Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 96%

 1012775881 Xl3.1-IMAGE:6325666.5 - 14 ESTs
                                                                       ...-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6325666.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGCGCTCGTGCTGGAGGCCCGCGCAGAAGTGCACAAGTTAATCATTAACACAAATATTAAAAAAGCCGCGGATACTCCCCCTCGAAGTGTTTTCCGTAAGGGTCGCTTTGCCTGATCTGGAGGAAACACTTGATAGTTACTTTTTCGCCTTCCTTAAGGACATCTTCACATTTTTTCATGGATTTTTTCATAAGTATGTCTGAAACGTTAAAATACAATGATGATGACCATAAAAGTGTCTTTTTGAAAACACTAAATGAGCAGCGCCTAGAAGGTGAATTTTGTGATATAGCCATTGTTGTGGAAGATGTTAAATTCAGAGCCCATAGATGTGTACTTGCCGCGTGCAGTACTTACTTCAAGAAACTTTTTAAGAAACTGGAGGTTGATAGTTCTTCAGTAATCGAAATTGATTTCCTGCGATCGGATATATTTGAGGAGGTTCTAAACTACATGTATACATCAAAGATTGCTGTCAAAAAAGAAGATGTGAACCTGATGATGTCCTCAGGCCAGATACTTGGTATTCGTTTCTTAGATAAGCTCTGCTCGCAGAAGCGTGAAGTTTCCAGCGTGAATGAGAATACGGCCTCCCCCAAAAATAAATACAGTTATGAAACAAGTTTGAAGATAACTCGTCCAGTTGGTGCAGCTAATAACCAAGATGATGAGGTGGAGGAGATTGGAGATCAGGATGATAGTCCATCAGATGATACAGTTGAGGGCACTCCTCAAAGCCATGGGGAGGAGAAGTCTCCTACCTCTACACTGCGAGCTCTGGAGGCAATTCTCAAGGAACTTGGCAGTGAAGAAGTGCGGAAGGTTAACTGTTATGGGCAAGAAGTCGAGGCAATGGAGACAACTTGAGCCAAAGGGTCCTGGCGATCAACAAACCCCTTCCTGACATTTAATGACAGCATTAGTGAAGTCAAAGATGAACAAGCCCCCGCATGGACAACGGCAACAGGAGATATGAAATTTGAGTATTTGCTTTATGGCCACAGGGAACAATTTGCTTGCCAAGCATGTGGCAAAACATTTACAGATGAAGCACGTCTAAGAAAACATGAGAAGTTACACACAGCAGATAGACCATTTGCCTGTGATATGTGTGCCAAGGCATTTACAACCCAAGCACACCTGAAGGAACATTTGAAAATTCACACGGGGTATAAGCCTTACAGTTGTGAGGTGTGTGCAAAGTCTTTTATTCGGGCTCCAGATCTCAAAAAGCACGAACGTGTCCACAGCAATGAGAGACCATTTGCATGTCATCTTTGTGATAAGGCATTCAAGCATAAATCTCATTTGAAAGACCATGAAAGAAGACACAGGGGTGAGAAACCTTTTATTTGTGCATCATGCACCAAAGCATTTGCCAAGGCCTCAGACCTAAAACGCCATGAAAACAATATGCATAGTGAGCAACGCAAACAAGTCACAACGAGTGCCATACAGAGTGAGACTGAGCAACTGCAGGCAGCAGCAATGGCAGCCGAGGCAGAACAGCAACTTGAAAGTATTGCCTGCAGTTAAACAAAATATTCAGTGTTCCATTATTTATCAATCAATGTTATCATTTAAACCCTTGTATTTTGCACCTGCTAATGGTTTAAACTTGCACTCAAAATGTCCCATACAGAGAGAAATGAAAGTCATATGTTAATAGCATCACTGGTGTGAAAAAACAAAACAACCAAAATGATATTGGTTCAACTTTTTACCTTGCGTATTGTATATACTTTGTTTAAAATCCAATTATGAATTAAAAATTTAATATTCATTATTAAAGGATATTG
                                                  Xl3.1-CHK-1012692675                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCGTGCTGGAGGCCCGCGCAGAAGTGCACAAGTTAATCATTAACACAAATATTAAAAAAGCCGCGGATACTCCCCCTCGAAGTGTTTTCCGTAAGGGTCGCTTTGCCTGATCTGGAGGAAACACTTGATAGTTACTTTTTCGCCTTCCTTAAGGACATCTTCACATTTTTTCATGGATTTTTTCATAAGTATGTCTGAAACGTTAAAATACAATGATGATGACCATAAAAGTGTCTTTTTGAAAACACTAAATGAGCAGCGCCTAGAAGGTGAATTTTGTGATATAGCCATTGTTGTGGAAGATGTTAAATTCAGAGCCCATAGATGTGTACTTGCCGCGTGCAGTACTTACTTCAAGAAACTTTTTAAGAAACTGGAGGTTGATAGTTCTTCAGTAATCGAAATTGATTTCCTGCGATCGGATATATTTGAGGAGGTTCTAAACTACATGTATACATCAAAGATTGCTGTCAAAAAAGAAGATGTGAACCTGATGATGTCCTCAGGCCAGATACTTGGTATTCGTTTCTTAGATAAGCTCTGCTCGCAGAAGCGTGAAGTTTCCAGCGTGAATGAGAATACGGCCTCCCCCAAAAATAAATACAGTTATGAAACAAGTTTGAAGATAACTCGTCCAGTTGGTGCAGCTAATAACCAAGATGATGAGGTGGAGGAGATTGGAGATCAGGATGATAGTCCATCAGATGATACAGTTGAGGGCACTCCTCAAAGCCATGGGGAGGAGAAGTCTCCTACCTCTACACTGCGAGCTCTxGAxGCAATTCTCAAGGAACTTGGCAGTGAAGAAGTGCGGAAGGTTAACTGTTATGGGCAAGAAGTCGAGGCAATGGAGACAACTxxxxCCAAAGGGTCCTGxxxAxxAACxxxxCxxxxCCTGACATTTAATGACAGCATTAGTGAAGTCAAAGATGAACAAGCCCCCGCATGGACAACGGCAACAGGAGATATGAAATTTGAGTATTTGCTTTATGGCCACAGGGAACAATTTGCTTGCCAAGCATGTGGCAAAACATTTACAGATGAAGCACGTCTAAGAAAACATGAGAAGTTACACACAGCAGATAGACCATTTGCCTGTGATATGTGTGCCAAGGCATTTACAACCCAAGCACACCTGAAGGAACATTTGAAAATTCACACGGGGTATAAGCCTTACAGTTGTGAGGTGTGTGCAAAGTCTTTTATTCGGGCTCCAGATCTCAAAAAGCACGAACGTGTCCACAGCAATGAGAGACCATTTGCATGTCATCTTTGTGATAAGGCATTCAAGCATAAATCTCATTTGAAAGACCATGAAAGAAGACACAGGGGTGAGAAACCTTTTATTTGTGCATCATGCACCAAAGCATTTGCCAAGGCCTCAGACCTAAAACGCCATGAAAACAATATGCATAGTGAGCAACGCAAACAAGTCACAACGAGTGCCATACAGAGTGAGACTGAGCAACTGCAGGCAGCAGCAATGGCAGCCGAGGCAGAACAGCAACTTGAAAGTATTGCCTGCAGTTAAACAAAATATTCAGTGTTCCATTATTTATCAATCAATGTTATCATTTAAACCCTTGTATTTTGCACCTGCTAATGGTTTAAACTTGCACTCAAAATGTCCCATACAGAGAGAAATGAAAGTCATATGTTAATAGCATCACTGGTGTGAAAAAACAAAACAACCAAAATGATATTGGTTCAACTTTTTACCTTGCGTATTGTATATACTTTGTTTAAAATCCAATTATGAATTAAAAATTTAATATTCATTATTAAAGGATATTGTAAACC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       3     3     3     3     3     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     7     6     7     6     7     6     7     6     7     6     6     6     6     6     6     6     6     7     7     7     7     7     7     6     6     6     6     6     6     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     3     2     3     2     3     2     3     1     3     1     3     1     3     1     2     1     2     1     1     1     1     1     1     1     1     1     1     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     4     4     4     4     4     4     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     5     6     5     6     5     6     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     3     4     2     2     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----C-------
                                               BLH ATG     178    1637                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               BLH MIN     178     246                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               BLH OVR     178      46                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               EST CLI       0      62                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               ORF LNG     178       3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                                                                                                                                           PROTEIN --- Ce ---- 7e-032     NP_492723.1 Drosophila ODD-skipped-like ODD-3 (odd-3) [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 1e-034     NP_723223.1 CG31632-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Ag ---- 5e-035     XP_319571.4 AGAP008827-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Sp ---- 2e-036     XP_001181381.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ci ---- 1e-038     NP_001071858.1 zinc finger protein [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Xt ---- 1e-037     NP_001120358.1 hypothetical protein LOC100145431 [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Bt ==== 2e-044     XP_590523.3 PREDICTED: similar to zinc finger and BTB domain containing 17 [Bos taurus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Dr ==== 0          NP_998701.1 zgc:66442 [Danio rerio] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = ?? ==== 0          XP_609570.4 PREDICTED: similar to Zinc finger protein 161 homolog (Zfp-161) (Zinc finger protein 5) (HZF5) (Zinc finger and BTB domain-containing protein 14) [Bos taurus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Gg ==== 0          NP_990492.1 zinc finger 5 protein [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Mm ==== 0          NP_033573.1 zinc finger protein 161 [Mus musculus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED = Cf ==== 0          XP_537319.2 PREDICTED: similar to zinc finger protein 161 homolog [Canis familiaris] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Hs ==== 0          NP_003400.2 zinc finger protein 161 homolog; zinc finger protein homologous to Zfp161 inmouse [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED = Xl ==== 0          NP_001091416.1 hypothetical protein LOC100049107 [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6325666.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAA---------TAA------------------------------------TAA------------------------------------------------------------------------------ATG---------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATGATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------TGA---------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG------------------------------------------TAA---------------------------------------------TAA---------------------TAA---------------------ATG---------------------------ATG------------------TGA------------------ATG---------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  5   1   2       bld DMZ  5g3  in                         xl283b24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGCGCTCGTGCTGGAGGCCCGCGCAGAAGTGCACAAGTTAATCATTAACACAAATATTAAAAAAGCCGCGGATACTCCCCCTCGAAGTGTTTTCCGTAAGGGTCGCTTTGCCTGATCTGGAGGAAACACTTGATAGTTACTTTTTCGCCTTCCTTAAGGACATCTTCACATTTTTTCATGGATTTTTTCATAAGTATGTCTGAAACGTTAAAATACAATGATGATGACCATAAAAGTGTCTTTTTGAAAACACTAAATGAGCAGCGCCTAGAAGGTGAATTTTGTGATATAGCCATTGTTGTGGAAGATGTTAAATTCAGAGCCCATAGATGTGTACTTGCCGCGTGCAGTACTTACTTCAAGAAACTTTTTAAGAAACTGGAGGTTGATAGTTCTTCAGTAATCGAAATTGATTTCCTGCGATCGGATATATTTGAGGAGGTTCTAAACTACATGTATACATCAAAGATTGCTGTCAAAAAAGAAGATGTGAACCTGATGATGTCCTCAGGCCAGATACTTGGTATTCGTTTCTTAGATAAGCTCTGCTCGCAGAAGCGTGAAGTTTCCAGCGTGAATGAGAATACGGCCTCCCCCAAAAATAAATACAGTTATGAAACAAGTTTGAAGATAACTCGTCCAGTTGGTGCAGCTAATAACCAAGATGATGAGGTGG
  5   1   2       bld DMZ  5g3  in                         xl233g08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGCGCTCGTGCTGGAGGCCCGCGCAGAAGTGCACAAGTTAATCATTAACACAAATATTAAAAAAGCCGCGGATACTCCCCCTCGAAGTGTTTTCCGTAAGGGTCGCTTTGCCTGATCTGGAGGAAACACTTGATAGTTACTTTTTCGCCTTCCTTAAGGACATCTTCACATTTTTTCATGGATTTTTTCATAAGTATGTCTGAAACGTTAAAATACAATGATGATGACCATAAAAGTGTCTTTTTGAAAACACTAAATGAGCAGCGCCTAGAAGGTGAATTTTGTGATATAGCCNTTGTTGTGGAAGATGTTAAATTCAGAGCCCATAGATGTGTACTTGCCGCGTGCAGTACTTACTTCAAGAAACTTTTTAAGAAACTGGAGGTTGATAGTTCTTCAGTAATCGAAATTGATTTCCTGCGATCGGATATATTTGAGGAGGTTCTAAACTACATGTATACATCAAAGATTGCTGTCAAAAAAGAAGATGTGAACCTGATGATGTCCTCAGGCCAGATACTTGGTATTCGTTTCTTAGATAAGCTCTGCTCGCAGAAGCGTGAAGTTTCCAGCGTGAATGAGAATACGGCCTCCCCCAAAAATAAATACAGTTATGAAACAAGTTTGAAGATAACTCGTCCAGTTGGTGCAGCTAATAACCAAGATGATGAGGTGG
  5   1   2      seed DMZ  5g3  in                         xl241e24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGCGCTCGTGCTGGAGGCCCGCGCAGAAGTGCACAAGTTAATCATTAACACAAATATTAAAAAAGCCGCGGATACTCCCCCTCGAAGTGTTTTCCGTAAGGGTCGCTTTGCCTGATCTGGAGGAAACACTTGATAGTTACTTTTTCGCCTTCCTTAAGGACATCTTCACATTTTTTCATGGATTTTTTCATAAGTATGTCTGAAACGTTAAAATACAATGATGATGACCATAAAAGTGTCTTTTTGAAAACACTAAATGAGCAGCGCCTAGAAGGTGAATTTTGTGATATAGCCATTGTTGTGGAAGATGTTAAATTCAGAGCCCATAGATGTGTACTTGCCGCGTGCAGTACTTACTTCAAGAAACTTTTTAAGAAACTGGAGGTTGATAGTTCTTCAGTAATCGAAATTGATTTCCTGCGATCGGATATATTTGAGGAGGTTCTAAACTACATGTATACATCAAAGATTGCTGTCAAAAAAGAAGATGTGAACCTGATGATGTCCTCAGGCCAGATACTTGGTATTCGTTTCTTAGATAAGCTCTGCTCGCAGAAGCGTGAAGTTTCCAGCGTGAATGAGAATACGGCCTCCCCCAAAAATAAATACAGTTATGAAACAAGTTTGAAGATAACTCGTCCAGTTGGTGCAGCTAATAACCAAGATGATGAGGTGGAGG
  5   1   2       bld Egg3 5g                         IMAGE:6325666.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCCCGGGGCACAAGTTAATCTTTAACACGAATATTAAAAAAGCCGCGGATACTCCCCCTCGAAGTGTTTTCCGTAAGGGTCGCTTTGCCTGATCTGGAGGAAACACTTGATAGTTACTTTTTCGCCTTCCTTAAGGACATCTTCACATTTTTTCATGGATTTTTTCATAAGTATGTCTGAAACGCTAAAATACAATGATGATGACCATAAAAGTGTCTTTTTGAAAACACTAAATGAGCAGCGCCTAGAAGGTGAATTTTGTGATATAGCCATTGTTGTGGAAGATGTTAAATTCAGAGCCCATAGATGTGTACTTGCCGCGTGCAGTACTTACTTCAAGAAACTTTTTAAGAAACTGGAGGTTGATAGTTCTTCAGTAATCGAAATTGATTTCCTGCGATCGGATATATTTGAGGAGGTGCTAAACTACATGTATACATCAAAGATTGCTGTCAAAAAAGAAGATGTGAACCTGATGATGTCCTCAGGCCAGATACTTGGTATTCGTTTCTTAGATAAGCTCTGCTCGCAGAAGCGTGAAGTTTCCAGCGTGAATGAGAATACGGCCTCCCCCAAAAATAAATACAGTTATGATACAAGTTTGAAGATAACTCGTCCAGTTGGTGCAGCTAATAACCAAGATGATGAGGTGGAGGAGATTGGAGATCATGATGATAGTCCATCAGATGATACAGTTGAGGGCACTCCTCCAAGCCATGGGGAGGAGAAGTCTCCTACCTCTACACTGCGAGCTCTTGAAGCAATTCTCAAGGAACTTGGCAGTGAAGAAGTGCGGAAGGTTAACTGCTATGGGCAAGAAGTCAAGGCCATGGGAGACACTTGAGCCAAAGGGTCCTGGCGATCAACAAACCCCTTCCAAACCTGGACATTTAATGGACAGCCCTTTAAGGGAAAATTCAAAGAAATGAACCAACCAcccccccc
  5   1   2       bld Egg3 5g                         IMAGE:6325665.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCCGGGGCACAAGTTAATCATTAACACAAATATTAAAAAAGCCGCGGATACTCCCCCTCGAAGTGTTTTCCGTAAGGGTCGCTTTGCCTGATCTGGAGGAAACACTTGATAGTTACTTTTTCGCCTTCCTTAAGGACATCTTCACATTTTTTCATGGATTTTTTCATAAGTATGTCTGAAACGCTAAAATACAATGATGATGACCATAAAAGTGTCTTTTTGAAAACACTAAATGAGCAGCGCCTAGAAGGTGAATTTTGTGATATAGCCATTGTTGTGGAAGATGTTAAATTCAGAGCCCATAGATGTGTACTTGCCGCGTGCAGTACTTACTTCAAGAAACTTTTTAAGAAACTGGAGGTTGATAGTTCTTCAGTAATCGAAATTGATTTCCTGCGATCGGATATATTTGAGGAGGTGCTAAACTACATGTATACATCAAAGATTGCTGTCAAAAAAGAAGATGTGAACCTGATGATGTCCTCAGGCCAGATACTTGGTATTCGTTTCTTAGATAAGCTCTGCTCGCAGAAGCGTGAAGTTTCCAGCGTGAATGAGAATACGGCCTCCCCCAAAAATAAATACAGTTATGAAACAAGTTTGAAGATAACTCGTCCAGTTGGTGCAGCTAATAACCAAGATGATGAGGTGGAGGAGATTGGAGATCAGGATGATAGTCCATCAGATGATACAGTTGAGGGCACTCCTCAAAGCCATGGGNGAGGAGAAGTCTCCTACCTCTACACTGCGAAGTCAGGAGGCAATTCTNCAGGAACTTGGCAGTGAAGAAGTGCGGAAAGTTAACTGTTATGGGCAAGAAGTCGAGGCAATGGNAGACACTGAGCCCAAAGGACCTGNGGATCACAAAACCCCTCAAAACCCTGACATTTTAATGACAGGCATTAGTTGAAAGTCAAAC
  5   1   2       bld Tbd1 5g                              AW871708.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCCCTCGAAGTGTTTTCCGTAAGGGTCGCTTTGCCTGATCTGGAGGAAACACTTGATAGTTACTTTTTCGCCTTCCTTAAGGACATCTTCACATTTTTTCATGGATTTTTTCATAAGTATGTCTGAAACGCTAAAATACAATGATGATGACCATAAAAGTGTCTTTTTGAAAACACTAAATGAGCAGCGCCTAGAAGGTGAATTTTGTGATATAGCCATTGTTGTGGAAGATGTTAAATTCAGAGCCCATAGATGTGTACTTGCCGCGTGCAGTACTTACTTCAAGAAACTTTTTAAGAAACTGGAGGTTGATAGTTCTTCAGTAATCGAAATTGATTTCCTGCGATCGGATATATTTGAGGAGGTTCTAAACTACATGTATACATCAAAGATTGCTGTCAAAAAGAAGATGTGAACCTGATGATGTCCTCAGGCCAGATACTTGGTATTCGTTTCTTAGATAAGCTCTGCTCGCAGAAGCG
  5   1   2       bld Tbd7 5g3  in                         XL080o05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAACACTTGATAGTTACTTTTTCGCCTTCCTTAAGGACATCTTCACATTTTTTCATGGATTTTTTCATAAGTATGTCTGAAACGTTAAAATACAATGATGATGACCNTAAAAGTGTCTTTTTGAAAACACTAAATGAGCAGCGCCTAGAAGGTGAATTTTGTGATATAGCCATTGTTGTGGAAGATGTTAAATTCAGAGCCCATAGATGTGTACTTGCCGCGTGCAGTACTTACTTCAAGAAACTTTTTAAGAAACTGGAGGTTGATAGTTCTTCAGTAATCGAAATTGATTTCCTGCGATCGGATATATTTGAGGAGGTTCTAAACTACATGTATACATCAAAGATTGCTGTCAAAAAAGAAGATGTGAACCTGATGATGTCCTCAGGCCAGATACTTGGTATTCGTTTCTTAGATAAGCTCTGCTCGCAGAAGCGTGAAGTTTCCAGCGTGAATGAGAATACGGCCTCCCCCAAAAATAAATACAGTTATGAAACAAGTTTGAAGATAAC
  5   1   2       bld Tbd7                                 XL098k03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTCCCCCAAAAATAAATACAGTTATGAAACAAGTTTGAAGATAACTCGTCCAGTTGGTGCAGCTAATAACCAAGATGATGAGGTGGAGGAGATTGGAGATCAGGATGATAGTCCATCAGATGATACAGTTGAGGGCACTCCTCAAAGCCATGGGGAGGAGAAGTCTCCTACCTCTATACTGCGAGTTCAGGAGGCAATTCTCAAGGAACTTGGCAGTGAAGAAGTGCGGAAGGTTAACTGTTATGGGCAAGAAGTCGAGGCAATGGAGACAACTGAGCCAAAGGACCTGGGATCACAAACCCCTCAAACCCTGACATTTAATGACAGCATTAGTGAAGTCAAAGATGAACAAGCCCCCGCATGGACAACGGCAACAGGAGATATGAAATTTGAGTATTTGCTTTATGGCCACAGGGAACAATTTGCTTGCCAAGCATGTGGCAAAACATTTACAGATGAAGCACGTCTAAGAAAACATGAGAAGTTACACACAGCAGATAGACCATTTGCCTGTGATATGTGTGCCAAGGCATTTACAACCCAAGCACACCTGAAGGAACATTTGAAAATTCACACGGGGTATAAGCCTTACAGTTGTGAGGTGTGTGCAAAGTCTTTTATTCG
  3   1   2      skin DMZ  5g3  in                         xl233g08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTGCCNAGCATGTGGCAAANCATTTACAGATGAAGCACGTCTAAGAAAACATGAGAAGTTACACACAGCAGATAGACCATTTGCCTGTGATATGTGTGCCAAGGCATTTACAACCCAAGCACACCTGAAGGAACATTTGAAAATTCACACGGGGTATAAGCCTTACAGTTGTGAGGTGTGTGCAAAGTCTTTTATTCGGGCTCCAGATCTCAAAAAGCACGAACGTGTCCACAGCAATGAGAGACCATTTGCATGTCATCTTTGTGATAAGGCATTCAAGCATAAATCTCATTTGAAAGACCATGAAAGAAGACACAGGGGTGAGAAACCTTTTATTTGTGCATCATGCACCAAAGCATTTGCCAAGGCCTCAGACCTAAAACGCCATGAAAACAATATGCATAGTGAGCAACGCAAACAAGTCACAACGAGTGCCATACAGAGTGAGACTGAGCAACTGCAGGCAGCAGCAATGGCAGCCGAGGCAGAACAGCAACTTGAAAGTATTGCCTGCAGTTAAACAAAATATTCAGTGTTCCATTATTTATCAATCAATGTTATCATTTAAACCCTTGTATTTTGCACCTGCTAATGGTTTAAACTTGCACTCAAAATGTCCCATACAGAGAGAAATGAAAGTCATATGTTAATAGCATCACTGGTGTGAAAAAACAAAACAACCAAAATGATATTGGTTCAACTTTTTACCTTGCGTATTGTATATACTTTGTTTAAAATCCAATTATGAATTAAAAATTA
  3   1   2       bld DMZ  5g3  in                         xl283b24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGCCAAGCATGTGGCAAAACATTTACAGATGAAGCACGTCTAAGAAAACATGAGAAGTTACACACAGCAGATAGACCATTTGCCTGTGATATGTGTGCCAAGGCATTTACAACCCAAGCACACCTGAAGGAACATTTGAAAATTCACACGGGGTATAAGCCTTACAGTTGTGAGGTGTGTGCAAAGTCTTTTATTCGGGCTCCAGATCTCAAAAAGCACGAACGTGTCCACAGCAATGAGAGACCATTTGCATGTCATCTTTGTGATAAGGCATTCAAGCATAAATCTCATTTGAAAGACCATGAAAGAAGACACAGGGGTGAGAAACCTTTTATTTGTGCATCATGCACCAAAGCATTTGCCAAGGCCTCAGACCTAAAACGCCATGAAAACAATATGCATAGTGAGCAACGCAAACAAGTCACAACGAGTGCCATACAGAGTGAGACTGAGCAACTGCAGGCAGCAGCAATGGCAGCCGAGGCAGAACAGCAACTTGAAAGTATTGCCTGCAGTTAAACAAAATATTCAGTGTTCCATTATTTATCAATCAATGTTATCATTTAAACCCTTGTATTTTGCACCTGCTAATGGTTTAAACTTGCACTCAAAATGTCCCATACAGAGAGAAATGAAAGTCATATGTTAATAGCATCACTGGTGTGAAAAAACAAAACAACCAAAATGATATTGGTTCAACTTTTTACCTTGCGTATTGTATATACTTTGTTTAAAATCCAATTATGAATTAAAAATT
  3   1   2       bld DMZ  5g3  in                         xl241e24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGAAGNTACACACAGCAGATAGACCATTTGCCTGTGATATGTGTGCCAAGGCATTACAACCCAAGCACACCTGAAGGAACATTTGAAAATTCACACGGGGTATAAGCCTTACAGTTGTGAGGTGTGTGCAAAGTCTTTTATTCGGGCTCCAGATCTCAAAAAGCACGAACGTGTCCACAGCAATGAGAGACCATTTGCATGTCATCTTTGTGATAAGGCATTCAAGCATAAATCTCATTTGAAAGACCATGAAAGAAGACACAGGGGTGAGAAACCTTTTATTTGTGCATCATGCACCAAAGCATTTGCCAAGGCCTCAGACCTAAAACGCCATGAAAACAATATGCATAGTGAGCAACGCAAACAAGTCACAACGAGTGCCATACAGAGTGAGACTGAGCAACTGCAGGCAGCAGCAATGGCAGCCGAGGCAGAACAGCAACTTGAAAGTATTGCCTGCAGTTAAACAAAATATTCAGTGTTCCATTATTTATCAATCAATGTTATCATTTAAACCCTTGTATTTTGCACCTGCTAATGGTTTAAACTTGCACTCAAAATGTCCCATACAGAGAGAAATGAAAGTCATATGTTAATAGCATCACTGGTGTGAAAAAACAAAACAACCAAAATGATATTGGTTCAACTTTTTACCTTGCGTATTGTATATACTTTGTTTAAAATCCAATTATGAATTAAAA
  3   1   2       bld Tbd7 5g3  in                         XL080o05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCCACAGCAATGAGAGACCATTTGCATGTCATCTTTGTGATAAGGCATTCAAGCATAAATCTCATTTGAAAGACCATGAAAGAAGACACAGGGGTGAGAAACCTTTTATTTGTGCATCATGCACCAAAGCATTTGCCAAGGCCTCAGACCTAAAACGCCATGAAAACAATATGCATAGTGAGCAACGCAAACAAGTANCAACGAGTGCCATACAGAGTGAGACTGAGCAACTGCAGGCAGCAGCAATGGCAGCCGAGGCAGAACAGCAACTTGAAAGTATTGCCTGCAGTTAAACAAAATATTCAGTGTTCCATTATTTATCAATCAATGTTATAATTTAAACCCTTGTATTTTGCACCTGCTAATGGTTTAAACTTGCACTCAAAATGTCCCATACAGAGAGAAATGAAAGTCATATGTTAATAGCATCACTGGTGTGAAAAAACAAAACAACCAAAATGATATTGGTTCAACTTTTTACCTTGCGTATTGTATATACTTTGTTTAAAATCCAATTANGAATTAAAAATTTAATATTCATTATTAAAGGATATTGAAACCT
  3   1   2       bld Ga18      in                      xlk115c09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTTGTGATAAGGCATTCAAGCATAAATCTCATTTGAAAGACCATGAAAGAAGACACAGGGGTGAGAAACCTTTTATTTGTGCATCATGCACCAAAGCATNNNNNAGGCCTCAGACCTAAAACGCCATGAAAACAATATGCATAGTGAGCAACGCAAACAAGTCACAACGAGTGCCATACAGAGTGAGACTGAGCAACTGCAGGCAGCAGCAATGGCANNGAGGCAGAACAGCAACTTGAAAGTATTGCCTGCAGTTAAACAAAATATTCAGTGTTCCATTATTTATCAATCAATGTTATCATTTAAACCCTTGTATTTTGCACCTGCTAATGGTTTAAACTTGCACTCAAAATGTCCCATACAGAGAGAAATGAAAGTCATATGTTAATAGCATCACTGGTGTGAAAAAACAAAACAACCAAAATGATATTGGTTCAACTTTTTACCTTGCGTATTGTATATACTTTGTTTAAAANCCAATTATGAANTAAAANTTTAA
  5   1   2       bld Ga18      in                      xlk115c09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTGATAAGGCATTCAAGCATAAATCTCATTTGAAAGACCATGAAAGAAGACACAGGGGTGAGAAACCTTTTATTTGTGCATCATGCACCAAAGCATTTGCCAAGGNCTCAGACCTAAAACGCCATGAAAACAATATGCATAGTGAGCAANNNNACAAGTCACAACGAGTGCCATACAGAGTGAGACTGAGCAACTGCAGGCAGCAGCAATGGCAGCCGAGGNAGAACAGCAACTTGAAAGTATTGCCTGCAGTTAAACAAAATATTCAGTGTTCCATTATTTATCAATCAATGTTATCATTTAAACCCTTGTATTTTGCACCTGCTAATGGTTTAAACTTGCACTCAAAATGTCCCATACAGAGAGAAATGAAAGTCATATGTTAATAGCATCACTGGTGTGaaaaaacaaaacaaccaaaaTGATATTGGTTCAACTTTTTACCTTGCGTATTGTATATACTTTGTTTAAAATCCAATTATGAATTAAAAATTTAATATTCATTATTAAAGGATATTGTAAACCTTTaaaaaaaaaa

In case of problems mail me! (mike.gilchrist@crick.ac.uk)