Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 18 Jan 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL477f10ex.5                         62 END     4          44        6                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL477f10ex.5                         62 PI      86          1      715                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012775783 Xl3.1-XL025i18.3 - 9 ESTs
                                                                       -150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL025i18.3                                                                                                                                                       TGGATACAGCATGTACCATCTGTCCTAAGACTTGTTTATGCTCCATTGAGACTGTGGGAAAGAAGACTTGAGTGATTTTTTCTTGCACTCCCTATATTTTTTCACTATTTATGAGTTCCTAGGGAATTGAATTGTAGAAATACTATGTCACTTCAATATGCCTATTGTCATCTTGTTAGCTGTGTCTAAATCATGAGTTCCAGGTGTCTTGCTCACTACCAGCTTCCCAAGTTCTTATCCCAGTCCATAAAGTATCAGAACCGAGGGGATATCTGTAACCTTGAAAGCACCAAACCCACTGCTTCAGGAGTTGTCCTACATTGTAGGGAAAGGCTTCCCAGCAAAGGTGGTGAGCAGTGTAAATATTATATTATAATATGGTGCAAACAGGATTGAGAGTTTGTGCAGAAAAAATCCATAATAATAACCCAGACTGGGGTAAGAGCACAATTTTGGGTGGGACCAGCTGCTGTTTAACTGTAATTTATGGGAGCTTGGCACCTCCACAGAATGACAAGATTGATAAAGGGAGTTAATTATCTCTTACATATAAGAGATACGTGTAAAATAGTATTGAAACTTTCACTTAACAGCACTGTCTGTTTGCGTTTCGTTATTGCAATTATATCCCTTTGGAAGGGAGTGTATGTAATATGTAATATATTGTACATTTGAAATTTATTATCCTTTATATTATAGCTATATTTGTTAAATAAATTA
                                                  Xl3.1-CHK-1012697594                                                                                                                                                             CAGCATGTACCATCTGTCCTAAGACTTGTTTATGCTCCATTGAGACTGTGGGAAAGAAGACTTGAGTGATTTTTTCTTGCACTCCCTATATTTTTTCACTATTTATGAGTTCCTAGGGAATTGAATTGTAGAAATACTATGTCACTTCAATATGCCTATTGTCATCTTGTTAGCTGTGTCTAAATCATGAGTTCCAGGTGTCTTGCTCACTACCAGCTTCCCAAGTTCTTATCCCAGTCCATAAAGTATCAGAACCGAGGGGATATCTGTAACCTTGAAAGCACCAAACCCACTGCTTCAGGAGTTGTCCTACATTGTAGGGAAAGGCTTCCCAGCAAAGGTGGTGAGCAGTGTAAATATTATATTATAATATGGTGCAAACAGGATTGAGAGTTTGTGCAGAAAAAATCCATAATAATAACCCAGACTGGGGTAAGAGCACAATTTTGGGTGGGACCAGCTGCTGTTTAACTGTAATTTATGGGAGCTTGGCACCTCCACAGAATGACAAGATTGATAAAGGGAGTTAATTATCTCTTACATATAAGAGATACGTGTAAAATAGTATTGAAACTTTCACTTAACAGCACTGTCTGTTTGCGTTTCGTTATTGCAATTATATCCCTTTGGAAGGGAGTGTATGTAATATGTAATATATTGTACATTTGAAATTTATTATCCTTTATATTATAGCTATATTTGTTAAATAAATTAATTTTA
                                                      consensus depths                                                                                                                                                            2     3     2     3     3     4     3     4     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     5     6     6     7     7     8     7     8     7     8     7     8     7     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     4     8     2     5     2     4     2     3
  3   1   2       bld Emb9      out                   IMAGE:7976539.3p TGGAGAGTCGTCTACCAGACAGAATTTCGACGGACAGCAAGTCAGACAGTGAAGTAATGTGTACCTGTCCCTCATNGATTCTCCTCTGGACCAGACCCAGCTCTGATGACTCTATCTTCAGAGCAGCTGCAATGTCTCTAGGGATTACACAGCCACCTTGATACAGCAGTACCTCTGTCCTAGACTTGTTTATGCTCCATTGGACTGTGGAAAGAAGACTGAGTGATTTTTCTTGCACTCCCTATATTTTTTCACTATTTATGAGTTCCTAGGGAATTGAATTGTAGAAATACTATGTCACTTCAATATGCCTATTGTCATCTTGTTAGCTGTGTCTAAATCATGAGTTCCAGGTGTCTTGCTCACTACCAGCTTCCCAAGTTCTTATCCCAGTCCATAAAGTATCAGAACCGAGGGGATATCTGTAACCTTGAAAGCACCAAACCCACTGCTTCAGGAGTTGTCCTACATTGTAGGGAAAGGCTTCCCAGCAAAGGTGGTGAGCAGTGTAAATATTATATTATAATATGGTGCAAACAGGATTGAGAGTTTGTGCAGAAAAAATCCATAATAATAACCCAGACTGGGGTAAGAGCACAATTTTGGGTGGGACCAGCTGCTGTTTAACTGTAATTTATGGGAGCTTGGCACCTCCACAGAATGACAAGATTGATAAAGGGAGTTAATTATCTCTTACATATAAGAGATACGTGTAAAATAGTATTGAAACTTTCACTTAACAGCACTGTCTGTTTGCGTTTCGTTATTGCAATTATATCCCTTTGGAAGGGAGTGTATGTAATATGTAATATATTGTACATTTGAAATTTATAT
  3   1   2       bld Tbd7 5g3  out                        XL069o24.3p                                                                                                                                           CACAGCCCACCTTGGATACAGCATGTACCATCTGTCCTAAGACTTGTTTATGCTCCATTGAGACTGTGGGAAAGAAGACTTGAGTGATTTTTTCTTGCACTCCCTATATTTTTTCACTATTTATGAGTTCCTAGGGAATTGAATTGTAGAAATACTATGTCACTTCAATATGCCTATTGTCATCTTGTTAGCTGTGTCTAAATCATGAGTTCCAGGTGTCTTGCTCACTACCAGCTTCCCAAGTTCTTATCCCAGTCCATAAAGTATCAGAACCGAGGGGATATCTGTAACCTTGAAAGCACCAAACCCACTGCTTCAGGAGTTGTCCTACATTGTAGGGAAAGGCTTCCCAGCAAAGGTGGTGAGCAGTGTAAATATTATATTATAATATGGTGCAAACAGGATTGAGAGTTTGTGCAAAAAAAATCCATAATAATAACCCAGACTGGGGTAAGAGCACAATTTTGGGTGGGACCAGCTGCTGTTTAACTGTAATTTATGGGAGCTTGGCACCTCCACAGAATGACAAGATTGATAAAGGGAGTTAATTATCTCTTACATATAAGAGATACGTGTAAAATAGTATTGAAACTTTCACTTAACAGCACTGTCTGTTTGCGTTTCGTTATTGCAATTATATCCCTTTGGAAGGGAGTGTATGTAATATGTAATATATTGTACATTTAAATTATTATCCTTAATA
  3   1   2       bld Neu7                                 XL025i18.3p                                                                                                                                                       TGGATACAGCATGTACCATCTGTCCTAAGACTTGTTTATGCTCCATTGAGACTGTGGGAAAGAAGACTTGAGTGATTTTTTCTTGCACTCCCTATATTTTTTCACTATTTATGAGTTCCTAGGGAATTGAATTGTAGAAATACTATGTCACTTCAATATGCCTATTGTCATCTTGTTAGCTGTGTCTAAATCATGAGTTCCAGGTGTCTTGCTCACTACCAGCTTCCCAAGTTCTTATCCCAGTCCATAAAGTATCAGAACCGAGGGGATATCTGTAACCTTGAAAGCACCAAACCCACTGCTTCAGGAGTTGTCCTACATTGTAGGGAAAGGCTTCCCAGCAAAGGTGGTGAGCAGTGTAAATATTATATTATAATATGGTGCAAACAGGATTGAGAGTTTGTGCAGAAAAAATCCATAATAATAACCCAGACTGGGGTAAGAGCACAATTTTGGGTGGGACCAGCTGCTGTTTAACTGTAATTTATGGGAGCTTGGCACCTCCACAGAATGACAAGATTGATAAAGGGAGTTAATTATCTCTTACATATAAGAGATACGTGTAAAATAGTATTGAAACTTTCACTTAACAGCACTGTCTGTTTGCGTTTCGTTATTGCAATTATATCCCTTTGGAAGGGAGTGTATGTAATATGTAATATATTGTACATTTAAATTTATTATCCTTATATTAAGCTATATTGTTAAATAA
  3   1   2      seed Tbd7 5g3  out                        XL101n07.3p                                                                                                                                                                               CTAAGACTTGTTTATGCTCCATTGAGACTGTGGGAAAGAAGACTTGAGTGATTTTTTCTTGCACTCCCTATATTTTTTCACTATTTATGAGTTCCTAGGGAATTGAATTGTAGAAATACTATGTCACTTCAATATGCCTATTGTCATCTTGTTAGCTGTGTCTAAATCATGAGTTCCAGGTGTCTTGCTCACTACCAGCTTCCCAAGTTCTTATCCCAGTCCATAAAGTATCAGAACCGAGGGGATATCTGTAACCTTGAAAGCACCAAACCCACTGCTTCAGGAGTTGTCCTACATTGTAGGGAAAGGCTTCCCAGCAAAGGTGGTGAGCAGTGTAAATATTATATTATAATATGGTGCAAACAGGATTGAGAGTTTGTGCAGAAAAAATCCATAATAATAACCCAGACTGGGGTAAGAGCACAATTTTGGGTGGGACCAGCTGCTGTTTAACTGTAATTTATGGGAGCTTGGCACCTCCACAGAATGACAAGATTGATAAAGGGAGTTAATTATCTCTTACATATAAGAGATACGTGTAAAATAGTATTGAAACTTTCACTTAACAGCACTGTCTGTTTGCGTTTCGTTATTGCAATTATATCCCTTTGGAAGGGAGTGTATGTAATATGTAATATATTGTACATTTAAATTTATTATCCTT
  5   1   2       bld Skin                            IMAGE:8644850.5p                                                                                                                                                                                                     TGAGACTGTGGAGAAGAAGACTTGAGTGATTTTTTCTTGCACTCCCTATATTTTTTCACTATTTATGAGTTCCTAGGGAATTGAATTGTAGAAATACTATGTCACTTCAATATGCCTATTGTCATCTTGTTAGCTGTGTCTAAATCATGAGTTCCAGGTGTCTTGCTCACTACCAGCTTCCCAAGTTCTTATCCCAGTCCATAAAGTATCAGAACCGAGGGGATATCTGTAACCTTGAAAGCACCAAACCCACTGCTTCAGGAGTTGTCCTACATTGTAGGGAAAGGCTTCCCAGCAAAGGTGGTGAGCAGTGTAAATATTATATTATAATATGGTGCAAACAGGATTGAGAGTTTGTGCAGAAAAAATCCATAATAATAACCCAGACTGGGGTAAGAGCACAATTTTGGGTGGGACCAGCTGCTGTTTAACTGTAATTTATGGGAGCTTGGCACCTCCACAGAATGACAAGATTGATAAAGGGAGTTAATTATCTCTTACATATAAGAGATACGTGTAAAATAGTATTGAAACTTTCACTTAACAGCACTGTCTGTTTGCGTTTCGTTATTGCAATTATATCCCTTTGGAAGGGAGTGTATGTAATATGTAATATATTGTACATTTGAATTNNATATCCTTTATATATAGCTATATTTGTAAATAAATAATTTTATGTaaaaaaaaaaaaaaaaaaaaGGGCGCGCAGGCTGATATCCAGACGCGCTCAGCTCTCCCTATATGATCTATACTAATCAACTGAAGATCTGATGATGACACCACTAAGCTGAAAAGCTTT
  3   1   2       bld Emb9                            IMAGE:7973923.3p                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTTGTAACATTTTATGCACCATACCCATTTTTTCAGGAGTTTGTCTTTCATTTTAGGGAAAGGCTTCTCAGCAAAGGTTTTTAGCAGTGAAAATATTTTATTATTTTATGGAGCAAACTGGATTTAGAGTTTTTCAAAAAAAATCCATAATAATAACCCAGATTGGGGTAAGAGCACAATTTTGGGTTGGACCAGCTGCTGTTTAACTGTAATTTATGGGAGCTTGGCACCTCCACAGAATGACAAGATTGATAAAGGGAGTTAATTATCTCTTACATATAAGAGATACGTGTAAAATAGTATTGAAACTTTCACTTAACAGCACTGTCTGTTTGCGTTTCGTTATTGCAATTATATCCCTTTGGAAGGGAGTGTATGTAATATGTAATATATTGTACATTTGAAATTTATTATCCCTTTATATTATAGTCG
  3   1   2       bld Emb4                            IMAGE:4957357.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAGGGAAAGGCTTCCCAGCAAAGGTGGTGAGCAGTGTAAATATTATATTATAATATGGTGCAAACAGGATTGAGAGTTTGTGCAGAAAAAATCCATAATAATAACCCAGACTGGGGTAAGAGCACAATTTTGGGTGGGACCAGCTGCTGTTTAACTGTAATTTATGGGAGCTTGGCACCTCCACAGAATGACAAGATTGATAAAGGGAGTTAATTATCTCTTACATATAAGAGATACGTGTAAAATAGTATTGAAACTTTCACTTAACAGCACTGTCTGTTTGCGTTTCGTTATTGCAATTATATCCCTTTGGAAGGGAGTGTATGTAATATGTAATATATTGTACATTTGAAATTTATTATCCTTTATATTATAGCTATATTTGTTAAATAAATTAATTTTAATGTA
  5   1   2       bld Emb4                            IMAGE:4681388.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTCCCAGCAAAGGTGGTGAGCAGTGTAAATATTATATTATAATATGGTGCAAACAGGATTGAGAGTTTGTGCAGAAAAAATCCATAATAATAACCCAGACTGGGGTAAGAGCACAATTTTGGGTGGGACCAGCTGCTGTTTAACTGTAATTTATGGGAGCTTGGCACCTCCACAGAATGACAAGATTGATAAAGGGAGTTAATTATCTCTTACATATAAGAGATACGTGTAAAATAGTATTGAAACTTTCACTTAACAGCACTGTCTGTTTGCGTTTCGTTATTGCAATTATATCCCTTTGGAAGGGAGTGTATGTAATATGTAATATATTGTACATTTGAAATTTATTATCCTTTATATTATAGCTATATTTGTTAAATAAATTAATTTTAATGTaaaaaaaaaaaaaaaaaaaaG
  3   1   2       bld Ga12 5g3  out                        XL141i07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTTATGGGAGCTTGGCACCTCCACAGAATGACAAGATTGATAAAGGGAGTTAATTATCTCTTACATATAAGAGATACGTGTAAAATAGTATTGAAACTTTCACTTAACAGCACTGTCTGTTTGCGTTTCGTTATTGCAATTATATCCCTTTGGAAGGGAGTGTATGTAATATGTAATATATTGTACATT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)