Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Oct 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xlk159b23ex.5                        11 END     1           7        9                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012776150 Xl3.1-XL433l19ex.5 - 14 ESTs
                                                                       .-1170.....-1160.....-1150.....-1140.....-1130.....-1120.....-1110.....-1100.....-1090.....-1080.....-1070.....-1060.....-1050.....-1040.....-1030.....-1020.....-1010.....-1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL433l19ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCATCTGCATTAAACTTGCAAAGGCAAAATAGCGTGAAATCAAGTGAGAATGGCTCTTTGGAAAGTGATGGATTGACAAATGATTCCTCCTCTGTAGGGGATCAAGAATATCCCAATGGTAAGAGTCCCACACAATCTGAGGCCAGGACTTTTTCACCAACCAATAGCCAGTCTGACAGTATTGCATCCAAGTCGCCTCCTTCCTATAATGGACTTGATGACCTAGGAATGCTGTCAAAGGATGAGCATTCGCAGAACAGCTCCCTTAATCCTGATGGGGATGGTGCCTTGGACCTAACGAATGGCGGGTTTGCCCGGAAGATCAAGGAAGAACCAGGTTTAATTCTGAATGGAGAACTAGGCAGGTCACCTAATATGTATGTAGGTGCCCCACCAGCACTCATTAAAATGGAAGTACCCTCTGACCGCATGGCAGGAGCAGCCCACTTTCTCGGGCCTTCAAACCTATCTCCAGGACTGACCCCTCTTATTGTCCCTCAGCGACGGTCAGCAAAGCAACATCTTTGTAACGCGTGCGGGAAGAATTTTTCCTCTGCAAGTGCCTTACAGATCCATGAAAGGACACACACCGGAGAGAAGCCATTTGCTTGTACGATTTGTGGCAGGGCATTCACCACAAAGGGAAACCTTAAGGTCCATGTTGGAACGCACATGTGGAATAATTCTGCTCGGAGAGGGAGAAGACTCTCTGTGGATAACCAAATTCCTGCATTGGGAGCTGATGCCAAGAAAGTGGCTGAGATTTTTCCAAAGTTCATTGTGCCTCCTACAGTCAGCATTGACCCCGCCATGTGGAACCAGTATGCCACCGCGCTTAGTAATGGCTTGGCTTTGAAGACTAATGAGATATCTGTTATACAAAACAGTGCCCTCCCTACGTTGCCTGTTGGCAATGGCGGTGCTCCTGTTATCAGTACAGCTACTGTTGCCAATATCGACGTTTCTCCAGCAGGTGTTGGCCAGACTATGACAGAAATTGGGGATTCTACTGCTGAGAGCGTAACAAAACACCAGTTTCCACACTTTATGGAAGGAAATATAACTGTGAACTAAAATCGAGCAGAAAGACTTATGCATTATGGACATCCATGGTTTTGCTGTTAGTCATGAATTGTTTTTCAGCAGTCTTTT
                                                  Xl3.1-CHK-1012692384                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCATTAAACTTGCAAAGGCAAAATAGCGTGAAATCAAGTGAGAATGGCTCTTTGGAAAGTGATGGATTGACAAATGATTCCTCCTCTGTAGGGGATCAAGAATATCCCAATGGTAAGAGTCCCACACAATCTGAGGCCAGGACTTTTTCACCAACCAATAGCCAGTCTGACAGTATTGCATCCAAGTCGCCTCCTTCCTATAATGGACTTGATGACCTAGGAATGCTGTCAAAGGATGAGCATTCGCAGAACAGCTCCCTTAATCCTGATGGGGATGGTGCCTTGGACCTAACGAATGGCGGGTTTGCCCGGAAGATCAAGGAAGAACCAGGTTTAATTCTGAATGGAGAACTAGGCAGGTCACCTAATATGTATGTAGGTGCCCCACCAGCACTCATTAAAATGGAAGTACCCTCTGACCGCATGGCAGGAGCAGCCCACTTTCTCGGGCCTTCAAACCTATCTCCAGGACTGACCCCTCTTATTGTCCCTCAGCGACGGTCAGCAAAGCAACATCTTTGTAACGCGTGCGGGAAGAATTTTTCCTCTGCAAGTGCCTTACAGATCCATGAAAGGACACACACCGGAGAGAAGCCATTTGCTTGTACGATTTGTGGCAGGGCATTCACCACAAAGGGAAACCTTAAGGTCCATGTTGGAACGCACATGTGGAATAATTCTGCTCGGAGAGGGAGAAGACTCTCTGTGGATAACCAAATTCCTGCATTGGGAGCTGATGCCAAGAAAGTGGCTGAGATTTTTCCAAAGTTCATTGTGCCTCCTACAGTCAGCATTGACCCCGCCATGTGGAACCAGTATGCCACCGCGCTTAGTAATGGCTTGGCTTTGAAGACTAATGAGATATCTGTTATACAAAACAGTGCCCTCCCTACGTTGCCTGTTGGCAATGGCGGTGCTCCTGTTATCAGTACAGCTACTGTTGCCAATATCGACGTTTCTCCAGCAGGTGTTGGCCAGACTATGACAGAAATTGGGGATTCTACTGCTGAGAGCGTAACAAAACACCAGTTTCCACACTTTATGGAAGGAAATATAACTGTGAACTAAAATCGAGCAGAAAGACTTATGCATTATGGACATCCATGGTTTTGCTGTTAGTCATGAATTGTTTTTCAGCAGTCTTTTTTTTTT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         4     4     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     6     5     6     5     6     7     7     8     8     8     8     8     8     8     8     8     8     7     8     7     8     6     8     6     8     7     8     7     8     7     8     7     8     7     8     5     8     6     7     6     7     7     8     7     8     7     8     7     8     7     8     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9    10    11    10    11    10    11     9    10     9    10     9    10     9    10     9    10     9    10     8     9     8     9     8     9     8     8     8     8     8     8     7     7     6     6     6     6     6     6     5     5     5     5     4     5     5     5     5     5     4     5     5     5     5     5     5     5     5     5     5     5     4     5     5     5     4     5     4     5     4     5     4     5     3     4     3     4     3     3     2     2     2     2     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----T--G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ------C---A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ---------T-C
                                                                                                                                                                                                                                                  ...PROTEIN --- Ce ---- 2e-022     NP_491997.1 SEx Muscle abnormal SEM-4, zinc-finger transcription factor, controls neuronal and mesodermal cell development (81.7 kD) (sem-4) [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                  ...PROTEIN --- Dm ---- 4e-026     NP_723669.1 spalt-related CG4881-PB [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                  ...PREDICTED - Sp ---- 1e-026     XP_001186630.1 PREDICTED: similar to Msal-3 protein [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                  ...PROTEIN --- Ci ---- 7e-030     FAA00180.1 TPA: zinc finger protein [Ciona intestinalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                  ...PREDICTED - Bt ---- 5e-058     XP_592327.2 PREDICTED: similar to Sal-like protein 1 (Zinc finger protein SALL1) (Spalt-like transcription factor 1) (HSal1) [Bos taurus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                  ...PROTEIN --- Mm ---- 4e-079     NP_840064.2 sal-like protein 3 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                  ...PROTEIN --- Dr ---- 1e-081     NP_001074078.1 sal-like 4 [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                  ...PREDICTED - ?? ---- 5e-082     XP_614880.3 PREDICTED: similar to sal-like 4 isoform 1 [Bos taurus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                  ...PREDICTED - Cf ---- 6e-085     XP_543055.2 PREDICTED: similar to sal-like 4 [Canis familiaris] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                  ...PREDICTED - Hs ---- 3e-089     NP_065169.1 similar to SALL1 (sal (Drosophila)-like [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                  ...PROTEIN --- Gg ---- 1e-121     NP_001074341.1 sal-like 4 [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                  ...PREDICTED - Xt ---- 0          NP_001001458.1 hypothetical protein MGC76059 [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                  ...PROTEIN --- Xl ---- 0          NP_001082723.1 zinc finger transcription factor SALL4 [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xl3.1-XL433l19ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATG---ATG---------------------------------------------------------------ATGATG------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG---------------------TAA------------------ATG---------------------------TAG---TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
  5   1   0       add Emb1                            IMAGE:6864257.5p TTCCCCAGGCACTGTCATTTTCCAGAATCCTATCAATGCTCTGGATCCTTCAAAAAAGCTCAAGGGGAAGTTCCCAAACGTGACCACTCCTGAGACCAAGCCTGGGGGAGATGACCAGTTCTTTAGGCATAAATGTAAGTTCTGCGGCAAAGTCTTTGGCAATGATAGTGCTTTACAAATCCATCTACGTTCTCATACCGGGGAAAGACCCTACAAGTGTAACATTTGCGGGAACAGGTTTACAACAAAAGGAAACCTGAAGGTCCACTTCCAGCGTCATAAAGATAAATATCCACACATCAAAATGAATCCCTACCCTGTCCCGGAGCATTTGGACAATGTTCCTACTACAAGTGGAATTCCATATGGTATGTCTGTTCCTCTGGATGAGTCTAATGTATTTGCGGATACAAAATCTGGTCTTGCAACCAACATCTCAGGCCTTACAGAAACTGTTCTAGGCGCTTTTCCACTTAATATGCAGTCCAGGCCATCTCCAGGTAGTGAAGGGGAGTCTGTTTCCTCTGGTGCTGTAGGTCAAGAGTCTGGTACAGACCAGAGTTTAAACTCTCCCCCTGTTAGTGGATCTAGTGAACAAGGGTCAGAAACGACTAAACTTCAACAGCTGGTTGAAAACTTGGACAAGAACGGATCAGAAACAAATGAGTGCTTGATATGTCATAGAGTGCTAAGTTGTCCTAGTTCCTTAAAAATGCATTACCGCACTCATACCGGTGAAAAGCCATTCAAATGCAAGATCTGCGGAAGAGGCTTTCTCGACCAAAAGTAAACCTCAAAACCCACTATGGCATTCACAGAGCCAATAC
  5   1   0       add DMZ                                  xl242f02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGTAGTGAAGGGGAGTCTGTTTCCTCTGGTGCTGTAGGTCAAGAGTCTGGTACAGACCANAGTTTAAACTCTCCCCCTGTTAGTGGATCTAGTGAACAAGGGTCAGAAACGACTAAACTTCANCAGCTGGTTGAAAACTTGGACAAGAACGGATCAGAAACAAATGAGTGCTTGATATGTCATAGAGTGCTAAGTTGTCCTAGTTCCTTAAAAATGCATTACCGCACTCATACCGGTGAAAGGCCATTCAAATGCAAGATCTGCGGAAGAGCTTTCTCGACAAAGAGTAACCTCAAAACCCACTATGGCATTCACAGAGCCAATACGCCTTTGAAATTGCAACATTCTTGCCCAATTTGCCAGAAGAAGTTTACAAACGCTGTAGTTCTGCAGCANCATATTCGAATGCATATGGGTGGGCAGATCCCAAACACTCCCGTGTCAGAAGAAGCCAGTGATGATCTTGACATTGACTCTATGATGGATGAGAAGAATGGAGATTTGAACAACAGTTTCACTGATGAGAATCTTGATGATATTGATATGGAAGATGATGACTTGGCAGAAAACGCAACAGGCTCTAAGCCACCAACCCCACACAGTGAAACAAGAGCAGAATCCCCTGCTATGCAGTTCTCTTCTGGAACAGGTCAGGACAATCCGGNTTCTTTGCCATCTGCATTAAAC
  5   1   2       bld Oo1                             IMAGE:6859199.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCACTCATACCGGTGAAAGGCCATTCAAATGCAAGATCTGCGGAAGAGCTTTCTCGACAAAAAGTAACCTCAAAACCCACTATGGCATTCACAGAGCCAATACGCCTTTGAAATTGCAACATTCTTGCCCAATTTGCCAGAAGAAGTTTACAAACGCTGTAGTTTTGCAGCAACATATTCGAATGCATATGGGTGGGCAGATCCCAAACACTCCCGTGTCAGAAGAAGCCAGTGATGATCTTGACATTGACTCTATGATGGATGAGAAGAATGGAGATTTGAACAACAGTTTCACTGATGAGAATCTTGATGATATTGATATGGAAGATGATGACTTGGCAGAAAACGCAACAGGCTCTAAGCCACCAACCCCACACAGTGAAACAAGAGCAGAATCCCCTGCTATGCAGTTCTCTTCTGGAACAGGTCAGGACAATCTGGTTTCTTTGCCATCTGCATTAAACTTGCAAAGGCAAAATAGCGTGAAATCAAGTGAGAATGGCTCTTTGGAAAGTGATGGATTGACAAATGATTCCTCCTCTGTAGGGGATCAAGAATATCCCAATGGTAAGAGTCCCACACAATCTGAGGCCAGGACTTTTTCACCAACCAATAGCCAGTCTGACAGTATTGCATCCAAGTCGCCTCCTTCCTATAATGGACTTGATGACCTAGGAATGCTGTCAAAGGATGAGCATTCGCAGAACAGCTCCCTTAATCCTGATGGGGATGGTGCCTTGGACCTAACGAATGGCGGGTTTGCCCGGAAGATCAAGGAAGAACAGGTTTAATTCTGAATGGAGAACTAGGCAGGTCACCTAATATGTATGTAGGTGCCCCCACCAGCACTCATTAAAATGGAAGTACCCTCTGAACGCATGGCAGGAGCAGCCCACTTTCTCGGN
  5   1   2       bld Ga15                               XL419e08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACAATCCGGTTTCTTTGCCATCTGCATTAAACTTGCAAAGGCAAAATAGCGTGAAATCAAGTGAGAATGGCTCTTTGGAAAGTGATGGATTGACAAATGATTCCTCCTCTGTAGGGGATCAAGAATATCCCAATGGTAAGAGTCCCACACAATCTGAGGCCAGGACTTTTTCACCAACCAATAGCCAGTCTGACAGTATTGCATCCAAGTCGCCTCCTTCCTATAATGGACTTGATGACCTAGGAATGCTGTCAAAGGATGAGCATTCGCAGAACAGCTCCCTTAATCCTGATGGGGATGGTGCCTTGGACCTAACGAATGGCGGGTTTGCCCGGAAGATCAAGGAAGAACCAGGTTTAATTCTGAATGGAGAACTAGGCAGGTCACCTAATATGTATGTAGGTGCCCCACCAGCACTCATTAAAATGGAAGTACCCTCTGACCGCATGGCAGGAGCAGCCCACTTTCTCGGGCCTTCAAACCTATCTCCAGGACTGACCCCTCTTATTGTCCCTCAGCGACGGTCAGCAAAGCAACATCTTTGTAACGCGTGCGGGAAGAATTTTTCCTCTGCAAGTGCCTTACAGATCCATGAAAGGACACACACCGGAGAGAAGCCATTTGCTTGTACGATTTGTGGCAGGGCATTCACCACAAAGGGAAACCTTAAGGTCCATGTTGGAACGCACATGTGGAATAATTCTGCT
  3   1   2       bld Unk4                                726_18E21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGTTACTTTGCCATCGGCATTAAACTTACAAAGGCAAAACAGTGTGAAATCAAGTGAGAATGGCTCTTTGGAAAGTGATGGATTGACTAATGATTCCTCCTCTGTATGGGATCAAGAATATCCCACTGGCAAAAGTCCCACACAATCTGAGGCCAGGACTTTTTCACCAACCAATAGCCAGTCTGACAGCAATGCGTCCAAGTCACCTCCTTCCTATAATGGACTTGATGACCTAGGAATGCTGTCGAAGGATGAGCATTCTCAGAATGGCTCCCTTAATCCTGATGGGGATGGTGCCTTGGATCTGACGAATGGTGGGTTTGCCCGGAAGATCAAGGAAGAACCAGGTTTACATCAGAATGGAGAATTCGGTAAATAACTCATGTTTGCTTTTAATTGCATGAGAACAAAAATAGTTCAACCCATATATTCACTTCTCAGAAGGGCTAAGGAATCTTTGGGTGTTCACAAGAGATAAAGGGTATAATGGGTGGAACTAGTCCCTGGTGCTTGGCATGGAAACCAAGTCTAAAGGGCATTGGCAAACTGTGCTTTTGGGCACGTTGTTGCCCAGGTATTGTTTTAGATTGATATGCATAGGGACAAAATGCTCACTTGCCAATACTTCATTTGGAGTGCAGTAGTTGCTTTCATGTGATTGACATTTATCGCCTATAGTTTTGCCATAAATGTAAGCTGCCAGAAAAAATGAGACTTGTACTGGTTTCAGGTTTTTTAGGAAGAAAAACATTTTTTTATTTTTAGGTTTAAATTAGTTTATTAAAAATCCTACTGTTGTCGTG
  5   1   2       bld Ga15                               XL460n03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGAAATCAAGTGAGAATGGCTCTTTGGAAAGTGATGGATTGACTAATGATTCCTCCTCTGTATGGGATCAAGAATATCCCACTGGCAAAAGTCCCACACAATCTGAGGCCAGGACTTTTTCACCAACCAATAGCCAGTCTGACAGCAATGCGTCCAAGTCACCTCCTTCCTATAATGGACTTGATGACCTAGGAATGCTGTCGAAGGATGAGCATTCTCAGAATGGCTCCCTTAATCCTGATGGGGATGGTGCCTTGGATCTGACGAATGGTGGGTTTGCCCGGAAGATCAAGGAAGAACCAGGTTTACATCAGAATGGAGAATTCGGCAGGTTACCTAATCTGTATGTAGGTGCCCCACCAGCACTCATTAAAATGGAAGTATCCTCTGACCGCATGGCAGGTGCAACCCAGTATCTTGGACCTCCAAACTTATCTCCAGGACTGAACCCTCTTATTGTACCTCAGCGACGATCTGCAAAGCAGCATATTTGCACCATGTGCGGGAAGAACTTTTCCTCTGCAAGTGCCTTACAGATCCATGAAAGGACACACACCGGGGAGAAGCCGTTTGCTTGTACAATTTGTGGGAGAGCATTCACCACAAAGGGGAACCTTAAGGTCCATGTTGGAACCCACATGTGGAATAATTCTGCTCGTCGAGGGAGAAGACTATCTTTGGATGGCCAAATTCCTGCATTGGGAACAGATGCCAAGAAAGTAGCTGAGATTTTTCCAAAATTCATTGTGCCTTCTTCAGTCAGCATTGACCCCGCCATGTGGAACCAATACGCC
  5   1   2      seed DMZ                                  xl317j11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAAGTCGCCTCCTTCCTATAATGGACTTGATGACCTAGGAATGCTGTCAAAGGATGAGCATTCGCAGAACAGCTCCCTTAATCCTGATGGGGATGGTGCCTTGGACCTAACGAATGGCGGGTTTGCCCGGAAGATCAAGGAAGAACCAGGTTTAATTCTGAATGGAGAACTAGGCAGGTCACCTAATATGTATGTAGGTGCCCCACCAGCACTCATTAAAATGGAAGTACCCTCTGACCGCATGGCAGGAGCAGCCCACTTTCTCGGGCCTTCAAACCTATCTCCAGGACTGACCCCTCTTATTGTCCCTCAGCGACGGTCAGCAAAGCAACATCTTTGTAACGCGTGCGGGAAGAATTTTTCCTCTGCAAGTGCCTTACAGATCCATGAAAGGACACACACCGGAGAGAAGCCATTTGCTTGTACGATTTGTGGCAGGGCATTCACCACAAAGGGAAACCTTAAGGTCCATGTTGGAACGCACATGTGGAATAATTCTGCTCGGAGAGGGAGAAGACTCTCTGTGGATAACCAAATTCCTGCATTGGGAGCTGATGCCAAGAAAGTGGCTGAGATTTTTCCAAAGTTCATTGTGCCTCCTACAGTCAGCATTGACCCCGCCATGTGGAACCAGTATGCCACCGCGCTTAGTAATGGCTT
  5   1   2       bld Neu7                                 XL044a16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATGCTGTCAAAGGNATGAGCATTCGCAGNAACAGCTCCCTTAATCCTGATGGGGATGGTGCCTTGGACCTAACGAATGGCGGGTTTGCCCGGAAGATCAAGGAAGAACCAGGTTTAATTCTGAATGGAGAACTAGGCAGGTCACCTAATATGTATGTAGGTGCCCCACCAGCACTCATTAAAATGGAAGTACCCTCTGACCGCATGGCAGGAGCAGCCCACTTTCTCGGGCCTTCAAACCTATCTCCAGGACTGACCCCTCTTATTGTCCCTCAGCGACGGTCAGCAAAGCAACATCTTTGTAACGCGTGCGGGAAGAATTTTTCCTCTGCAAGTGCCTTACAGATCCATGAAAGGACACACACCGGAGAGAAGCCATTTGCTTGTACGATTTGTGGCAGGGCATTCACCACAAAGGGAAACCTTAAGGTCCATGTTGGAACGCACATGTGGAATAATTCTGCTCGGAGAGGGAGAAGACTCTCTGTGGATAACCAAATTCCTGCATTGGGAGCTGATGCCAAGAAAGTGGCTGAGAT
  5   1   2       bld Ga12                                 XL151k21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCCTTAATCCTGATGGGGATGGTGCCTTGGACCTAACGAATGGCGGGTTTGCCCGGAAGATCAAGGAAGAACCAGGTTTAATTCTGAATGGAGAACTAGGCAGGTCACCTAATATGTATGTAGGTGCCCCACCAGCACTAATTAAAATGGAAGTACCCTCTGACCGCATGGCAGGAGCAGCCCACTTTCTCGGGCCTTCAAACCTATCTCCAGGACTGACCCCTCTTATTGTCCCTCAGCGACGGTCAGCAAAGCAACATCTTTGTAACGCGTGCGGGAAGAATTTTTCCTCTGCAAGTGCCTTACAGATCCATGAAAGGACACACACCGGAGAGAAGCCATTTGCTTGTACGATTTGTGGCAGGGCATTCACCACAAAGGGAAACCTTAAGGTCCATGTTGGAACGCACATGTGGAATAATTCTGCTCGGAGAGGGAGAAGACTCTCTGTGGATAACCAAATTCCTGCATTGGGAGCTGATGCCAAGAAAGTGGCTGAGATTTTTCCAAAGTTCATTGTGCCTCCTACAGTCAGCATTGACCCCGCCATGTGGAACCAGTATGCCACCGCGCTTAGTAATGGCTTGGCTTTGAAGACTAATGAGATATCTGTTA
  5   1   2       bld Ga15                               XL433l19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGGGGATGGTGCCTTGGATCTGACGAATGGTGGGTTTGCCCGGAAGATCAAGGAAGAACCAGGTTTACATCAGAATGGAGAATTCGGCAGGTTACCTAATCTGTATGTAGGTGCCCCACCAGCACTCATTAAAATGGAAGTATCCTCTGACCGCATGGCAGGTGCAACCCAGTATCTTGGACCTCCAAACTTATCTCCAGGACTGAACCCTCTTATTGTACCTCAGCGACGATCTGCAAAGCAGCATATTTGCACCATGTGCGGGAAGAACTTTTCCTCTGCAAGTGCCTTACAGATCCATGAAAGGACACACACCGGGGAGAAGCCGTTTGCTTGTACAATTTGTGGGAGAGCATTCACCACAAAGGGGAACCTTAAGGTCCATGTTGGAACCCACATGTGGAATAATTCTGCTCGTCGAGGGAGAAGACTATCTTTGGATGGCCAAATTCCTGCATTGGGAACAGATGCCAAGAAAGTAGCTGAGATTTTTCCAAAATTCATTGTGCCTTCTTCAGTCAGCATTGACCCCGCCATGTGGAACCAATACGCCACAGCGCTTAGTAATGGCTTGGCTTTGAAGACTAATGAGATCTCTGTTATACAGAACAGTGCCGTCCCTACGCTGCCAATTAGCAATGACGGTGCTCCTGTTCTCAGCACGGCTACCGTCGCCAATATCGACATTTCCCCGGCAGGTGTTGGCCAGACTATGACAGAAATTGGGGATTCCACAGTGGAGAGTGTACCAAAACACCAGNTTTCCACACTTTATGGAGGAAAATATTGCTGTGAACTANAAATANAGCCANAAAAGCTAATGCATTAT
  5   1   2       bld Tbd7                                 XL069j14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGACCCCTCTTATTGTCCCTCAGCGACGGTCAGCAAAGCAACATCTTTGTAACGCGTGCGGGAAGAATTTTTCCTCTGCAAGTGCCTTACAGATCCATGAAAGGACACACACCGGAGAGAAGCCATTTGCTTGTACGATTTGTGGCAGGGCATTCACCACAAAGGGAAACCTTAAGGTCCATGTTGGAACGCACATGTGGAATAATTCTGCTCGGAGAGGGAGAAGACTCTCTGTGGATAACCAAATTCCTGCATTGGGAGCTGATGCCAAGAAAGTGGCTGAGATTTTTCCAAAGTTCATTGTGCCTCCTACAGTCAGCATTGACCCCGCCATGTGGAACCAGTATGCCACCGCGCTTAGTAATGGCTTGGCTTTGAAGACTAATGAGATATCTGTTATACAAAACAGTGCCCTCCCTACGTTGCCTGTTGGCAATGGCGGTGCTCCTGTTATCAGTACAGCTACTGTTGCCAATATCGACGTTTCTCCAGCAGGTGTTGGCCAGACTATGACAGAAATTGGGGATTCTACTGCTGAGAGCGTAACAAAACACCAGTTTCCACACTTTATGGAAGGAAATATAACTGTGAACTAAAATCGAGCAGAAAGACTTATGCATTATGGACATCCATGGTTTTGCTGT
  5   1   2       bld Egg1                               PBX0112E03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAAGAATTTTTCCTCTGCAAGTGCCTTACAGATCCATGAAAGGACACACACCGGAGAGAAGCCATTTGCTTGTACGATTTGTGGCAGGGCATTCACCACAAAGGGAAACCTTAAGGTCCATGTTGGAACGCACATGTGGAATAATTCTGCTCGGAGAGGGAGAAGACTCTCTGTGGATAACCAAATTCCTGCATTGGGAGCTGATGCCAAGAAAGTGGCTGAGATTTTTCCAAAGTTCATTGTGCCTCCTACAGTCAGCATTGACCCCGCCATGTGGAACCAGTATGCCACCGCGCTTAGTAATGGCTTGGCTTTGAAGACTAATGAGATATCTGTTATACAAAACAGTGCCCTCCCTACGTTGCCTGTTGGCAATGGCGGTGCTCCTGTTATCAGTACAGCTACTGTTGCCAATATCGACGTTTCTCCAGCAGGTGTTGGCCAGACTATGACAGAAATTGGGGATTCTACTGCTGAAAGCGTAACAAAACACCAGTTTCCACACTTTATGGAAGGAAATATAACTGTGAACTAAAATCGAGCAGAA
  5   1   2       bld Tbd7                                 XL086d24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGAAACCTTAAGGTCCATGTTGGAACGCACATGTGGAATAATTCTGCTCGGAGAGGGAGAAGACTCTCTGTGGATAACCAAATTCCTGCATTGGGAGCTGATGCCAAGAAAGTGGCTGAGATTTTTCCAAAGTTCATTGTGCCTCCTACAGTCAGCATTGACCCCGCCATGTGGAACCAGTATGCCACCGCGCTTAGTAATGGCTTGGCTTTGAAGACTAATGAGATATCTGTTATACAAAACAGTGCCCTCCCTACGTTGCCTGTTGGCAATGGCGGTGCTCCTGTTATCAGTACAGCTACTGTTGCCAATATCGACGTTTCTCCAGCAGGTGTTGGCCAGACTATGACAGAAATTGGGGATTCTACTGCTGAGAGCGTAACAAAACACCAGTTTCCACACTTTATGGAAGGAAATATAACTGTGAACTAAAATCGAGCAGAAAGACTTATGCATTATGGACATCCATGGTTTTGCTGTTAGTCATGAATTGTTTTTCAGCAGTCtttttttttttttggaaanntttttttGGCNAA
  5   1   2       bld Tbd7      out                        XL087d24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAACCTTAAGGTCCATGTTGGAACGCACATGTGGAATAATTCTGCTCGGAGAGGGAGAAGACTCTCTGTGGATAACCAAATTCCTGCATTGGGAGCTGATGCCAAGAAAGTGGCTGAGATTTTTCCAAAGTTCATTGTGCCTCCTACAGTCAGCATTGACCCCGCCATGTGGAACCAGTATGCCACCGCGCTTAGTAATGGCTTGGCTTTGAAGACTAATGAGATATCTGTTATACAAAACAGTGCCCTCCCTACGTTGCCTGTTGGCAATGGCGGTGCTCCTGTTATCAGTACAGCTACTGNTGCCAATATCGACGTTTCTCCAGCAGGTGTTGGCCAGACTATGACAGAAATTGGGGATTCTACTGCTGAGAGCGTAACAAAACACCAGTTTCCACACTTTATGGAAGGAAATATAACTGTGAACTAAAATCGAGCAGAAAGACTTATGCATTATGGACATCCATGGTTTTGCTGTTAGTCATGAATTGTTTTTCAGCAGTCtttttttttttttggnaacttttttttG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)