Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 25 Oct 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL217h22.3                           13 END     7          63       53                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:7980761.5                       3 PI      85          4      521                hypothetical protein LOC100145489 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 95%

 1012776183 Xl3.1-XL151i04.5 - 11 ESTs
                                                                       ......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL151i04.5                           TGTTGCCGGGTTCGGCTCGCACCTCCAGTTCCTACGTTGATCGGTATAGGCGAGAAGTAGTTTCCCTGCTACGCTGGTGAGCACTGAGCAATAGAGCCCCCCGTCTCAGAGGCCGGCGAAACGTGACACGCGTGCCCGCGCACAGTTAGTTCCGTTCAGAGAAAGGAGGCTAATCGGGGGCGCGCACGCAGCCTCACAGGGCCGCTCCCGCGCACGCACCGCAAGGACCGCTCCCCCGTCTCAGGGCCGCCGATGAGGCAGGAGTGAGCAGGGCGAGTGTGTAAGATGGCGGACTTCCTGCCGTCCCACTCGATGTTTTCCGTGTGCTTTCCTAATTGTGTGCTCAACAGCCGGGAGGCCGACCAGCAGCGCAAGTCCAAGGAGATCGATCGCTGCCTATCCCGGGAGAAAACTTATGTCAAACGCCTGGTGAAGATCCTGTTGCTCGGGGCCGGGGAGAGCGGCAAATCTACTTTCCTCAAGCAGATGCGCATTATCCACGGGCAGGACTTCGATCTGCGGGCCAAGGAGGAGTTCCGGTCCACCATCTACAGCAATGTCATCAAAGGTATCCGGGTACTGGTGGATGCACGAGAGAAGCTCCACATTCCATGGGGCGAATCAGCCAATCAGAAGCACGGAGAGGTGATGATGGCTTTTGACACAAGGTCAGCCATGGTGGCCCAGGGTATGGTGGAAACTCAAGTATTCATGGCACACCTGGTATCGATTAGGGCATTGTGGGCAGACAGTGGCATACAGACGGCTTACGATCGGCGCAGAGAATTTCAATTGGGGGAATCTGTGAAGTATTTCTTGGACAATCTGGGCAAGCTCGGTGACAAGGATTATCTTCCAACCCAGCAAGACATCCTGCTAGCCCGACGG
                                                  Xl3.1-CHK-1012694921                                 CGGGTTCGGCTCGCACCTCCAGTTCCTACGTTGATCGGTATAGGCGAGAAGTAGTTTCCCTGCTACGCTGGTGAGCACTGAGCAATAGAGCCCCCCGTCTCAGAGGCCGGCGAAACGTGACACGCGTGCCCGCGCACAGTTAGTTCCGTTCAGAGAAAGGAGGCTAATCGGGGGCGCGCACGCAGCCTCACAGGGCCGCTCCCGCGCACGCACCGCAAGGACCGCTCCCCCGTCTCAGGGCCGCCGATGAGGCAGGAGTGAGCAGGGCGAGTGTGTAAGATGGCGGACTTCCTGCCGTCCCACTCGATGTTTTCCGTGTGCTTTCCTAATTGTGTGCTCAACAGCCGGGAGGCCGACCAGCAGCGCAAGTCCAAGGAGATCGATCGCTGCCTATCCCGGGAGAAAACTTATGTCAAACGCCTGGTGAAGATCCTGTTGCTCGGGGCCGGGGAGAGCGGCAAATCTACTTTCCTCAAGCAGATGCGCATTATCCACGGGCAGGACTTCGATCTGCGGGCCAAGGAGGAGTTCCGGTCCACCATCTACAGCAATGTCATCAAAGGTATCCGGGTACTGGTGGATGCACGAGAGAAGCTCCACATTCCATGGGGCGAATCAGCCAATCAGAAGCACGGAGAGGTGATGATGGCTTTTGACACAAGGTCAGCCATGGTGGCCCAGGGTATGGTGGAAACTCAAGTATTCATGGCACACCTGGTATCGATTAGGGCATTGTGGGCAGACAGTGGCATACAGACGGCTTACGATCGGCGCAGAGAATTTCAATTGGGGGAATCTGTGAAGTATTTCTTGGACAATCTGGGCAAGCTCGGTGACAAGGATTATCTTCCAACCCAGCAAGACATCCTGCTAGCC
                                                      consensus depths                                2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     4     5     4     5     4     5     4     5     4     5     5     6     5     6     5     6     6     7     6     7     6     7     6     7     6     8     7     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     8     7     8     8     8     8     8     8     8     7     8     8     9     8     8     8     8     7     7     7     7     7     7     7     7     6     7     7     7     7     7     7     7     8     8     7     8     7     8     7     8     7     8     7     8     7     8     6     7     6     7     5     7     4     6     4     5     4     5     3     5
                                               BLH ATG     285     313                           
                                               BLH MIN     285      96                           
                                               BLH MPR      33      96                           
                                               BLH OVR     285     641                           
                                               CDS MIN     285      96                           
                                               ORF LNG     285      21                           
                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Ci ==== 4e-028     NP_001027619.1 G protein alpha subunit Gi splicing variant CiGi1a [Ciona intestinalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Ce ==== 1e-033     NP_740789.1 G protein, class Q, Alpha subunit, EGg Laying defective EGL-30 (41.9 kD)(egl-30) [Caenorhabditis elegans] ======================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ag ---- 5e-041     XP_307876.4 AGAP009457-PA [Anopheles gambiae str. PEST] ------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                  PROTEIN --- Dm ---- 3e-043     NP_001036421.1 concertina CG17678-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = Cf ==== 3e-044     XP_548023.2 PREDICTED: similar to guanine nucleotide binding protein (G protein), alpha 13 [Canis familiaris] =================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Sp ---- 9e-052     NP_001001476.1 guanine nucleotide-binding protein G(12) alpha subunit [Strongylocentrotus purpuratus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Bt ---- 8e-055     XP_593131.3 PREDICTED: hypothetical protein [Bos taurus] -----------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Dr ==== 1e-085     NP_001012243.2 guanine nucleotide binding protein (G protein), alpha 13 [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Gg ==== 3e-091     XP_415686.1 PREDICTED: similar to guanine nucleotide binding protein (G protein), alpha 13 [Gallus gallus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Mm ==== 4e-092     NP_034433.3 guanine nucleotide binding protein, alpha 13 [Mus musculus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Hs ==== 7e-094     NP_006563.2 guanine nucleotide binding protein (G protein), alpha 13 [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Xt ==== 3e-104     NP_001120411.1 hypothetical protein LOC100145489 [Xenopus tropicalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Xl ==== 7e-112     NP_001088969.1 hypothetical protein LOC496349 [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-XL151i04.5                                                                                    TAG------------------------TGA------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------ATG---------TGA------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG---------------------ATG------------ATG------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ...
  5   1   2       bld Egg3 5g                         IMAGE:6870976.5p GATTCCCGGGTTCAGATGGCGTTTGGTGTTGCCGGGTTCGGCTCGCACCTCCAGTTCCTACGTTGATCGGTATAGGCGAGAAGTAGTTTCCCTGCTACGCTGGTGAGCACTGAGCAATAGAGCCCCCCGTCTCAGAGGCCGGCGAAACGTGACACGCGTGCCCGCGCACAGTTAGTTCCGTTCAGAGAAAGGAGGCTAATCGGGGGCGCGCACGCAGCCTCACAGGGCCGCTCCCGCGCACGCACCGCAAGGACCGCTCCCCCGTCTCAGGGCCGCCGATGAGGCAGGAGTGAGCAGGGCGAGTGTGTAAGATGGCGGACTTCCTGCCGTCCCACTCGATGTTTTCCGTGTGCTTTCCTAATTGTGTGCTCAACAGCCGGGAGGCCGACCAGCAGCGCAAGTCCAAGGAGATCGATCGCTGCCTATCCCGGGAGAAAACTTATGTCAAACGCCTGGTGAAGATCCTGTTGCTCGGGGCCGGGGAGAGCGGCAAATCTACTTTCCTCAAGCAGATGCGCATTATCCACGGGCAGGACTTCGATCTGCGGGCCAAGGAGGAGTTCCGGTCCACCATCTACAGCAATGTCATCAAAGGTATCCGGGTACTGGTGGATGCACGAGAGAAGCTCCACATTCCATGGGGCGAATCAGCCAATCAGAAGCACGGAGAAGTGATGATGGCTTTTGACACAAGGTCAGGCATGGTGGCCCCAGGTATGGTGGAAACTCCAGGATTCATGGCACACCTGGTATCGATTACGGGCATTTGTGTGCCAACCGTGGGCCTCACGAACGGCTTAAGAATCCGTGCCGCGAGATTTTTCAATTGGCGGGGGCACCGGCGGAACCCATTTCTCTTGGACACTCCCTGGGAAAGCTCCGGTGGCAAAGGGTATTTTCGCTTTCAAGCCTAGCCAGAGAAATTTCTCGCCCTAAAGCCCGAACGGTGCTACGCTCGCCACT
  5   1   2       bld Ga12 5g3  out                        XL200j12.5p               GATGGCGGATGGTGTTGCCGGGTTCGGCTCGCACCTCCAGTTCCTACGTTGATCGGTATAGGCGAGAAGTAGTTTCCCTGCTACGCTGGTGAGCACTGAGCAATAGAGCCCCCCGTCTCAGAGGCCGGCGAAACGTGACGCGCGTACCCGCGCACAGTTAGTTCCGTTCAGAGAAAGGAGGCTAATCGGGGGCGCGCACGCAGCCTCACAGTGCCGCTCCCGCGCACGCACCGCAAGGACCGCTCCCCCGTCTCAGGGCCGCCGATGAGGCAGGAGTGAGCAGGGCGAGTGTGTAAGATGGCGGACTTCCTGCCGTCCCACTCGATGTTTTCCGTGTGCTTTCCTAATTGTGTGCTCAACAGCCGGGAGGCCGACCAGCAGCGCAAGTCCAAGGAGATCGATCGCTGCCTATCCCGGGAGAAAACTTATGTCAAACGCCTGGTGAAGATCCTGTTGCTCGGGGCCGGGGAGAGCGGCAAATCTACTTTCCTCAAGCAGATGCGCATTATCCACGGGCAGGACTTCGATCTGCGGGCCAAGGAGGAGTTCCGGTCCACCATCTACAGCAATGTCATCAAAGGTATCCGGGTACTGGTGGATGCACNAGAGAAGCTCCACATTCCATGGGGCGAATCANC
  5   1   2       bld Neu5 5g                           Neu5-60B22A.5p                                                                            CGAGAAGTAGTTTCCCTGCTACGCTGGTGAGCACTGAGCAATAGAGCCCCCCGTCTCAGAGGCCGGCGAAACGTGACACGCGTACCCGCGCACAGTTAGTTCCGTTCAGAGAAAGGAGGCTAATCGGGGGCGCGCACGCAGCCTCACAGTGCCGCTCCCGCGCACAGCACCGCAAGGACCGCTCCCCCGTCTCAGGGCCGCCGATGAGGCAGGAGTGAGCAGGGCGAGTGTGTAAGATGGCGGACTTCCTGCCGTCCCACTCGATGTTTTCCGTGTGCTTTCCTAATTGTGTGCTCAACAGCCGGGAGGCCGACCAGCAGCGCAAGTCCAAGGAGATCGATCGCTGCCTATCCCGGGAGAAAACTTATGTCAAACGCCTGGTGAAGATCCTGTTGCTCGGGGCCGGGGAGAGCGGCAAATCTACTTTCCTCAAGCAGATGCGCATTATCCACGGGCAGGACTTCGATCTGCGGGCCAAGGAGGAGTTCCGGTCCACCATCTACAGCAATGTCATTAAAGGTTCCGGGTCTGGTGGATGCACGANAAAGCTCCACATTCA
  5   1   2      seed Ga12 5g3  out                        XL151i04.5p                                                                                                                                                                                                                                      GCTCCCGCGCACGCACCGCAAGGACCGCTCCCCCGTCTCAGGGCCGCCGATGAGGCAGGAGTGAGCAGGGCGAGTGTGTAAGATGGCGGACTTCCTGCCGTCCCACTCGATGTTTTCCGTGTGCTTTCCTAATTGTGTGCTCAACAGCCGGGAGGCCGACCAGCAGCGCAAGTCCAAGGAGATCGATCGCTGCCTATCCCGGGAGAAAACTTATGTCAAACGCCTGGTGAAGATCCTGTTGCTCGGGGCCGGGGAGAGCGGCAAATCTACTTTCCTCAAGCAGATGCGCATTATCCACGGGCAGGACTTCGATCTGCGGGCCAAGGAGGAGTTCCGGTCCACCATCTACAGCAATGTCATCAAAGGTATCCGGGTACTGGTGGATGCACGAGAGAAGCTCCACATTCCATGGGGCGAATCAGCCAATCAGAAGCACGGAGAGGTGATGATGGCTTTTGACACAAGGTCAGCCATGGTGGCCCAGGGTATGGTGGAAACTCAAGTATTCATGGCACACCTGGTATCGATTAGGGCATTGTGGGCAGACAGTGGCATACAGACGGCTTACGATCGGCGCAGAGAATTTCAATTGGGGGAATCTGTGAAGTATTTCTTGGACAATCTGGGCAAGCTCGGTGACAA
  5   1   2       bld Ga18 5g3  out                      xlk76f08ex.5p                                                                                                                                                                                                                                               TCCCGCGCANNNNCNNAANNCCGCTCCCCCGTCTCAGGGCCGCCGATGAGGNNGAGTGAGCAGNNNNGTGTGTAAGATGGCGGACTTCCTGCCGTCCCACTCGATGTTTTCCGTGTGCTTTCCTAATTGTGTGCTCAACAGCCGGGAGCNACCAGCNNNNNNGTCCAAGGAGATCGATCGCTGCCTATCCCGGGAGAAAACTTATGTCAAACGCCTGGTGAAGATCCTGTTGCTCGGGGCCGGGGAGAGCGGNAAATCTACTTTCCTCAAGCAGATGCGCATTATCCACGGGCAGGACTTCGATCTGCGGGCCAAGGAGGANNNNNNGTCCACCATCTACAGCAATGTCATCAAAGGTATCCGGGTACTGGTGGATGCACGAGAGAAGCTCCACATTCCATGGGGCGAATCAGCCAATCAGAAGCACGGAGAGGTGATGATGGCTTTTGACACAAGGNCAGCCATGGTGGNCCAGGGTATGGTGGAAACTCAAGTATTCATGGCACACCTGGTATCGATTAGGGCATTGTGGGCAGACAGTGGNATACAGACGGCTTACGATCGGCGCAGAGAATTTCAATTNGGGGAATCTGTGAAGNATTTCTTGGACAATCTGGGCAAGNTCNGTGACNAGGNTTATCTTCCNACCCAGCAAGANATCCTGCTAGCCCGANGNC
  5   1   2       bld Ga12 5g3  out                        XL166o22.5p                                                                                                                                                                                                                                                                                                     GGCAGGGCGAGTGTGTAAGATGGCGGACTTCCTGCCGTCCCACTCGATGTTTTCCGTGTGCTTTCCTAATTGTGTGCTCAACAGCCGGGAGGCCGACCAGCAGCGCAAGTCCAAGGAGATCGATCGCTGCCTATCCCGGGAGAAAACTTATGTCAAACGCCTGGTGAAGATCCTGTTGCTCGGGGCCGGGGAGAGCGGCAAATCTACTTTCCTCAAGCAGATGCGCATTATCCACGGGCAGGACTTCGATCTGCGGGCCAAGGAGGAGTTCCGGTCCACCATCTACAGCAATGTCATCAAAGGTATCCGGGTACTGGTGGATGCACGAGAGAAGCTCCACATTCCATGGGGCGAATCAGCCAATCAGAAGCACGGAGAGGTGATGATGGCTTTTGACACAAGGTCAGCCATGGTGGCCCAGGGTATGGTGGAAACTCAAGTATTCATGGCACACCTGGTATCGATTAGGGCATTGTGGGCAGACAGTGGCATACAGACGGCTTACGATCGGCGCAGAGAATTTCAATTGGGGGAATCTGTGAAGTATTTCTTGGACAATCTGGGCAAGCTCGGTGACAAGGATTATCTTCC
  5   1   2       bld Ga12      out                        XL217h22.5p                                                                                                                                                                                                                                                                                                                                           CCCACTCGATGTTTTCCGTGTGCTTTCCTAATTGTGTGCTCAACAGCCGGGAGGCCGACCAGCAGCGCAAGTCCAAGGAGATCGATCGCTGCCTATCCCGGGAGAAAACTTATGTCAAACGCCTGGTGAAGATCCTGTTGCTCGGGGCCGGGGAGAGCGGCAAATCTACTTTCCTCAAGCAGATGAGCATTATCCACGGGCAGGACTTCGATCTGCGGGCCAAGGAGGAGTTCCGGTCCACCATCTACAGCAATGTCATCAAAGGTATCCGGGTACTGGTGGATGCACGAGAGAAGCTCCACATTCCATGGGGCGAATCAGCCAATCAGAAGCACGGAGAGGTGATGATGGCTTTTGACACAAGGTCAGCCATGGTGGCCCAGGGTATGGTGGAAACTCAAGTATTCATGGCACACCTGGTATCGATTAGGGCATTGTGGGCAGACAGTGGCATACAGACGGCTTACGATCGGCGCAGAGAATTTCAATTGGGGGAATCTGTGAAGTATTTCTTGGACAATCTGGGCAAGCTCGGTGACAAGGATTATCTTCCAACCCAGCAAGACATCCTGCTAGCCCGACGGC
  5   1   2       bld Neu7      out                        XL040m01.5p                                                                                                                                                                                                                                                                                                                                                                                                 GCCGACCGCAGCGCAAGTCCAAGGAGATCGATCGCTGCCTATCCCGGGAGAAAACTTATGTCAAACGCCTGGTGAAGATCCTGTTGCTCGGGGCCGGGGAGAGCGGCAAATCTACTTTCCTCAAGCAGATGCGCATTATCCACGGGCAGGACTTCGATCTGCGGGCCAAGGTTGAGTTCCGGTCCACCATCTACAGCAATGTCATCAAAGGTATCCGGGTACTGGTGGATGCACGAGAGAAGCTCCACATTCCATGGGGCGAATCAGCCAATCAGAAGCACGGAGAGGTGATGATGGCTTTTGACACAAGGTCAGCCATGGTGGCCCAGGGTATGGTGGAAACTCAAGTATTCATGGCACACCTGGTATCGATTAGGGCATTGTGGGCAGACAGTGGCATACAGACGGCTTACGATCGGCGCAGAGAATTTCAATTGGGGGAATCTGTGAAGTATTT
  5   1   2       bld Neu7      out                        XL040j01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCGGGAGAAAACTTATGCCAAACGCCTGGTGAAGATCCTGTTGCTCGGGGCCGGGGAGAGCGGCAAATCTACTTTCCTCAAGCAGATGCGCATTATCCACGGGCAGGACTTCGATCTGCGGGCCA
  5   1   2       bld Emb1                            IMAGE:5155100.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATGCACGAGAGAAGCTCCACATTCCATGGGGCGAATCAGCCAATCAGAAGCACGGAGAGGTGATGATGGCTTTTGACACAAGGTCAGCCATGGTGGCCCAGGGTATGGTGGAAACTCAAGTATTCATGGCACACCTGGTATCGATTAGGGCATTGTGGGCAGACAGTGGCATACAGACGGCTTACGATCGGCGCAGAGAATTTCAATTGGGGGAATCTGTGAAGTATTTCTTGGACAATCTGGGCAAGCTCGGTGACAAGGATTATCTTCCAACCCAGCAAGACATCCTGCTAGCCCGACGGCCCACCAAAGGAATTCATGAATATGACTTTGAGATCAAAAATGTTCCCTTCAAGATGGTAGATGTGGGAGGTCAGAGGTCAGAGCGCAAGCGCTGGTTTGAGTGTTTTGACAGCGTGACCTCCATACTTTTCCTGGTGTCATCGAGTGAATACGACCAAGTCCTGATGGAAGACAGGCAGACAAACCGCCTCACTGAGTCTCTGAACATCTTTGAAACAATAGTCAACAACCGCGTGTTCAGCAACGGTCTCCATCATCCCTATTCCCTAAACAAAGACTTGGACCTTGCTGGGAGGGAGGAAAGGTAAAAAAATAAGTGGAAGCCATTTAAGGGGACTTATTTTTTGCAAGATTTTTCGGAAGGGAGGAGCCCCCCACCTGGCCCTTTGAAAGGATGGGGCAAAAAAGGTTCCTTTGGGTAAAAATTTGTTTTTCCCGAAAANCAAAGCCGGGCGGGGGAATTCCAGGGAGGCAGGAAAACCCCTCCTTCTTACCCACATCAACTTTTCAACCAACCGGGCCCATTAAAAACAAACCGGAAAGGAAAACATTTCCCCGCCCCTGGGGTTTTTTTCCCCGCCGGAATGTGTTTAAAAAGAAATACCC
  5   1   2       bld Ga18      ?                       xlk131a20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACACCTGGTATCGATTAGGGCATTGTGGGCAGACAGTGGCATACAGACGGCTTACGATCGGCGCAGAGAATTTCAATTGGGGGAATCTGTGAAGTATTTCTTGGACAATCTGGGCAAGCTCGGTGACAAGGATTATCTTCCAACCCAGCAAGACATCCTGCTAGCCCGACGNCCACCAAAGGAANTCATGAATNTGACTTTGAGANCAAAAANNNTCCCTTCAAGnnnnnnnnnGGGAGGCAGAGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)