Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 96%

 1012775719 Xl3.1-IMAGE:3301655-IMAGp.5 - 10 ESTs
                                                                       .........-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:3301655-IMAGp.5                                        ATATTGAGGCATCCTAGCAACCGGCCTCCCTTCCGAAGTCTGCAGCGCACTGACAGCAGCAGGGAGCCCGAGAATCCAAATAAGTGCAGCACAACCGGCTGCTCTTAAGATAAAAAAAATAAATTAAAGAAACATATAGGTAATGGCAGAGGTCCACATCATAGGGCAGATCATTGGAGCTAGTGGCTTCCCCCAACACAGCTTGTTTTGCAAATGGGGACTACACACGGGTGGGGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCACCCGCAAAATGATGACATGGCATTTTGGTCTCACCCTATCGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGGAATGAGCTTTATGGTTACAGCTTCCTCCACATTCCTTCCACCCCTGGCACTCACACATTGCTTAGCCCAACCTGGCGACCTCTGGGAACGTGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGTGGTCCACAACTTAAGTCAGCCAGCTTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCGAATTAACAGTCATACTCAGGAACTTTGAACGATATGGGGTGGAGTCTTCTTGAAATCTGCAGAGTGCTGGTTTTCGAAATGAAATAATGATTATTATTGATGCCAAGGACATAAGCACTGAAATAATTAGCAAGACTTTATTTTATGTAATTACTTGTGAGCAACTTAGCCATTGTTGTAAAATTCCTCTCCGCATTCAATGACACCCTTTTCTCTCTTGTTTCTCACTAAAATTGATGTTTAACAATGTTTCATAATACTTCACCCACTAAGCAGTGTACAGGTATGTTTATATTAAGTAATTTGGGTCTTTTTGTTTTTAAATACTTTTCAGATTTTCTTAGCAGTTATCTTGAATCAGTTAATAGAGGAAATGTAATTCCAGTGGCTCTGCTGTCAGCTGTGCTATATATACACATGCAAATAACTTTGCCCTGTTTGACTCAGGTTGGTTATCTGACAAATTTTAAAATGTGTCTGTTCTTTCCAAATGGTT
                                                  Xl3.1-CHK-1012696169                                              AGGCATCCTAGCAACCGGCCTCCCTTCCGAAGTCTGCAGCGCACTGACAGCAGCAGGGAGCCCGAGAATCCAAATAAGTGCAGCACAACCGGCTGCTCTTAAGATAAAAAAAATAAATTAAAGAAACATATAGGTAATGGCAGAGGTCCACATCATAGGGCAGATCATTGGAGCTAGTGGCTTCCCCCAACACAGCTTGTTTTGCAAATGGGGACTACACACGGGTGGGGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCACCCGCAAAATGATGACATGGCATTTTGGTCTCACCCTATCGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGGAATGAGCTTTATGGTTACAGCTTCCTCCACATTCCTTCCACCCCTGGCACTCACACATTGCTTAGCCCAACCTGGCGACCTCTGGGAACGTGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGTGGTCCACAACTTAAGTCAGCCAGCTTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCGAATTAACAGTCATACTCAGGAACTTTGAACGATATGGGGTGGAGTCTTCTTGAAATCTGCAGAGTGCTGGTTTTCGAAATGAAATAATGATTATTATTGATGCCAAGGACATAAGCACTGAAATAATTAGCAAGACTTTATTTTATGTAATTACTTGTGAGCAACTTAGCCATTGTTGTAAAATTCCTCTCCGCATTCAATGACACCCTTTTCTCTCTTGTTTCTCACTAAAATTGATGTTTAACAATGTTTCATAATACTTCACCCACTAAGCAGTGTACAGGTATGTTTATATTAAGTAATTTGGGTCTTTTTGTTTTTAAATACTTTTCAGATTTTCTTAGCAGTTATCTTGAATCAGTTAATAGAGGAAATGTAATTCCAGTGGCTCTGCTGTCAGCTGTGCTATATATACACATGCAAATAACTTTGCCCTGTTTGACTCAGGTTGGTTATCTGACAAATTTTAAAATGTGTCTGTTCTTTCCAA
                                                      consensus depths                                             2     3     3     4     3     4     5     5     5     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     7     7     8     7     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     7     7     8     7     8     7     8     7     8     7     8     6     6     5     6     5     6     4     6     4     6     4     6     4     6     3     5     3     5     3     5     3     5     2     5     2     4     2     4     2     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3
                                                                   SNP                                                                                                                                                                                                                                                                ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                            A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                    ---------C--
                                               BLH ATG     142     586                                        
                                               BLH MIN     142      79                                        
                                               BLH OVR     142    1049                                        
                                               EST CLI       0       1                                        
                                               ORF LNG     142      27                                        
                                                                              PREDICTED - Gg ---- 3e-013     XP_414829.2 PREDICTED: similar to B9 [Gallus gallus] ---------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                          PROTEIN --- Xt ---- 3e-015     CAJ83871.1 novel protein similar to eppb9, endothelial precursor protein B9 [Xenopus tropicalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                       PREDICTED - ?? ---- 1e-015     XP_001790645.1 PREDICTED: B9 protein domain 1 [Bos taurus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                            PROTEIN === Dm ==== 1e-030     NP_608998.1 CG9227-PA [Drosophila melanogaster] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                            PROTEIN === Ag ==== 2e-031     XP_556085.3 AGAP005448-PA [Anopheles gambiae str. PEST] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                            PREDICTED = Ce ==== 4e-044     NP_500186.1 putative protein of bilaterial origin (4D70) [Caenorhabditis elegans] ======================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                            PREDICTED = Sp ==== 2e-071     XP_001175727.1 PREDICTED: similar to MGC82986 protein isoform 1 [Strongylocentrotus purpuratus] ===========================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                            PREDICTED = Cf ==== 3e-073     XP_533658.1 PREDICTED: similar to cDNA sequence BC028440 [Canis familiaris] ===============================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                            PREDICTED = Mm ==== 3e-075     NP_742160.1 hypothetical protein MGC41256 [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                            PROTEIN === Bt ==== 2e-075     NP_001035683.1 B9 protein domain 2 [Bos taurus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                            PREDICTED = Hs ==== 5e-076     NP_085055.1 hypothetical protein MGC4093 [Homo sapiens] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                            PREDICTED = Dr ==== 8e-081     XP_001923646.1 PREDICTED: similar to B9 domain-containing protein 2 isoform 1 [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                            PROTEIN === Xl ==== 3e-105     NP_001085984.1 MGC82986 protein [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                           Xl3.1-IMAGE:3301655-IMAGp.5                                            TGA---------------------------------------------------------------------------------------------------------------------TAA---------TAG---ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG------------------------------------------------------------------TGA---------------------------------ATG---------------------------------------------------------------------------------------------------------------TGA---------------------------------ATG---------------TAA------------TAA---------------------------TAA------------------TAA------------------TAG---------TGA------TAATAG---------------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                      [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  5   1   2      seed Egg2 5x3               IMAGE:3301655-IMAGp.IMAGp CGCGATGAGACCTGTAGCTTTGGGATTGTAGAGAAAACAATATTGAGGCATCCTAGCAACCGGCCTCCCTTCCGAAGTCTGCAGCGCACTGACAGCAGCAGGGAGCCCGAGAATCCAAATAAGTGCAGCACAACCGGCTGCTCTTAAGATaaaaaaaaTAAATTAAAGAAACATATAGGTAATGGCAGAGGTCCACATCATAGGGCAGATCATTGGAGCTAGTGGCTTCCCCCAACACAGCTTGTTTTGCAAATGGGGAGTACACACAGGTGGGGCCTGGAAGCTACTTTCTGGGGTCGTGGAAGGCCAGACACAAGTAGATCACCCGCAAAATGATGACATGGCATTCTGGTCTCACCCTATCGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGGAATGAGCTTTATGGTTACAGCTTCCTCCACATTCCTTCCACCCCTGGCACTCACACATTGCTTAGCCCAACCTGGCGACCTCTGGGAACGTGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGTGGTCCACAACTTAAGTCAGCCAGCTTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCGAATTAACAGTCATACTCAGGAACTTTGAACGATATGGGGTGGAGTCTTCTTGAAATCTGCAGAGTGCTGGTTTTCGAAATGAAATAATGATTATTATTGATGCCAAGGACATAAGCACTGAAATAATTAGCAAGACTTTATTTTATGTAATTACTTGTGAGCAACTTAGCCATTGTTGTAAAATTCCTCTCCGCATTCAATGACACCCTTTTCTCTCTTGTTTCTCACTAAAATTGATGTTTAACAATGTTTCATAATACT
  5   1   2       bld Egg1 5g                            PBX0041G05.5p                                        ATATTGAGGCATCCTAGCAACCGGCCTCCCTTCCGAAGTCTGCAGCGCACTGACAGCAGCAGGGAGCCCGAGAATCCAAATAAGTGCAGCACAACCGGCTGCTCTTAAGATaaaaaaaaTAAATTAAAGAAACATATAGGTAATGGCAGAGGTCCACATCATAGGGCAGATCATTGGAGCTAGTGGCTTCCCCCAACACAGCTTGTTTTGCAAATGGGGAGTACACACAGGTGGGGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCACCCGCAAAATGATGACATGGCATTCTGGTCTCACCCTATCGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAAGACACATTTGGTCGGAATGAGCTTTATGGTTACAGCTTCCTCCACATTCCTTCCACCCCTGGCACTCACACATTGCTT
  5   1   2       bld Egg1 5g                            PBX0160H09.5p                                        CACGAGGGGCATCCTAGCAACCGGCCTCCCTTCCGAAGTCTGCAGCGCACTGACAGCAGCAGGGAGCCCGAGAATCCAAATAAGTGCAGCACAACCGGCTGCTCTTAAGATaaaaaaaaTAAATTAAAGAAACATATAGGTAATGGCAGAGGTCCACATCATAGGGCAGATCATTGGAGCTAGTGGCTTCCCCCAACACAGCTTGTTTTGCAAATGGGGAGTACACACAGGTGGGGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCACCCGCAAAATGATGACATGGCATTCTGGTCTCACCCTATCGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGGAATGAGCTTTATGGTTACAGCTTCCTCCACATTCCTTCCACCCCTGGCACTCACACATTGCTTAGCCCAACCTGGCGACCTCTGGGAACGTGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGTGGTCCACAACTTAAGTCAGCCAGCTTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCGAATTAAC
  5   1   2       bld FaBN 5g3  in                    IMAGE:8074682.5p                                                TCGGTCCGGAATATCCGGGATCTTCCGAAGTCTGCAGCGCACTGACACTAACGGGGAGCCCGAGAATCCAAATAAGTGCAGCACAACCGGCTGCTCTTAAGATaaaaaaaaTAAATTAAAGAAACATATAGGTAATGGCAGAGGTCCGCATCATAGGGCAGATCATTGGAGCTAGTGGCTTCCCCCAACACAGCTTGTTTTGCAAATGGGGACTACACACGGGTGGGGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCACCCGCAAAATGATGACATGGCATTTTGGTCTCACCCTATCGAGATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGGAATGAGCTTTATGGTTACAGCTTCCTCCACATTCCTTCCACCCCTGGCACTCACACATTGCTTAGCCCAACCTGGCGACCTCTGGGAACGTGGCACGAGCAAATATGTCAAATGTTTGTTGGCGGTGGTCCACAACTTAAGTCAGCCAGCTTAGATTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGCGCATGGGGGCAGTACTTCTCTAATTAACAGTCTTACTCAGGAACTTTGAATGATATGGGGTGGAGTCTTTTTGAAATCTGCACAATGGTGGTTTTTCAAAATGAATAATGATTATATTGATGCCAACGACTTAGGCCTGAATTATTAGCAGGACTTATTTTAGTAATTCCTGTAGCAACTAACCATGTGTAAAATC
  5   1   2       bld Te2N 5x3                        IMAGE:7203945.5p                                                                        CCGAAGTCTGCAGCGCACTGACAGCAGCAGGGAGCCCGAGAATCCAAATAAGTGCAGCACAACCGGCTGCTCTTAAGATaaaaaaaaTAAATTAAAGAAACATATAGGTAATGGCAGAGGTCCACATCATAGGGCAGATCATTGGAGCTAGTGGCTTCCCCCAACACAGCTTGTTTTGCAAATGGGGACTACACACGGGTGGGGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCACCCGCAAAATGATGACATGGCATTTTGGTCTCACCCTATCGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGGAATGAGCTTTATGGTTACAGCTTCCTCCACATTCCTTCCACCCCTGGCACTCACACATTGCTTAGCCCAACCTGGCGACCTCTGGGAACGTGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGTGGTCCACAACTTAAGTCAGCCAGCTTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCGAATTAACAGTCATACTCAGGAACTTTGAACGATATGGGGTGGAGTCTTCTTGAAATCTGCAGAGTGCTGGTTTTCGAAATGAAATAATGATTATTATTGATGCCAAGGACATAAGCACTGAAATAATTAGCAAGACTTTATTTTATGTAATTACTTGTGAGCAACTTTAGCATTGTTGTAAAATTCCTCTCCGCATTCAATGACACCCTTTTTCTCTCTTGTTTTCTCATTAAAATGGATGTTTAACAAGTTTTCATAATATTCCACCCACTAACCATTGGTACAGGTATTTTTAAATTAAAGAAATTTGGGGTCCT
  5   1   2       bld Egg3 5x3                        IMAGE:6325359.5p                                                                             CCCCGGGGCGCACTGACAGCTCCAGGGAGCCCGAGAATCCAAATAAGTGCACCACAACCGGCTGCTCTTAAGATaaaaaaaaTAAATTAAAGAAACATATAGGTAATGGCAGAGGTCCACATCATAGGGCAGATCATTGGAGCTAGTGGCTTCCCCCAACACAGCTTGTTTTGCAAATGGGGACTACACACGGGTGGGGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCACCCGCAAAATGATGACATGGCATTTTGGTCTCACCCTATCGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGGAATGAGCTTTATGGTTACAGCTTCCTCCACATTCCTTCCACCCCTGGCACTCACACATTGCTTAGCCCAACCTGGCGACCTCTGGGAACGTGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGTGGTCCACAACTTAAGTCAGCCAGCTTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCGAATTAACAGTCATACTCAGGAACTTTGAACGATATGGGGTGGAGTCTTCTTGAAATCTGCAGAGTGCTGGTTTTCGAAATGAAATAATGATTATTATTGATGCCAAGGACATAAGCACTGAAATAATTAGCAAGACTTTATTTTATGTAATTACTTGTGAGCAACTTAGCCATTGTTGTNAAATTCCCTCTCCGCATTCAATGACACCCCTTTTCTCTCTTGGATTCTCACTAAAAATTGATGTTTAACAATGTTTTCATAATAACTTCACCCACCTAAGCAGTTGTACCAGGTATGGtttatatttaagtaattttggggtcttttttggtttttaaaatactttttCAGAATC
  5   1   2       bld Emb4 5x3                        IMAGE:5515964.5p                                                                                                                   TCCAATAAGTGCAGCACATCCGGCTGCTCTTAAGATaaaaaaaaTAAATTAAAGAAACATATAGGTAATGGCAGAGGTCCACATCATAGGGCAGATCATTGGAGCTAGTGGCTTCCCCCAACACAGCTTGTTTTGCAAATGGGGACTACACACGGGTGGGGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCACCCGCAAAATGATGACATGGCATTTTGGTCTCACCCTATCGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGGAATGAGCTTTATGGTTACAGCTTCCTCCACATTCCTTCCACCCCTGGCACTCACACATTGCTTAGCCCAACCTGGCGACCTCTGGGAACGTGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGTGGTCCACAACTTAAGTCAGCCAGCTTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCGAATTAACAGTCATACTCAGGAACTTTGAACGATATGGGGTGGAGTCTTCTTGAAATCTGCAGAGTGCTGGTTTTCGAAATGAAATAATGATTATTATTGATGCCAAGGACATAAGCACTGAAATAATTAGCAAGACTTTATTTTATGTAATTACTTGTGAGCAACTTAGCCATTTGTGTAAA
  3   1   2       bld FaBN 5g3  in                    IMAGE:8074682.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTTAGCCCACCTGGCAACCTTGGGAAACGGGCAAGAAGCAAATATGTCAGAATGTTTGTTGGCGGTGGGTCCACAACTTAAGTCAGCCAGCTTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCGAATTAACAGTCATACTCAGGAACTTTGAACGATATGGGGTGGAGTCTTCTTGAAATCTGCAGAGTGCTGGTTTTCGAAATGAAATAATGATTATTATTGATGCCAAGGACATAAGCACTGAAATAATTAGCAAGACTTTATTTTATGTAATTACTTGTGAGCAACTTAGCCATTGTTGTAAAATTCCTCTCCGCATTCAATGACACCCTTTTCTCTCTTGTTTCTCACTAAAATTGATGTTTAACAATGTTTCATAATACTTCACCCACTAAGCAGTGTACAGGTATGTTTATATTAAGTAATTTGGGTCTTTTTGTTTTTAAATACTTTTCAGATTTTCTTAGCAGTTATCTTGAATCAGTTAATAGAGGAAATGTAATTCCAGTGGCTCTGCTGTCAGCTGTGCTATATATACACATGCAAATAACTTTGCCCTGTTTGACTCAGGTTGGTTATCTGACAAATTTTAAAATGTGTCTGTTCTTTCCAAATGGTTTTACTGCAAATATCCTCGNTACACACTACGGCGNNTTTTGCCGG
  3   1   2       bld Egg1                            IMAGE:3301655.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAACGTGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGTGGTCCACAACTTAAGTCAGCCAGCTTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCGAATTAACAGTCATACTCAGGAACTTTGAACGATATGGGGTGGAGTCTTCTTGAAATCTGCAGAGTGCTGGTTTTCGAAATGAAATAATGATTATTATTGATGCCAAGGACATAAGCACTGAAATAATTAGCAAGACTTTATTTTATGTAATTACTTGTGAGCAACTTAGCCATTGTTGTAAAATTCCTCTCCGCATTCAATGACACCCTTTTCTCTCTTGTTTCTCACTAAAATTGATGTTTAACAATGTTTCATAATACTTCACCCACTAAGCAGTGTACAGGTATGTTTATATTAAGTAAATTGGGGTCTTTTTGTTTTTAAATAATTTTCAGATTTTCTTAGCAGTTATCTTGAATCAGTTAATAGAGGAAATGTAATTCCAGTGGCTCTGCTGTCAGCTGTGCTATATATACACATGCAAATAACTTTGCCCTGTTTGACTCAGGTTGGTTATCTGACAAATTTTAAAATGTGTCTGTTCTTTCCAAATGGTTTTTACTGCAAATATTTTTTTAGATAAAATTATATTTTAAAAAAAA
  3   1   2       bld Sp1                             IMAGE:4963005.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GACATAAGCACTGAAATAATTAGCAAGACTTTATTTTATGTAATTACTTGTGAGCAACTTAGCCATTGTTGTAAAATTCCTCTCCGCATTCAATGACACCCTTTTCTCTCTTGTTTCTCACTAAAATTGATGTTTAACAATGTTTCATAATACTTCACCCACTAAGCAGTGTACAGGTATGTTTATATTAAGTAATTTGGGTCTTTTTGTTTTTAAATAATTTTCAGATTTTCTTAGCAGTTATCTTGAATCAGTTAATAGAGGAAATGTAATTCCAGTGGCTCTGCTGTCAGCTGTGCTATATATACACATGCAAATAACTTTGCCCTGTTTGACTCAGGTTGGTTATCTGACAAATTTTAAAATGTGTCTGTTCTTTCCAAATGGTTTTTACTGCAAATATTTTTTTAGATAAAATTATATTTTATGAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)