Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:7207176.3                       3 END     1           6       33                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:8073137.5                      37 PI      76         80      516                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:6316036.5                      16 PI      76         80      516                (no blast hit)

 This cluster: approximate FL confidence score = 92%

 1012776117 Xl3.1-IMAGE:8548878.5 - 15 ESTs
                                                                       ...-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8548878.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAGAGCTGGGATATGTGCTTGCTGCCCCGTTAGCTTATATTTAGTCCATCTCACCGGAGCACAGCCTGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACGGTGTTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCAAGCCTCTACTTCTGCTGTGCCGTTGAAGATCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGTGTGTGTGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGCTGGGAGGAGAAGTTCAGGAGACATCCAAGAAAAACGTGCTCAAAGCCATCGAACAGGCGGATCTTCTGCAGGAGGATGCTGAGACACCACAGACACCACGGAAAGAAATTGGTCTGACATAAACCTCATAAACCTCCTCCAGTGTCTCTGGTGTCTCTCTGTGTTCACTGCCTTCATCTCAGTGTTATCTCAGTGTTAAATAATAGTGTAAACTGCTGTCTGTCAGTATTACTGTGCTTTATTTGGGTTCTCAAAAAGGGGACAAATCACTCCAAGAAACAAAAGGGAAAGGAACATTTCACCGAATCCATGGTGCATTCCAAGAACATTTTCTCATTTGATTTCAGATTGATGATAATCTGAAGGCACAGCTACCCCAGTTCTAATACTGCCATTGCACCAGAGCTGAAGTTCTTATTGGCCCGCGGGACAGGAAGCCGTCATTTGAACCCCATCTTGGATCTGCGAGGTGCTGCAGATCCTTCTGACACATTCAAATTAACTTTTGTTTTGGCAACCAAAGAGAAGTCATTTGCTGTTAAGGAT
                                                  Xl3.1-CHK-1012691718                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGGGATATGTGCTTGCTGCCCCGTTAGCTTATATTTAGTCCATCTCACCGGAGCACAGCCTGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACGGTGTTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCAAGCCTCTACTTCTGCTGTGCCGTTGAAGATCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGTGTGTGTGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGCTGGGAGGAGAAGTTCAGGAGACATCCAAGAAAAACGTGCTCAAAGCCATCGAACAGGCGGATCTTCTGCAGGAGGAxxCTGAGACACCACxGAxxxxxCxGxAAGAAATxGxxxxxAxxxAAACCTCxTxxxCCTCCTCxxGxGTCTCTGxTxxxxxTCxxxGTTCACTGCCTTCATCTCAGTGTTAxxTxAGTGTTAAATAATAGTGTAAACTGCTGTCTGTCAGTAxTAxxxTGCTTTATTTGGGTTCTCAAAAAGGGGACAAATCACTCCAAGAAACAAAAGGGAAAGGAACATTTCACCGAATCCATGGTGCATTCCAAGAACATTTTCTCATTTGATTTCAGATTGATGATAATCTGAAGGCACAGCTACCCCAGTTCTAATACTGCCATTGCACCAGAGCTGAAGTTCTTATTGGCCCGCGGGACAGGAAGCCGTCATTTGAACCCCATCTTGGATCTGCGAGGTGCTGCAGATCCTTCTGACACATTCAAATTAACTTTTGTTTTGGCAACCAAAGAGAAGTCATTTGCTGTT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   2     4     3     5     3     6     3     6     3     7     4     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8    10    11    10    11    10    11    10    11    10    11    11    12    12    13    12    13    13    13    13    13    13    13    13    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    13    13    13    14     7    14     7    14     7    14     7    14     6    13     7    13     6    12     5    12     5    12     5    11     5    11     5    11     5    11     4    10     4    10     4    10     4     9     4     9     4     9     4     9     5     9     5     9     5     8     3     8     3     8     3     8     3     8     3     7     3     7     3     7     3     7     3     7     3     7     3     7     3     6     3     5     3     5     3     5     3     5
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCTTGGAAGAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTAAGGAAGCCG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAGCGTTCTGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCGTGCTGGAAGAAATTGGACTGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCTCTCATGTCG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCGCGTTGCCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTGACATCAAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTGACATCAATGTTCACTGCCTTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAATAATAGTGTAAACTGCTGTCTGTCAGTATTACTGTACTGCTAAGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TACTGCTAAGCTGCTTTATTTGGGTTCTCAGAAGGG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------AA
                                               BLH ATG      74     730                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                               BLH MIN      74      98                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                               EST CLI     -45       1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Ce ==== 1e-066     NP_504559.1 AdaPTin or adaptin-related protein (18.6 kD) (apt-2C) [Caenorhabditis elegans] =============================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Ag ==== 4e-068     XP_313555.2 AGAP004283-PA [Anopheles gambiae str. PEST] ================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = Sp ==== 5e-069     XP_792185.2 PREDICTED: similar to clathrin-associated adaptor complex AP-1 small chain sigma1 [Strongylocentrotus purpuratus] =======================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Dm ==== 2e-069     NP_651198.1 CG5864-PA [Drosophila melanogaster] ========================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Dr ==== 2e-078     NP_991121.1 adaptor-related protein complex 1, sigma 2 subunit; wu:fd19a08 [Danio rerio] ===============================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Mm ==== 9e-079     NP_081163.2 adaptor-related protein complex 1 sigma 2 subunit [Mus musculus] =====================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xt ==== 9e-082     NP_001039110.1 adaptor-related protein complex 1, sigma 2 subunit [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Cf ---- 8e-082     XP_854230.1 PREDICTED: similar to Adapter-related protein complex 1 sigma 1B subunit (Sigma-adaptin 1B) (Adaptor protein complex AP-1 sigma-1B subunit) (Golgi adaptor HA1/AP1 adaptin sigma-1B subunit) (Clathrin assembly protein complex 1 sigma-1B small chain) (Sigma 1 [Canis familiaris]  -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Xl ==== 7e-082     NP_001088344.1 hypothetical protein LOC495185 [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Bt ==== 5e-082     NP_001035681.1 adaptor-related protein complex 1, sigma 1 subunit [Bos taurus] =========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Gg ==== 2e-082     NP_001006261.1 similar to DC22 [Gallus gallus] =========================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Hs ==== 1e-082     NP_003907.3 adaptor-related protein complex 1 sigma 2 subunit [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:8548878.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATG------ATG------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------TAA---------------------TGA------------------------------TAA------------TAATAG------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------TAA---------------------------------------------------------------------------------------------------TGA---------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
  5   1   2       bld Eye1      out                   IMAGE:6957428.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTCTATTGTGGTGTaaaaaaaaaaaaaaaGGCACCGCACATCCCAGATTCCGTTCCGAGAGCCCAGAGAACATCGCTCCAGCGCCTGGTGCTTTGCAGAGATGCCTCTTGGAAGACAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGAGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACCGTGTTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCAAGCCTCTACTTCTGCTGTGCCATTGAAGATCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGTGAACTCGATATCATCTTCAATTTTGAAAAAGCCTATTTTATTCTGGACGAATTTCTGCTGGGAGGAGAAGTTCAGGAGACCTCCAAGAAAAACGTGCTCAAAGCCATCGAGCAGGCGGATCTTCTGCAGGAGGATGCTAAGGAAGCCGAGACACCACGGAGCGTGCTGGAAGAAATTGGACTGACATAAACCTCCTCTCGCGTTGCCAGTGTCTCTCTGTTTGACATCAATGTTCACTGCCTTCATCTCAGTGTTAAATAATAGTGTAAACTGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTTATTTGGGTTCTCAGAAAGGGACAAATCACTTCCAGAAACCAAAGGGGAAAGGAACATTTTCAGGCAAATCCCTGGGTGGCATTCCAAAAACATTTTT
  5   1   2       bld Eye1                            IMAGE:7020071.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAAACCTCCCTATTGTGGTGTAAAAAAAGGCTCCGCACATCCCAGATTCCAGTCCAGAGAACGTGGCTCCGGTTCCTGGCGCTTCGCAGAGATGCCTCTTGGAAGACAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACGGTGTTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGCGGGATCTGAAGATCGTCTACAAAAGGTACGCAAGCCTCTACTTCTGCTGTGCCGTTGAAGATCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGTGTGTGTGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGCTGGGAGGAGAAGTTCAGGAGACATCCAAGAAAAACGTGCTCAAAGCCATCGAACAAGCGGATCTTCTGCAGGAGGATGCTAAAGAAACTGAGACACCACGGAGCGTTCTGGAAGAAATTGGTCTGACATAAACCTCCTCTCATGTCGCCAGTGTCTCTGTTTGACATCAACGTTCACTGCCTTCATCTCAGTGTTAAATAATAGTGTAAACTGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAAAAAGGGGACAAATCACTCCAAGAAACAAAANAGGAAAGGGAACTTTTCACCGAAATCCCATGGGTGCATTTCCAAAGAACATTTTTCCTCATTTTGATTTTCCAGATTGAATGAATAAATCTGAAAGGGCACCAGCCTAACCCCCCAGTC
  5   1   2       bld DMZ       in                         xl309l24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGTGTAAGCGCGCTGCCTGACAGGGAGGAAGAGAGCTGGGATATGTGCTGGCTGCCCCGTTAGCTTATATTTAGTCCATCTCACCGGAGCACAGCCTGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACGGTGTTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCAAGCCTCTACTTCTGCTGTGCCGTTGAAGATCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGTGTGTGTGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGCTGGGAGGAGAAGTTCAGGAGACATCCAAGAAAAACGTGCTCAAAGCCATCGAACAGGCGGATCTTCTGCAGGAGGAAACTGAGACACCACGGAGCGTTCTGGAAGAAATTGGTCTGACATAAACCTCCTCTCATGTCGCCAGTGTCTCTGTTTGACATCAACGTTCACTGCCTTCATCTCAGTGTTAAATAAT
  5   1   2       bld Tbd7      in                         XL056p15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTGACAGGGNAGGAAGAGAGCTGGGATATGTGCTTGCTGCCCCGTTAGCTTATATTTAGTCCATCTCACCGGAGCACAGCCTGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACGGTGTTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCAAGCCTCTACTTCTGCTGTGCCGTTGAAGATCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGTGTGTGTGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGCTGGGAGGAGAAGTTCAGGAGACATCCAAGAAAAACGTGCTCAAAGCCATCGAACAGGCGGATCTTCTGCAGGAGGAAACTGAGACACCACGGAGCGTTCTGGAAGAAATTGGTCTGACATAAACCTCCTCTCATGTAGCCAGTGTCTCTGTTTGACATCA
  5   1   2       bld Thy       in                    IMAGE:8548878.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCTGGGATATGTGCTTGCTGCCCCGTTAGCTTATATTTAGTCCATCTCACCGGAGCACAGCCTGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGCGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACGGTGTTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGCGGGATCTGAAGATCGTCTACAAAAGGTACGCAAGCCTCTACTTCTGCTGTGCCGTTGAAGATCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGTGTGTGTGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGCTGGGAGGAGAAGTTCAGGAGACATCCAAGAAAAACGTGCTCAAAGCCATCGAACAGGCGGATCTTCTGCAGGAGGAAACTGAGACACCACGGAGCGTTCTGGAAGAAATTGGTCTGACATAAACCTCCTCTCATGTCGCCAGTGTCTCTGTTTGACATCAACGTTCACTGCCTTCATCTCAGTGTTAAATAATAGTGTAAACTGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAAAAAGGGGACAAATCACTCCAAGAAACAAAAGGGAAAGGAACATTTCACCGAATCCATGGTGCATTCCAAGAACATTTTCTCATTTGATTTCAGATTGATGATATCTGAAGGCACAGCTACCCCAGTTCTATACTGCATTGCACCAGAGCTGAGTTCTTATGGCCGCGGGACAGAGCGGTCATTTGACCCATCTGATCTGCAAGGTGCTGCGATCTTCTGACCCATTCCAATAACTTTGGTTTGG
  5   1   2       bld Egg1                               PBX0076E09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCTGGCTGGCCCGCTAGCCTAAATTTAGTTCACCTTCAGCGGAACACAGCCTGGGAAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGAGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACCGTGTTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCAAGCCTCTACTTCTGCTGTGCCATTGAAGATCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGTGAACTCGATATCATCTTCAATTTTGAAAAAGCCTATTTTATTCTGGACGAATTTCTGCTGGGAGGAGAAGTTCAGGAGACCTCCAAGAAAAACGTGCTCAAAGCCATCGAGC
  5   1   2      seed Te2N                            IMAGE:7204884.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGCCTGGTGCTTTGCAGAGATGCCTCTTGGAAGACAAATGCAGTTTATGCTTTTGTTCAGCCGTCAGGGGAAGCTGAGGCTTCAGAAGTGGTATGTGCCTCTGTCTGACAAAGAGAAGAAGAAGATCACCAGGGAGCTGGTCCAGACCGTGTTAGCCCGCAAGCCGAAAATGTGCAGCTTCCTGGAATGGAGGGATCTGAAGATCGTCTACAAAAGGTACGCAAGCCTCTACTTCTGCTGTGCCATTGAAGATCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGTGAACTCGATATCATCTTCAATTTTGAAAAAGCCTATTTTATTCTGGACGAATTTCTGCTGGGAGGAGAAGTTCAGGAGACCTCCAAGAAAAACGTGCTCAAAGCCATCGAGCAGGCGGATCTTCTGCAGGAGGATGCTAAGGAAGCCGAGACACCACGGAGCGTGCTGGAAGAAATTGGACTGACATAAACCTCCTCTCGCGTTGCCAGTGTCTCTCTGTTTGACATCAATGTTCACTGCCTTCATCTCAGTGTTAAATAATAGTGTAAACTGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAAGGGGACAAATCACTCCAAGAAACTAAAGGGAAAGGAACATTTCAGCAAATCCATGGTGCATTCAAAACATTTTCACATTTGACTACAGGTTGATAACGGGATATCTAAACACCCCCCCAGTCTGATACTGCCAGTGCACCAGAGCTTCAGTTTCTATTGGCTCGCAGGACAAGGAAGCCCAAATTTGAACCCCCTTTTTGTCCTCAGGAAGGGATTTTGTAAGG
  3   1   2       bld Thy       in                    IMAGE:8548878.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCACTGATCATAGTGTACTCAGAGTGGTTGAGGTAGCTCTGACAGGAGAGAATACAGAGTGTCAGACGTGTAGCGCAGCGAAATGCAGCTCTGAATGCGGATTGAGATGTTACAAAGTACGCAGCTCTACTCTGCGTGCCGTGAGATCAGGACAAGAGCTGATACACTGGAAATATCCATCGTTACGTGGAGCTTTGGACAAGTATTTTGGCAGTGTGTGTGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGCTGGGAGGAGAAGTTCAGGAGACATCCAAGAAAAACGTGCTCAAAGCCATCGAACAGGCGGATCTTCTGCAGGAGGAAACTGAGACACCACGGAGCGTTCTGGAAGAAATTGGTCTGACATAAACCTCCTCTCATGTCGCCAGTGTCTCTGTTTGACATCAACGTTCACTGCCTTCATCTCAGTGTTAAATAATAGTGTAAACTGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAAAAAGGGGACAAATCACTCCAAGAAACAAAAGGGAAAGGAACATTTCACCGAATCCATGGTGCATTCCAAGAACATTTTCTCATTTGATTTCAGATTGATGATAATCTGAAGGCACAGCTACCCCAGTTCTAATACTGCCATTGCACCAGAGCTGAAGTTCTTATTGGCCCGCGGGACAGGAAGCCGTCATTTGAACCCCATCTTGGATCTGCGAGGTGCTGCAGATCCTTCTGACACATTCAAATTAACTTTTGTTTTGGCAACCAAAGAGAAGTCATTTGCTGTTAAGGATTT
  5   1   2       bld Egg1                               PBX0034C04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGTCTACAAAAGGTACGCAAGCCTCTACTTCTGCTGTGCCATTGAAGATCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGTGAACTCGATATCATCTTCAATTTTGAAAAAGCCTATTTTATTCTGGACGAATTTCTGCTGGGAGGAGAAGTTCAGGAGACCTCCAAGAAAAACGTGCTCAAAGCCATCGAGCAGGCGGATCTTCTGCAGGAGGATGCTAAGGAAGCCGAGACACCACGGAGCGTGCTGGAAGAAATTGGACTGACATAAACCTCCTCTCGCGTTGCCAGTGTCTCTCTGTTTGACATCAATGTTCACTGCCTTCATCTCAGTGTTAAATAATAGTGTAAACTGCTGTCTGTCAGTATTACTGTACT
  5   1   2       bld Egg1                               PBX0034E04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGTCTACAAAAGGTACGCAAGCCTCTACTTCTGCTGTGCCATTGAAGATCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGTGAACTCGATATCATCTTCAATTTTGAAAAAGCCTATTTTATTCTGGACGAATTTCTGCTGGGAGGAGAAGTTCAGGAGACCTCCAAGAAAAACGTGCTCAAAGCCATCGAGCAGGCGGATCTTCTGCAGGAGGATGCTAAGGAAGCCGAGACACCACGGAGCGTGCTGGAAGAAATTGGACTGACATAAACCTCCTCTCGCGTTGCCAGTGTCTCTCTGTTTGACATCAATGTTCACTGCCTTCATCTCAGTGTTAAATAATAGTGTAAACTGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAAGGGGACAAATCAC
  3   1   2       bld DMZ       in                         xl309l24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTCTACAAAAGGTACGCAAGCCTCTACTTCTGCTGTGCCGTTGAAGATCAGGACAATGAGCTGATTACACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGTGTGTGTGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGCTGGGAGGAGAAGTTCAGGAGACATCCAAGAAAAACGTGCTCAAAGCCATCGAACAGGCGGATCTTCTGCAGGAGGAAACTGAGACACCACGGAGCGTTCTGGAAGAAATTGGTCTGACATAAACCTCCTCTCATGTCGCCAGTGTCTCTGTTTGACATCAACGTTCACTGCCTTCATCTCAGTGTTAAATAATAGTGTAAACTGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAAAAAGGGGACAAATCACTCCAAGAAACAAAAGGGAAAGGAACATTTCACCGAATCCATGGTGCATTCCAAGAACATTTTCTCATTTGATTTCAGATTGATGATAATCTGAAGGCACAGCTACCCCAGTTCTAATACTGCCATTGCACCAGAGCTGAAGTTCTTATTGGCCCGCGGGACAGGAAGCCGTCATTTGAACCCCATCTTGGATCTGCGAGGTGCTGCAGATCCTTCTGACACATTCAAATTAACTTTTGTTTTGGCAACCAAAGAGAAGTCATTTGCTGTTAAGGATTTTT
  5   1   2       bld Ooc2                            IMAGE:3745903.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CACTGGAAATAATCCATCGTTACGTGGAGCTTTTGGACAAGTATTTTGGCAGCGTGTGTGAACTCGATATCATCTTCAATTTTGAAAAAGCCTATTTTATTCTGGACGAATTTCTGCTGGGAGGAGAAGTTCAGGAGACCTCCAAGAAAAACGTGCTCAAAGCCATCGAGCAGGCGGATCTTCTGCAGGAGGATGCTAAGGAAGCCGAGACACCACGGAGCGTGCTGGAAGAAATTGGACTGACA
  3   1   2       bld Tbd7      in                         XL056p15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAATCCATCGTTACGTGNAGCTTTTGGACAAGTATTTTGGCAGTGTGTGTGAACTCGATATCATCTTTAATTTTGAAAAAGCCTATTTTATTCTGGATGAATTTTTGCTGGGAGGAGAAGTTCAGGAGACATCCAAGAAAAACGTGCTCAAAGCCATCGAACAGGCGGATCTTCTGCAGGAGGAAACTGAGACACCACGGAGCGTTCTGGAAGAAATTGGTCTGACATAAACCTCCTCTCATGTAGCCAGTGTCTCTGTTTGACATCAACGTTCACTGCCTTCATCTCAGTGTTAAATAATAGTGTAAACTGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAAAAAGGGGACAAATCACTCCAAGAAACAAAAGGGAAAGGAACATTTCACCGAATCCATGGTGCATTCCAAGAACATTTTCTCATTTGATTTCAGATTGATGATAATCTGAAGGCACAGCTACCCCAGTTCTAATACTGCCATTGCACCAGAGCTGAAGTTCTTATTGGCCCGCGGGACAGGAAGCCGTCATTTGAACCCCATCTTGGATCTGCGAGGTGCTGCAGATCCTTCTGACACATTCAAATTAACTTTTGTTTTGGCAACCAAAGAGAAGTCATTTGCTGTTAAGGATTTTTTTTGTACCNAAATTTCTTTCAAATATTAAAAAT
  3   1   2       bld Te2N                            IMAGE:7764719.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAGCCTATTTTATTCTGGACGAATTTCTGCTGGGAGGAGAAGTTCAGGAGACCTCCAAGAAAAACGTGCTCAAAGCCATCGAGCAGGCGGATCTTCTGCAGGAGGAAGCCGAGACACCACGGAGCGTGCTGGAAGAAATTGGACTGACATAAACCTCCTCTCGCGTTGCCAGTGTCTCTCTGTTTGACATCAATGTTCACTGCCTTCATCTCAGTGTTAAATAATAGTGTAAACTGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAAGGGGACAAATCACTCCAAGAAACTAAAGGGAAAGGAACATTTCAGCAAATCCATGGTGCATTCAAAAACATTTTCACATTTGACTACAGGTTGATAACTGATAATCTAAAACACCCCCCAGTTTTGATACTGCCAGTGCACCAGAGCTCAAGTTTTTATTGGCTCGCAGGACAGGAAGCCCAAATTTGAACCCCATTTTGTCTCAAGATGGATTTGTAAGGTGCTGCAGATCCTTGTGACACATACAAATTAATTGTTGTTTTGGCAACCAAAGAGTAGTCATTTGCTGTTAAGGGTTTTTTTTTTTTGTATTGAAATTTCTTTCAAATATTGAAATATTGTTTTTCAGTTTTAATATTTTCCTCCCAATAAACCAAAGAGGAACTTAAAAAAAAAA
  5   1   2       bld Egg1                               PBX0067A10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCGGATCTTCTGCAGGAGGATGCTAAGGAAGCCGAGACACCACGGAGCGTGCTGGAAGAAATTGGACTGACATAAACCTCCTCTCGCGTTGCCAGTGTCTCTCTGTTTGACATCAATGTTCACTGCCTTCATCTCAGTGTTAAATAATAGTGTAAACTGCTGTCTGTCAGTATTACTGTACTGCTAAGCTGCTTTATTTGGGTTCTCAGAAGGGGACAAATCACTCCAAGAAACTAAAGGGAAAGGAACATTTCAGCAAATCCATGGTGCATTCAAAAACATTTTCACATTTGACTACAGGTTGATAACGGATAATCTAAAACACCCCCCAGTTCTGATACTGCCAGTGCACCAGAGCTCAAGTTCTTATTGGCTCGCAGGACAGGAAGCCCAAATTTGAACCCCATTTTGTCTCAAGATGGATTTGTAAGGTGCTGCAGATCCTTGTGACACATACAAATTAATTGTTGTTTTGGCAACCAAAGAGTAGTCATTTGCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)