Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 28 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6859281.5                      13 END     5          27       38                MGC84115 protein [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL426d03ex.5                          4 PI      96       1132     1356                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012775772 Xl3.1-IMAGE:8636191.3 - 18 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8636191.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGGAGCTGCACTATTGCACAGGAGCCTTCCGAATCTCTCCGGTGGATGTCAATAGCCGACCCTCCTCATGCCTCACCAACTTTCTCTTGAACGGTCGGTCTGTGCTGCTGGAACAGCCGCGGAAGTCTGGCTCCAAAGTGATCAGTCACATGCTCAGCAGCCACGGGGGCGAGATCTTCCTGCACGTGCTCAGTAGTTCCCGCTCCATTCTAGAGGACCCTCCATCGATCAGCGAAGGCTGCGGGGGCCGAGTGACGGATTACAGGATCACGGACTTTGGGGAGTTCATGAGGGAGAACAGACTGATGCCGTTTCCAGAGCAGAGCTATCAGATGGACGGGGGCCCCGAGGTGCCGTTGGAGAGGGCCAAGGAGCAGCTGGAGAGACACACTCGCTATTGGCCGATGATCATATCACAGACGACCATATTTAACATGCAGGCGGTGGTGCCGCTGGCCAGTGTTATAGTGAAGGAGTCTCTGAGTGAGGAGGACTTGCTGAACTGCCAGAAAACCATTTATAACCTGGTGGATATGGAACGAAAAAACGACCCCCTTCCCATCTCCACAGCTGGAACCAGAGGGAAAGGCCCAAAGAGGGATGAGCAGTATCGCATCATGTGGAACGAGCTGGAAACGCTGGTTCGGGCGCATGTGAGTGGGTCTGAGCGGCACCAGCGGGTGATGGAGTGTCTCATGGCGTGCAGGAGTAAACCCCCCGAGGAAGAGGAGCGCAAGAAACGAGGAAGGAAAAGAGAGGACAAGGAGGAGAAAGGGGAGAAGCTCAACAAGGACCATGAACATGACAAAAAGGGGCAGGAATCAGAGCGGATCAAATCTGTCTTGGACCGAGAGAAAGAGGATTTAGCTGAGGCCGAGGTGATCAAAGACTCCCCAGATTCCCCCGAGCCCCCCAACAAGAAGCCGCACATTGTGATTGAGGACACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCGCGGATCAACACGGCCAATTCGAGGAAACACCAGGAGTTCGTCGGGCGCCTGAACTCTGTAAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGGGGAGGGCGTGGAGAACGGCAAGGCGAGTCGCCAGTGATGCGTCGGTGGGATCCATTGGGTTCTGGACATTTCAATGAATTCACGAATATTCAGGACACATTGTAGAGAAATATCTTTTTCTTTTTTTTTTTTTTATATAGAATCTTGTTCAGACCCACGAGCTCTCTGTGTGAGGCACGGGGAGGTTTCTGTCGGGTGATGAATGAATGAAATTTTAATACAGTAACTTCCTTCCACTTTCCTGTGT
                                                  Xl3.1-CHK-1012690536                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGCACTATTGCACAGGAGCCTTCCGAATCTCTCCGGTGGATGTCAATAGCCGACCCTCCTCATGCCTCACCAACTTTCTCTTGAACGGTCGGTCTGTGCTGCTGGAACAGCCGCGGAAGTCTGGCTCCAAAGTGATCAGTCACATGCTCAGCAGCCACGGGGGCGAGATCTTCCTGCACGTGCTCAGTAGTTCCCGCTCCATTCTAGAGGACCCTCCATCGATCAGCGAAGGCTGCGGGGGCCGAGTGACGGATTACAGGATCACGGACTTTGGGGAGTTCATGAGGGAGAACAGACTGATGCCGTTTCCAGAGCAGAGCTATCAGATGGACGGGGGCCCCGAGGTGCCGTTGGAGAGGGCCAAGGAGCAGCTGGAGAGACACACTCGCTATTGGCCGATGATCATATCACAGACGACCATATTTAACATGCAGGCGGTGGTGCCGCTGGCCAGTGTTATAGTGAAGGAGTCTCTGAGTGAGGAGGACTTGCTGAACTGCCAGAAAACCATTTATAACCTGGTGGATATGGAACGAAAAAACGACCCCCTTCCCATCTCCACAGCTGGAACCAGAGGGAAAGGCCCAAAGAGGGATGAGCAGTATCGCATCATGTGGAACGAGCTGGAAACGCTGGTTCGGGCGCATGTGAGTGGGTCTGAGCGGCACCAGCGGGTGATGGAGTGTCTCATGGCGTGCAGGAGTAAACCCCCCGAGGAAGAGGAGCGCAAGAAACGAGGAAGGAAAAGAGAGGACAAGGAGGAGAAAGGGGAGAAGCTCAACAAGGACCATGAACATGACAAAAAGGGGCAGGAATCAGAGCGGATCAAATCTGTCTTGGACCGAGAGAAAGAGGATTTAGCTGAGGCCGAGGTGATCAAAGACTCCCCAGATTCCCCCGAGCCCCCCAACAAGAAGCCGCACATTGTGATTGAGGACACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCGCGGATCAACACGGCCAATTCGAGGAAACACCAGGAGTTCGTCGGGCGCCTGAACTCTGTAAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGGGGAGGGCGTGGAGAACGGCAAGGCGAGTCGCCAGTGATGCGTCGGTGGGATCCATTGGGTTCTGGACATTTCAATGAATTCACGAATATTCAGGACACATTGTAGAGAAATATCTTTTTCTTTTTTTTTTTTTxxxxxxxAxxxTTGTTCAGACCCACGAGCTxxxxxxGTGAGGCACGGGGAGGTTxxxxxxGGGTGATGAATGAATGAAATTTTAATACAGTAACTTCCTTCCACTTTC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     5     4     6     4     6     5     6     6     9     6     9     6     9     6     9     5     8     5     8     5     8     5     8     6     8     6     8     6     8     6     8     7     8     6     8     7     8     7     7     7     7     9     9     9     9     9     9     8     9     8     9     9     9     8     9     9    10     9     9     8     9     9     9    10    10     8    10     9    11    11    11    12    12    11    12    11    11    10    11    11    11     9    11    10    11    11    11    13    13    12    13    13    13    13    13    11    13    12    13    11    13    13    13    13    13    11    13    10    13    12    13    12    13    12    13    10    14    12    14    12    13    10    13    12    13     8    12     7    12     9    11     7    11     4    11     3     9     3     8     3     8     3     7     2     7     2     7     2     6     2     5     2     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------A-
                                                                       ...PROTEIN --- Ce ---- 6e-012     NP_499881.1 maternal transcript 89Bb like (89.7 kD) (4A986) [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 4e-012     XP_646812.1 hypothetical protein DDBDRAFT_0191071 [Dictyostelium discoideum AX4] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 5e-045     NP_524379.2 Maternal transcript 89Bb CG6814-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                     PROTEIN --- Ag ---- 4e-065     XP_307882.3 AGAP002295-PA [Anopheles gambiae str. PEST] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 2e-101     XP_001195717.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                             PREDICTED - Dr ---- 2e-177     NP_956177.1 Similar to hypothetical protein FLJ10637; wu:fi39e09 [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                PREDICTED - Mm ---- 0          NP_620096.2 hypothetical protein LOC71177 [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                PREDICTED - Hs ---- 0          NP_060634.2 hypothetical protein LOC55726 [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 0          XP_416439.2 PREDICTED: hypothetical protein [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                PREDICTED - Bt ---- 0          NP_001039964.1 hypothetical protein LOC541109 [Bos taurus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                        PREDICTED - Cf ---- 0          XP_865619.1 PREDICTED: similar to Protein C12orf11 (Sarcoma antigen NY-SAR-95) isoform 6 [Canis familiaris] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                             PROTEIN --- Xt ---- 0          CAJ83879.1 novel protein [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 0          NP_001086192.1 MGC84115 protein [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:8636191.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATG---------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG------------------------ATG---------------------------------------------------------------------ATG---------------------------ATG------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG---------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------ATG------------------------------------------------------------------------------------------------------------------------TGATGAATG------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  5   1   2       bld Ooc1      in                     Ooc1-db23a12.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGTCGACCCACGCGTCCGCCCAGGACTAACAGCGTGGAGCTGCACTATTGCACAGGAGCCTTCCGAATCTCTCCGGTGGATGTCAATAGCCGACCCTCCTCATGCCTCACCAACTTTCTCTTGAACGGTCGGTCTGTGCTGCTGGAACAGCCGCGGAAGTCTGGCTCCAAAGTGATCAGTCACATGCTCAGCAGCCACGGGGGCGAGATCTTCCTGCACGTGCTCAGTAGTTCCCGCTCCATTCTAGAGGACCCTCCATCGATCAGCGAAGGCTGCGGGGGCCGAGTGACGGATTACAGGATCACGGACTTTGGGGAGTTCATGAGGGAGAACAGACTGATGCCGTTTCCAGAGCAGAGCTATCAGATGGNACGGGGGCCCGAGGTGCCGTTGGAGAGGGCCAAGGAGCAGCTGGAGAGACACACTCGCTATTGGCCGATGATCATATCACAGACGACCATATTTAACATGCAGGCGGTGGTGCCGCTGGCCAGTGTTATAGTGAAGGAGTCTCTGAGTGAGGAGGACTTGCTGAACTGCCAGAAAACCATGTATAACCTG
  5   1   2       bld DMZ       in                         xl257n12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGGAGCTGCACTATTGCACAGGAGCCTTCCGAATCTCTCCGGTGGATGTCAATAGCCGACCCTCCTCATGCCTCACCAACTTTCTCTTGAACGGTCGGTCTGTGCTGCTGGAACAGCCGCGGAAGTCTGGCTCCAAAGTGATCAGTCACATGCTCAGCAGCCACGGGGGCGAGATCTTCCTGCACGTGCTCAGTAGTTCCCGCTCCATTCTAGAGGACCCTCCATCGATCAGCGAAGGCTGCGGGGGCCGAGTGACGGATTACAGGATCACGGACTTTGGGGAGTTCATGAGGGAGAACAGACTGATGCCGTTTCCAGAGCAGAGCTATCAGATGGACGGGGGCCCCGAGGTGCCGTTGGAGAGGGCCAAGGAGCAGCTGGAGAGACACACTCGCTATTGGCCGATGATCATATCACAGACGACCATATTTAACATGCAGGCGGTGGTGCCGCTGGCCAGTGTTATAGTGAAGGAGTCTCTGAGTGAGGAGGACTTGCTGAACTGCCAGAAAACCATTTATAACCTGGTGGATATGGAACGAAAAAACGACCCCCTTCCCATCTCCACAGCTGGAACCAGAGGGAAAGGCCCAAAGAGGGATGAGCAGTATCGCATCATGTGGAACGAGCTGGAAACGCTGGTTCGGGCGCATGTGAGTGGGTCTGANC
  5   1   2       bld Neu7                                 XL010j09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAGGCTGCGGGGGCCGAGTGACGGATTACAGGATCACGGACTTTGGGGAGTTCATGAGGGAGAACAGACTGATGCCGTTTCCAGAGCAGAGCTATCAGATGGACGGGGGCCCCGAGGTGCCGCTGGAGAGGGCCAAGGAGCAGCTGGAGAGACACACTCGCTATTGGCCGATGATCATATCACAGACGACCATATTTAACATGCAGGCGGTGGTGCCGCTGGCCAGTGTTATAGTGAAGGAGTCTCTGAGTGAGGAGGACTTGCTGAACTGCCAGAAAACCATTTATAACCTGGTGGATATGGAACGAAAAAACGACCCCCTTCCCATCTCCACAGCTGGAACCAGAGGGAAAGGCCCAAAGAGGGATGAGCAGTATCGCATCATGTGGAACGAGCTGGAAACGCTGGTTCGGGCGCATGTGAGTGGGTCTGAGCGGCACCAGCGGGTGATGGAGTGTCTCATGGCGTGCAGGAGTAAACCCCccgaggaagaggagcgcaagaaacgaggaaggaaaagagaggacaaggaggagaaaggGGAGAA
  5   1   2      seed Ga15                               XL446m16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCACAGACGACCATATTTAACATGCAGGCGGTGGTGCCGCTGGCCAGTGTTATAGTGAAGGAGTCTCTGAGTGAGGAGGACTTGCTGAACTGCCAGAAAACCATTTATAACCTGGTGGATATGGAACGAAAAAACGACCCCCTTCCCATCTCCACAGCTGGAACCAGAGGGAAAGGCCCAAAGAGGGATGAGCAGTATCGCATCATGTGGAACGAGCTGGAAACGCTGGTTCGGGCGCATGTGAGTGGGTCTGAGCGGCACCAGCGGGTGATGGAGTGTCTCATGGCGTGCAGGAGTAAACCCCCCGAGGAAGAGGAGCGcaagaaacgaggaaggaaaagagaggacaaggaggagaaaggggagaagctcaacaaggaCCATGAACATGACAAAAAGGGGCAGGAATCAGAGCGGATCAAATCTGTCTTGGACCGAGAGAAAGAGGATTTAGCTGAGGCCGAGGTGATCAAAGACTCCCCAGATTCCCCCGAGCCCCCCAACAAGAAGCCGCACATTGTGATTGAGGACACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCGCGGATCAACACGGCCAATTCGAGGAAACACCAGGAGTTCGTCGGGCGCCTGAACTCTGTAAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGGGGAGGGCGTGGAGAACGGCAANGCGAGTCGCCANTGATGCGTC
  5   1   2       bld Lmb2      in                    IMAGE:8636191.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAATATATaaaaaaaaTTCTCTCTTAAAAGATTCGTCCCGAAGGAGTCTCTGAGTGAGGAGGACTTGCTGAACTGCCAGAAAACCATTTATAACCTGGTGGATATGGAACGAAAAAACGACCCCCTTCCCATCTCCACAGCTGGAACCAGAGGGAAAGGCCCAAAGAGGGATGAGCAGTATCGCATCATGTGGAACGAGCTGGAAACGCTGGTTCGGGCGCATGTGAGTGGGTCTGAGCGGCACCAGCGGGTGATGGAGTGTCTCATGGCGTGCAGGAGTAAACCCCCCGAGGAAGAGGAGCGcaagaaacgaggaaggaaaagagaggacaaggaggagaaaggggagaagctcaacaaggaCCATGAACATGACAAAAAGGGGCAGGAATCAGAGCGGATTAAATCTGTCTTGGACCGAGAGAAAGAGGATTTAGCTGAGGCCGAGGTGATCAAAGACTCCCCAGATTCCCCCGAGCCCCCCAACAAGAAGCCGCACATTGTGATTGAGGACACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCGCGGATCAACACGGCCAATTCGAGGAAACACCAGGAGTTCGTCGGGCGCCTGAACTCTGTAAATAACAAGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGGGAGGGCGTGAGAACGGCAAGGCGAGTCGCCAGTGATGCGTCGTGGATCCATTGGGTTCTGGACATTTCATGAATTCACGAATATTCAGGACACATTGTAAAGAAATA
  3   1   2       bld Brn1 5g3  out                   IMAGE:6950192.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAGGGAGTTTTCCTGGAGGGAAGGGAAGGAACTTGGTGTAATTGCCCCGGAAAAACCCATTTTATAAACCCTGGGTGGAATTGGGAAAGGAAAAAAACCGGCCCCCCTTTCCAATTTTTCCACAGGTGGAAACCAGAGGGGAAAGGGCCCAAAGGAGGGATGAGGCAGTATTCGCTTTATTGGGGAACGGAGCTGGAAAACGCTGGTTTCGGGCGGCATGTGAGTGGGTTTTGAGCGGCACCAGCGGGTGATGGAGTGTCTCATGGCGTGCAGGAGTAAACCCCCCGAGGAAGAAGAGCGCAAGAAACGAGGAAGGAAAAGAGAGGACAAGGAGGAGAAAGGGGAGAAGCTCAACAAGGACCATGAACATGACAAAAAGGGGCAGGAATCAGAGCGGATCAAATCTGTCTTGGACCAAGAGAAAGAGGATTTAGCTGAGGCCGAGGTGATCAAAGACTCCCCAGATTCCCCCGAGCCCCCCAACAAGAAGCCGCACATTGTGATTGAGGACACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCGCGGATCAACACGGCCAATTCGAGGAAACACCAGGAGTTCGTCGGGCGCCTGAACTCTGTAAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGGGGAGGGCGTGGAGAACGGCAAGGCGAGTCGCCAGTGATGCGTCGGTGGGATCCATTGGGTTCTGGACATTTCAATGAATTCACGAATATTCAGGACACATTGTAGAGAAATATCTTTTTCTTTTTTTTTTTTTTATATAGAATCTTGTTCAGACCCACGAGCTGCTCTGTGTGAGGCACGGGGAGGTTCTGTCGGGTGATGAATGAATGAAATTTTAATACAGTAACTTCCTTCCACTTTCCTGTGTTGTCACTAGTTCGGCG
  3   1   2       bld Lmb2      in                    IMAGE:8636191.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGGTCACGAGGAGTCTTGGAGGTAGAGGACTTGGTGAACTGCCAGTAAACCATTAACTGGTGATATGGACGAAAAACGACCCCCATCCCATCTCACAGCTGAACCAGAGGGAAAGGCCCAAAGAGGGATGAGCAGTATCGCATCATGTGGAACGAGCTGGAAACGCTGGATCGGGCGCATGTGAGTGGGTCTGAGCGGCACCAGCGGGTGATGGAGTGTCTCATGGCGTGCAGGAGTAAACCCCCCGAGGAAGAGGAGCGCAAGAAACGAGGAAGGAAAAGAGAGGACAAGGAGGAGAAAGGGGAGAAGCTCAACAAGGACCATGAACATGACAAAAAGGGGCAGGAATCAGAGCGGATTAAATCTGTCTTGGACCGAGAGAAAGAGGATTTAGCTGAGGCCGAGGTGATCAAAGACTCCCCAGATTCCCCCGAGCCCCCCAACAAGAAGCCGCACATTGTGATTGAGGACACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCGCGGATCAACACGGCCAATTCGAGGAAACACCAGGAGTTCGTCGGGCGCCTGAACTCTGTAAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGGGGAGGGCGTGGAGAACGGCAAGGCGAGTCGCCAGTGATGCGTCGGTGGGATCCATTGGGTTCTGGACATTTCAATGAATTCACGAATATTCAGGACACATTGTAGAGAAATATCTTTTTCTTTTTTCTTTTTTTATATAGAATCTTGTTCAGACCCACGAGCTGCTCTGTGTGGGCCACGGAGACGCTCGTGGCCCACACAGAGCAGCTTCGTTGGTTCTAAAT
  5   1   2       bld Eye1      in                    IMAGE:4743706.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGTCTCTGAGTGAGGAGGACTTGCTGAACTGCCAGAAAACCATTTATAACCTGGTGGATATGGAACGAAAAAACGACCCCCTTCCCATCTCCACAGCTGGAACCAGAGGGAAAGGCCCAAAGAGGGATGAGCAGTATCGCATCATGTGGAACGAGCTGGAAACGCTGGTTCGGGCGCATGTGAGTGGGTCTGAGCGGCACCAGCGGGTGATGGAGTGTCTCATGGCGTGCAGGAGTAAACCCCCCGAGGAAGAAGAGCGcaagaaacgaggaaggaaaagagaggacaaggaggagaaaggggagaagctcaacaaggaCCATGAACATGACAAAAAGGGGCAGGAATCAGAGCGGATCAAATCTGTCTTGGACCAAGAGAAAGAGGATTTAGCTGAGGCCGAGGTGATCAAAGACTCCCCA
  3   1   2       bld Em10 5g3  out                   IMAGE:7981060.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGACATGTAAAGAAGAGTTTGGGTAGGGGACTCAGAATGCCAGAAACCCTTTTATCTAGGGAAAGGGAGGAAAAAAGCCCCCATCCATTTCCCAAGTGGAACCAGAGGAAAAGCCCAAAGAGGATGAGCAGATCGCATCATGTGAACGAGCTGGAAACGTTGGTTCGGGCGCATGTGAGTGGGTCTGAGCGGCACCAGCGGGTGATGGAGTGTCTCATGGCGTGCAGGAGTAAACCCCCCGAGGAAGAAGAGCGCAAGAAACGAGGAAGGAAAAGAGAGGACAAGGAGGAGAAAGGGGAGAAGCTCAACAAGGACCATGAACATGACAAAAAGGGGCAGGAATCAGAGCGGATCAAATCTGTCTTGGACCAAGAGAAAGAGGATTTAGCTGAGGCCGAGGTGATCAAAGACTCCCCAGATTCCCCCGAGCCCCCCAACAAGAAGCCGCACATTGTGATTGAGGACACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCGCGGATCAACACGGCCAATTCGAGGAAACACCAGGAGTTCGTCGGGCGCCTGAACTCTGTAAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGGGGAGGGCGTGGAGAACGGCAAGGCGAGTCGCCAGTGATGCGTCGGTGGGATCCATTGGGTTCTGGACATTTCAATGAATTCACGAATATTCAGGACACATTGTAGAGAAATATCTTTTTCTTTTTTTTTTTATATAGAATCTTGTTCAGACCCACGAGCTGCTCTGTGTGAGGCACGGGGCGGCTCGTCCTCACACAGAGCAGCTCGGGCGACAGTC
  3   1   2       bld Neu7 5g3  out                        XL021n02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAGCGGGTGATGGAGTGTCTCATGGCGTGCAGGAGTAAACCCCCCGAGGAAGAGGAGCGCAAGAAACGAGGAAGGAAAAGAGAGGACAAGGAGGAGAAAGGGGAGAAGCTCAACAAGGACCATGAACATGACAAAAAGGGGCAGGAATCAGAGCGGATCAAATCTGTCTTGGACCGAGAGAAAGAGGATTTAGCTGAGGCCGAGGTGATCAAAGACTCCCCAGATTCCCCCGAGCCCCCCAACAAGAAGCCGCACATTGTGATTGAGGACACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCGCGGATCAACACGGCCAATTCGAGGAAACACCAGGAGTTCGTCGGGCGCCTGAACTCTGTAAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGGGGAGGGCGTGGAGAACGGCAAGGCGAGTCGCCAGTGATGCGTCGGTGGGATCCATTGGGTTCTGGACATTTCAATGAATTCACGAATATTCAGGACACATTGTAGAGAAATATCTTTTTCTTTTTTnTTTTTTNATATAGAATCCTTGTTCAGACCCACGAGCTGACTTCTGTGTGGGCC
  3   1   2       add DMZ       in                         xl257n12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCGGGTGATGGAGTGTTTCATGGCGTGCAGGAGTAAACCCCCCGAGGAAGNGGAGCGCNAGAAACGNGGAAGGAAAAGNGNGGACAAGGNGGNGAAAGGGGNGAAGCTCAACAAGGNCCNTGAACNTGACAAAAAGGGGCNGGAATCAGAGNGGATCAAATNTNTNTTGGACCGAGANAAAGAGGATTTAGCTGAGGCCGNGGNGATCAAAGACTCCCCAGATTNCCCCGAGCCCCCCAACAAGAAGCCNCNCNTTGTGATTGNGGACNCGGGTCCTGCAGAGAAATTTAAAGGCCCCNTGTCCTTGTTGTCTTTATGGAGCTCGNGGATCAACCCGGCCAATTNGAGGAAACCCCNGGAGTTNGTNGGGCNCCTGAACTNTGTAAATAACAAGGNTGAGTTNTNTCAGCNTTTCAAGGAGGAGAATGGGGGGGAGGGCGTGGAGAACGGCAAGNNGAGTCGCCNGTGATGCGTCGGTGGGATCCNTTGGGTTNTGGNCNTTTCAATGAATTCNCGAATNTTCCGGNCCCNTTGTAGAGAAATATCTTTTTnTTTTTTTTTTTTTTNTATAGAAT
  3   1   2       add DMZ       out                        xl269c14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGGAGAAAGGGGNGAAGCTCAACAAGGACCATGAACATGACAAAAAGGGGCAGGAATCAGAGNGGATCAAATNTNTNTTGGACCGAGAGAAAGAGGATTTAGCTGAGGCCGAGGTGATCAAAGACTCCCCAGATTNCCCCGAGCCCCCCAACAAGAAGCCNCNCNTTGTGATTGAGGACNCGGGTCCTGCAGAGAAATTTAAAGGCCCCNTGTCCTTGTTGTCTTTATGGAGCTCGNGGATCAACNCGGCCAATTCGNGGAAACNCCNGGAGTTTGTNGGGCNCCTGAACTNTGTAAATAACAAGGNTGAGTTATNTCAGCATNTCAAGGAGGAGAATGGGGGGGAGGGCGTGGAGAACGGCAAGGCGAGTCNCCNGTGATGCGTCGGTGGGATCCNTTGGGTTNTGGACNTTTCAATGAATTCNCGAATNTTCNGGNCCCNTTGTAGNGAAANATNTTTTTnTTTTTTTTTTTTTATATAGAATCTTGTTCAGACCCACGAGCTGCTCTGTGTGGGCCACGGAGAGGTTCTGTCGGTTATGAATGAATGAAATTTTAATACAGTAACTTCCTTCCACTTTACTGTGTTG
  3   1   2       bld Ga15 5g3  out                      XL430k16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACAAAAAGGGGCAGGAATCAGAGCGGATTAAATCTGTCTTGGACCGAGAGAAAGAGGATTTAGCTGAGGCNGAGGTGATCAAAGACTCCCCAGATTCCCCCGAGCCCCCCAACAAGAAGCCGCACATTGTGATTGAGGACACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCGCGGATCAACACGGCCAATTCGAGGAAACACCAGGAGTTCGTCGGGCGCCTGAACTCTGTAAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGGGGAGGGCGTGGAGAACGGCAAGGCGAGTCGCCAGTGATGCGTCGGTGGGATCCATTGGGTTCTGGACATTTCAATGAATTCAACGAATATTCAGGACNCATTGTAGAGAAATATCTTTTTCTCTTTTTCTTTTTTTACTATAGGAATC
  5   1   2       bld Neu4                            IMAGE:3475542.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTAAATCTGTCTTGGACCGAGAGAAAGAGGATTTAGCTGAGGCCGAGGTGATCAAAGACTCCCCAGATTCCCCCGTGCCCCCCAACAAGAAGCCGCACATTGGGATTGAGGACACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCGCGGATCAACACGGCCAATTCGAGGAAACACCAGGAGTTTGTNGGGCGCCTGAACTCTGTAAATAACAAGGCTGAGTTATATCAGCATTTCAAGGAGGAGAATGGGGGGGAGGGCGTGGAGAACGGTAAGGCGAGTTGCCAGTGATGCGTCGGTGGGATCCATTGGGTTTTGGACATTTCAATGAATT
  3   1   2       bld Ooc1      in                     Ooc1-db23a12.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATTTAGCTGAGGCCGAGGTGATCAAAGACTCCCCAGATTCCCCCGAGCCCCCCAACAAGAAGCCGCACATTGTGATTGAGGACACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCGCGGATCAACACGGCCAATTCGAGGAAACACCAGGAGTTCGTCGGGCGCCTGAACTCTGTAAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGGGGAGGGCGTGGAGAACGGCAAGGCGAGTCGCCAGTGATGCGTCGGTGGGATCCATTGGGTTCTGGACATTTCAATGAATTCACGAATATTCAGGACACATTGTAGAGAAATATCTTTTTCTTTTTTTTTTTTTATATAGAATCTTGTTCAGACCCACGAGCTGCTCTGTGTGAGGCACGGGGAGGTTCTGTCGGGTGATGAATGAATGAAATTTTAATACAGTAACTTCCTTCCAAAAAAAAAA
  3   1   2       add Ga15 5g3  out                      XL480c22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCAGAGAAATCTAAAGGCCCCATNTCCTTGTTGTCTTTANGGAGCTCGCGGATCAACACGNCCAATTCGAGGAAACACCAGGAGTTCGTCGGGCGCCTGAACTNTGTAAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGNAGAATGGGGGGGAGGGCGTGGAGAACGGCAAGGCGAGTCGCCAGTGATGCGTCGGTGGGATCCATTGGGTTCTGGACATTTCAATGAATTCNCGAATATTCANANCACATNGTAGAGAAATATCTTTTTCTnTTTTCTTTTTTTATATAGAATTNTTGTTCAGA
  3   1   2       bld Tbd3                            IMAGE:3549509.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCGCGGATCAACACGGCCAATTCGAGGAAACACCAGGAGTTCGTCGGGCGCCTGAACTCTGTAAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGGGGAGGGCGTGGAGAACGGCAAGGCGAGTCGCCAGTGATGCGTCGGTGGGATCCATTGGGTTCTGGACATTTCAATGAATTCACGAATATTCAGGACACATTGTAAAGAAAAATCTTTTTCTTTTTTTTTTTTTTAAAAAGAATCTTGTTCAGACCCACGAGCTGCTCTGTGTTAGGCACGGGGAGGTTCTGTCGGGTGATGAATGAATGAAATTTTAATACAGTAACTTCCTTCCACTTTCCTGTGTTTGTCACTTTGTTCTGTCGCTGGAGATTAAAGAGTTTTTTTGGTAAAAAAAAAAAAAAAAA
  3   1   2       add Eye1      in                    IMAGE:4743706.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAACGGCAAGGCGAGTCGCCAGTGATGCGTCGGTGGGATCCATTGGGTTCTGGACATTTCAATGAATTCACGAATATTCAGGACCCATTGTAGAGAAATATCTTTTTCTTTTTTTTTTTCCACACACAATCTTGTTCAGACCCACGAGCTGCTCTGTGTGAGGCACGGGGAGGTTCTGTCGGGTGATGAATGAATGAAATTTTAATACAGTAACTTCCTTCCCAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)