCCCAGCTATGAAGGGTGGGCTCATCTCTACAGTGACTGGAGGACCACCTAAAGGAAGAAGCACCAGGGGAAGGCAGCCAGTCCATACTATAGAGCTCATCTGCCGCTGCTTGGGAAAGTGGCTTGGACACCCCGATAAGTTTGTCGGTGTCACTTACGTTATCACTATTTTGTGGATCCTGATCTTTGCCTGCTCTGCTGTCCCTGTCTACATTTACTTCAATACTTGGGTCACCTGTCAGTCCATTGCATTCCCAGGGAAAACCACAACCAGTGTCAGTACCCTGTGTTTAGATGCTCGTATGTATGGTGTTCTGCCATGGAATGCTTTCCCAGGGAAAGTATGCGGGACCAGTCTGCTTGCCATCTGCAAGACCAGTGAGTTCCAGATGACATTTCACCTTTTTATTGCGGCATTTGTGGGTGCAGC
                                                  Xl3.1-CHK-1012703046                     CAGGGCTAGCCACACAAGCAGGTCCTCTTCCAAGAAGTCTATTTCCTGAACCATGGGTTGGCATGATGGCTGCATACGCTGCATGGTTGGGGTACCATTTGCTTCAGTCATTGCCACAGTCCTGTGTTTTGCCGGAGTGGCCCTATTCTGTGGCTGCGGACATGAGGCTTTGAGTGGAACAGAGAAGTTGATAGAGACATATTTTTCCAAAAACTACCAGGAGTATGAATACCTCATTCATGTAATTAATGCCTTTCAGTTTGTGATCTATGGAATTGCCATTTTCTTCTTTCTGTATGGGATCCTACTTTTGGCTGAGGGATTCTATACAACAACTGCCATCAAACACATCCTAGGAGAGTTCAAACCCCCAGCTATGAAGGGTGGGCTCATCTCTACAGTGACTGGAGGACCACCTAAAGGAAGAAGCACCAGGGGAAGGCAGCCAGTCCATACTATAGAGCTCATCTGCCGCTGCTTGGGAAAGTGGCTTGGACACCCCGATAAGTTTGTCGGTGTCACTTACGTTATCACTATTTTGTGGATCCTGATCTTTGCCTGCTCTGCTGTCCCTGTCTACATTTACTTCAATACTTGGGTCACCTGTCAGTCCATTGCATTCCCAGGGAAAACCACAACCAGTGTCAGTACCCTGTGTTTAGATGCTCGTATGTATGGTGTTCTGCCATGGAATGCTTTCCCAGGGAAAGTATGCGGGACCAGTCTGCTTGCCATCTGCAAGACCAGTGAGTTCCAGATGACATTTCACCTTTTTATTGCGGCATTTGTGGG
                                                      consensus depths                    3     3     3     3     3     3     3     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     4     6     4     6     4     6     3     6     3     6     2     6     2     6
                                               BLH ATG      58     537               
                                               BLH MIN      58      97               
                                               BLH MPR      58      97               
                                               BLH OVR      58     450               
                                               CDS MIN      58       1               
                                               EST CLI     -14       1               
                                               ORF LNG      58      31               
  5   1   2       add Tad2 5g                         IMAGE:6932318.5p GGAGTCAGAAAGAGAAGAATCAGGGCTAGCCACACAAGCAGGTCCTCTTCCAAGAAGTCTATTTCCTGAACCATGGGTTGGCATGATGGCTGCATACGCTGCATGGTTGGGGTACCATTTGCTTCAGTCATTGCCACAGTCCTGTGTTTTGCCGGAGTGGCCCTATTCTGTGGCTGCGGACATGAGGCTTTGAGTGGAACAGAGAAGTTGATAGAGACATATTTTTCCAAAAACTACCAGGAGTATGAATACCTCATTCATGTAATTAATGCCTTTCAGTTTGTGATCTATGGAATTGCCATTTTCTTCTTTCTGTATGGGACCCTACTTTTGGCTGAGGGATTCTATACAACAACTGCCATCAAACACATCCTAGGAGAGTTCAAACCCCCAGCTATGAAGGGTGGGCTCATCTCTACAGTGACTGGAGGACCACCTAAAGGAAGAAGCACCAGGGGAAGGCAGCCAGTCCATACTATAGAGCTCATCTGCCGCTGCTTGGGAAAGTGGCTTGGACACCCCGATAAGTTTGTCGGTGTCACTTACGTTATCACTATTTTGTGGATCCTGATCTTTGCCTGCTCTGCTGTCCCTGTCTACATTTACTTCAATACTTGGGTCACCTGTCAGTCCATTGCATTCCCAGGGGAAACCACAACCAGTGTCAGTACCCTGTGTTTAGATGCTCGTATGTATGGGTGTCTGCCATGGAATGCTTTTCCCAGGAAAGTATGCGGGAACCAGTCTGCCTGCCATCTGCAAGACCAGNGGAGTTTCCAGAATGACATTTTCACCTTTTTTTATTGCGGGCATTTTGTGGGGGTGGCAGCTTGCAAACACATTGGTGGGGCCCTGA
  5   1   2       add Tad1 5g                         IMAGE:6878162.5p   GGGGAGAAAGAGAAGAATCAGGGCTAGCCACACAAGCAGGTCCTCTTCCAAGAAGTCTATTTCCTGAACCATGGGTTGGCATGATGGCTGCATACGCTGCATGGTTGGGGTACCATTTGCTTCAGTCATTGCCACAGTCCTGTGTTTTGCCGGAGTGGCCCTATTCTGTGGCTGCGGACATGAGGCTTTGAGTGGAACAGAGAAGTTGATAGAGACATATTTTTCCAAAAACTACCAGGAGTATGAATACCTCATTCATGTAATTAATGCCTTTCAGTATGTGATCTATGGAATTGCCATTTTCTTCTTTCTGTATGGGATCCTACTTTTGGCTGAGGNATTCTATACAACAACTGCCATCAAACACATCCTAGGAGAGTTCAAACCCCCAGCTATGAAGGGTGGGCTCATCTCTACAGTGACTGGGAGGACACCCTAAAGGAGAAACCACCAGGGGAAAGCAGCCAGTTCATTATATAGAGCTCATCTGCCGCTGCTTTGGAAAATGGCCTGGGACCCCCCAGTAAGTTTTGTCGGTGGCCCCTTAACTTAATCCCTAATTTGGGGGAATCCCCGAAACTTTTGGCCCGGCCCCGGGGTGGCCCCCGGGTCAACATTTTTCCTTTAAAAAACCTGGGGGGACACCCGGTGGCAACCCCCTTTTGGTTTTTTccccgcggggaaaaaaacccaaacccccaggggggggtgaaaacccccccgggtgtttttaaaaaaacccccccccaaataagagaggggggggcccccccccccccAGGAGAAAGAAAAATGTTCTCTCCCCCCCGCGGAGAGAAGAAAAAC
  5   1   2       bld Eye1 5g                         IMAGE:6958827.5p               AAGAATCAGGGCTAGCCACACAAGCAGGTCCTCTTCCAAGAAGTCTATTTCCTGAACCATGGGTTGGCATGATGGCTGCATACGCTGCATGGTTGGGGTACCATTTGCTTCAGTCATTGCCACAGTCCTGTGTTTTGCCGGAGTGGCCCTATTCTGTGGCTGCGGACATGAGGCTTTGAGTGGAACAGAGAAGTTGATAGAGACATATTTTTCCAAAAACTACCAGGAGTATGAATACCTCATTCATGTAATTAATGCCTTTCAGTTTGTGATCTATGGAATTGCCATTTTCTTCTTTCTGTATGGGATCCTACTTTTGGCTGAGGGATTCTATACAACAACTGCCATCAAACACATCCTAGGAGAGTTCAAACCCCCAGCTATGAAGGGTGGGCTCATCTCTACAGTGACTGGAGGACCACCTAAAGGAAGAAGCACCAGGGGAAGGCAGCCAGTCCATACTATAGAGCTCATCTGCCGCTGCTTGGGAAAGTGGCTTGGACACCCCGATAAGTTTGTCGGTGTCACTTACGTTATCACTATTTTGTGGATCCTGATCTTTGCCTGCTCTGCTGTCCCTGTCTACATTTACTTCAATACTTGGGTCACCTGTCAGTCCATTGCATTCCCAGGGAAAACCACAACCAGTGTCAGTACCCTGTGTTTAGATGCTCGTATGTATGGTGTTCTGCCATGGAATGCTTTCCCAGGGAAAGTATGCGGGACCAGTCTGCTTGCCATCTGCAAGACCAGTGNAGTTCCAGATGACATTTCACCCTTTTTATTGGCGGCATTTTGTGGGGTGCAGCCTGCNAACACTTTGTTGGC
  5   1   2      seed Eye1 5g                         IMAGE:6946470.5p                                               TGGATCACTTGTCAAGGACTTAAATACTCGGTTGGCATGATGGCTGCATACGCTGCATGGTTGGGGTACCATTTGCTTCAGTCATTGCCACAGTCCTGTGTTTTGCCGGAGTGGCCCTATTCTGTGGCTGCGGACATGAGGCTTTGAGTGGAACAGAGAAGTTGATAGAGACATATTTTTCCAAAAACTACCAGGAGTATGAATACCTCATTCATGTAATTAATGCCTTTCAGTTTGTGATCTATGGAATTGCCATTTTCTTCTTTCTGTATGGGATCCTACTTTTGGCTGAGGGATTCTATACAACAACTGCCATCAAACACATCCTAGGAGAGTTCAAACCCCCAGCTATGAAGGGTGGGCTCATCTCTACAGTGACTGGAGGACCACCTAAAGGAAGAAGCACCAGGGGAAGGCAGCCAGTCCATACTATAGAGCTCATCTGCCGCTGCTTGGGAAAGTGGCTTGGACACCCCGATAAGTTTGTCGGTGTCACTTACGTTATCACTATTTTGTGGATCCTGATCTTTGCCTGCTCTGCTGTCCCTGTCTACATTTACTTCAATACTTGGGTCACCTGTCAGTCCATTGCATTCCCAGGGAAAACCACAACCAGTGTCAGTACCCTGTGTTTAGATGCTCGTATGTATGGTGTTCTGCCATGGAATGCTTTCCCAGGGAAAGTATGCGGGACCAGTCTGCTTGCCATCTGCAAGACCAGTGAGTTCCAGATGACATTTCACCTTTTTATTGCGGCATTTGTGGGTGCAGCCTGCACACTTGTGGCCCTGCTCACATATATGGGTAGGAGCATCATTCAACTATGCTGTGCCTTCGG
  5   1   2       bld Eye1 5g                         IMAGE:6945861.5p                                                    AAGAAGTCTATTTCCTGAACCATGGGTTGGCATGATGGCTGCATACGCTGCATGGTTGGGGTACCATTTGCTTCAGTCATTGCCACAGTCCTGTGTTTTGCCGGAGTGGCCCTATTCTGTGGCTGCGGACATGAGGCTTTGAGTGGAACAGAGAAGTTGATAGAGACATATTTTTCCAAAAACTACCAGGAGTATGAATACCTCATTCATGTAATTAATGCCTTTCAGTTTGTGATCTATGGAATTGCCATTTTCTTCTTTCTGTATGGGATCCTACTTTTGGCTGAGGGATTCTATACAACAACTGCCATCAAACACATCCTAGGAGAGTTCAAACCCCCAGCTATGAAGGGTGGGCTCATCTCTACAGTGACTGGAGGACCACCTAAAGGAAGAAGCACCAGGGGAAGGCAGCCAGTCCATACTATAGAGCTCATCTGCCGCTGCTTGGGAAAGTGGCTTGGACACCCCGATAAGTTTGTCGGTGTCACTTACGTTATCACTATTTTGTGGATCCTGATCTTTGCCTGCTCTGCTGTCCCTGTCTACATTTACTTCAATACTTGGGTCACCTGTCAGTCCATTGCATTCCCAGGGAAAACCACAACCAGTGTCAGTACCCTGTGTTTAGATGCTCGTATGTATGGTGTTCTGCCATGGAATGCTTTCCCAGGGAAAGTATGCGGGACCAGTCTGCTTGCCATCTGCAAGACCAGTGAGTTCCAGATGACATTTCACCCTTTTTATTGCGGCATTTTGGGGGTGCAAGCTGCAACACTTTGTGGGCCCTGCTCACATATTATGGGTAGGGAGCCATCCATTTCCAACTATGGCCTGTTGCTTTCCCAGATTTACATGGGCCCGCCAGGCCGATTCGCCTTTCAAAGAGTTTTTTAAA
  5   1   2       bld Tad2                            IMAGE:6872075.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAAGTTTGTCGGTGTCACTTACGTTATCACTATTTTGTGGATCCTGATCTTTGCCTGCTCTGCTGTCCCTGTCTACATTTACTTCAATACTTGGGTCACCTGTCAGTCCATTGCATTCCCAGGGAAAACCACAACCAGTGTCAGTACCCTGTGTTTAGATGCTCGTATGTATGGTGTTCTGCCATGGAATGCTTTCCCAGGGAAAGTATGCGGGACCAGTCTGCTTGCCATCTGCAAGACCAGTGAGTTCCAGATGACATTTCACCTTTTTATTGCGGCATTTGTGGGTGCAGCTGCAACACTTGTGGCCCTGCTCACACATATGGTAGGAGCATCATTCAACTATGCTGTGCTTCGAGTTACTGGCCGCAGCGATCGCTCAAAGTTTTAAACTTCGAGTCTGTGGTTGATAAAAACAAAGCTGAATCCTGAATTCATGGTTTTATTTATATGATTATaatgttcatgttttccttttattttcaaagtcttatttttgtttgtttgcattggaatttaGATAACATCGCTGGTGCTTTCCATGGAAAATCTGTATCTGCCTTTGGTTTCCCTAAACTCTTGGTTTAATCTAATAGAACATGTAAGAACTGCCCTAACGATATTAANGCAGGAATGCTAATCTCAGCCACTCATATATCTGATTCATCAACAAATGTAGGACCCACCTATAATTTAGAAAAAATGAAGAGTCCATGGAGAAGACATTTTATACTTTAATCTTGGGCCCCCaaaaaaaaaaaaTTTCTCTCTTTAAATAGGGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)