Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 25 Jun 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-rxlk74o04ex.3                         9 END     5          55       55                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012776191 Xl3.1-IMAGE:3378109-IMAGp.5 - 9 ESTs
                                                                       -80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:3378109-IMAGp.5                                                                                 GCTGCTTGTGAGGTGAAGAGAGAGAAGTGGTTCCTCGGTTCAGCAATCAAGCAACAGCGTAACTCAGCCGGCAGATATGAGTTCTTCTAGTAGCTCTCTGGATGATGAGGATACCTTTAAGATCCTGGTTGCTACTGACATTCACTTGGGCTTTATGGAGAAAGATGCTGTGCGGGGAAATGACAGCTTTGTGGCTTTTGATGAAATCCTCCGACTCGCTCAAGACAATGAAGTTGACTTCCTTCTTTTGGGTGGAGATCTTTTCCATGACAACAAACCCTCCAGAAGGACCCTCCACATTTGTTTAGAACAGTTGAGGAAGTATTGCATGGGCGATCGTCCAATTGAGTTTGAGGTTCTGAGTGACCAGTCTGTAAATTTTGGCTATAGCAAATTTCCTTGGGTGAATTACCAGGATAACAATCTGAATATTTCTCTGCCAGTCTTCAGTGTGCATGGAAACCACGATGACCCAACAGGGGCAGATGCTCTTTGCGCTTTGGATATTTTAAGCAGCGCTGGGCTCGTGAATCACTTTGGACGTGCTACATCTGTAGAAAAGATAGACATTAGCCCTGTATTGCTGCAGAAGGGCCACTCAAAGATCGCTCTGTATGGACTCGGGTCCATACCTGATGAGCGACTGTATCGAATGTTTGTTAATAAACAAGTCATGATGCTGCGCCCTCGAGAGGATGAGTCCAGCTGGTTTAACTTGTTTGTTATCCATCAGAACAGGAGTAAACATGGCCCAACAAATTACATCCCGGAACAGTTTTTAGATGAGTTTTTGGATTTGGTTATTTGGGGTCACTA
                                                  Xl3.1-CHK-1012697525                                                                                       TGTGAGGTGAAGAGAGAGAAGTGGTTCCTCGGTTCAGCAATCAAGCAACAGCGTAACTCAGCCGGCAGATATGAGTTCTTCTAGTAGCTCTCTGGATGATGAGGATACCTTTAAGATCCTGGTTGCTACTGACATTCACTTGGGCTTTATGGAGAAAGATGCTGTGCGGGGAAATGACAGCTTTGTGGCTTTTGATGAAATCCTCCGACTCGCTCAAGACAATGAAGTTGACTTCCTTCTTTTGGGTGGAGATCTTTTCCATGACAACAAACCCTCCAGAAGGACCCTCCACATTTGTTTAGAACAGTTGAGGAAGTATTGCATGGGCGATCGTCCAATTGAGTTTGAGGTTCTGAGTGACCAGTCTGTAAATTTTGGCTATAGCAAATTTCCTTGGGTGAATTACCAGGATAACAATCTGAATATTTCTCTGCCAGTCTTCAGTGTGCATGGAAACCACGATGACCCAACAGGGGCAGATGCTCTTTGCGCTTTGGATATTTTAAGCAGCGCTGGGCTCGTGAATCACTTTGGACGTGCTACATCTGTAGAAAAGATAGACATTAGCCCTGTATTGCTGCAGAAGGGCCACTCAAAGATCGCTCTGTATGGACTCGGGTCCATACCTGATGAGCGACTGTATCGAATGTTTGTTAATAAACAAGTCATGATGCTGCGCCCTCGAGAGGATGAGTCCAGCTGGTTTAACTTGTTTGTTATCCATCAGAACAGGAGTAAACATGGCCCAACAAATTACATCCCGGAACAGTTTTTAGATGAGTTTTTGGATTTGGTTATTTGGGGTCACTAGCATGA
                                                      consensus depths                                                                                      3     3     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     6     6     7     6     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     8     9     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     5     7     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     3     5     4     5     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     4
                                               BLH ATG      76     849                                                                                 
                                               BLH MIN      34     147                                                                                 
                                               BLH OVR      76    1040                                                                                 
                                               ORF LNG      76      49                                                                                 
                                                                       PROTEIN --- Ce ---- 3e-067     NP_505736.2 yeast MRE recombination/repair homolog family member (mre-11) [Caenorhabditis elegans] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                REMOVED -== Dm ==== 7e-074     NP_523547.1 PROBABLY REMOVED OR REPLACED [Drosophila melanogaster]  ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                               PROTEIN --- At ==== 3e-074     NP_200237.1 DNA repair and meiosis protein (Mre11) [Arabidopsis thaliana] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                   PROTEIN --- ?? ---- 3e-078     XP_628997.1 DNA repair exonuclease [Dictyostelium discoideum AX4] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                  PREDICTED - Sp ==== 3e-095     XP_001185673.1 PREDICTED: similar to MRE11 meiotic recombination 11 homolog A, partial [Strongylocentrotus purpuratus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                      PROTEIN === Gg ==== 4e-120     NP_990109.1 Mre11 [Gallus gallus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                   PROTEIN === Dr ==== 1e-120     NP_001001407.1 meiotic recombination 11 homolog A [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                      PREDICTED = Cf ==== 2e-125     XP_542244.2 PREDICTED: similar to Double-strand break repair protein MRE11A (MRE11 homolog 1) (MRE11 meiotic recombination 11 homolog A) [Canis familiaris] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                      PROTEIN === Mm ==== 1e-125     NP_061206.1 meiotic recombination 11 homolog A [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                      PREDICTED = Bt ==== 7e-126     XP_603439.3 PREDICTED: similar to DNA recombination and repair protein [Bos taurus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                      PROTEIN === Hs ==== 2e-126     NP_005581.2 meiotic recombination 11 homolog A isoform 2 [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                   PREDICTED = Xt ==== 2e-139     NP_001107519.1 hypothetical protein LOC100135381 [Xenopus tropicalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                   PREDICTED = Xl ==== 3e-143     NP_001080975.1 putative nuclease Mre11 [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                           Xl3.1-IMAGE:3378109-IMAGp.5                                                                                              TGA------------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATGATG
                                                                   ORF                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ...
  5   1   2      seed Egg3 5g                IMAGE:3378109-IMAGp.IMAGp                                                               TTTCCCGGGGCTTTTCAGGCTGCTTGTGAGGTGAAGAGAGAGAAGTGGTTCCTCGGTTCAGCAATCAAGCAACAGCGTAACTCAGCCGGCAGATATGAGTTCTTCTAGTAGCTCTCTGGATGATGAGGATACCTTTAAGATCCTGGTTGCTACTGACATTCACTTGGGCTTTATGGAGAAAGATGCTGTGCGGGGAAATGACAGCTTTGTGGCTTTTGATGAAATCCTCCGACTCGCTCAAGACAATGAAGTAGACTTCCTTCTTTTGGGTGGAGATCTTTTCCATGACAACAAACCCTCCAGAAGGACCCTCCACATTTGTTTAGAACAGTTGAGGAAGTATTGCATGGGCGATCGTCCAATTGAGTTTGAGGTTCTGAGTGACCAGTCTGTAAATTTTGGCTATAGCAAATTTCCTTGGGTGAATTACCAGGATAACAATCTGAATATTTCTCTGCCAGTCTTCAGTGTGCATGGAAACCACGATGACCCAACAGGGGCAGATGCTCTTTGCGCTTTGGATATTTTAAGCAGCGCTGGGCTCGTGAATCACTTTGGACGTGCTACATCTGTAGAAAAGATAGACATTAGCCCTGTATTGCTGCAGAAGGGCCACTCAAAGATCGCTCTGTATGGACTCGGGTCCATACCTGATGAGCGACTGTATCGAATGTTTGTTAATAAACAAGTCATGATGCTGCGCCCTCGAGAGGATGAGTCCAGCTGGTTTAACTTGTTTGTTATCCATCAGAACAGGAGTAAACATGGCCCAACAAATTACATCCCGGAACAGTTTTTAGATGAGTTTTTGGATTTGGTTATTTGGGGGTCACGAGCATGAGTGCAAAATCGCGCCAACAAGGAATGAACAGCAACTCTTCTACGTGTCCCAGCCTGGAAGTTCGGTGGCCACATCCCTTTCTCCAGGGGAGGCAGAAAAAAGCATGTGGGTTTATTGCGAATTAAAGGGaaaaaaaaTGAACATGCAGA
  5   1   2       bld Egg3 5g3  out                   IMAGE:3378109.5p                                                                     CGGGCTTTTCAGGCTGCTTGTGAGGTGAAGAGAGAGAAGTGGTTCCTCGGTTCAGCAATCAAGCAACAGCGTAACTCAGCCGGCAGATATGAGTTCTTCTAGTAGCTCTCTGGATGATGAGGATACCTTTAAGATCCTGGTTGCTACTGACATTCACTTGGGCTTTATGGAGAAAGATGCTGTGCGGGGAAATGACAGCTTTGTGGCTTTTGATGAAATCCTCCGACTCGCTCAAGACAATGAAGTAGACTTCCTTCTTTTGGGTGGAGATCTTTTCCATGACAACAAACCCTCCAGAAGGACCCTCCACATTTGTTTAGAACAGTTGAGGAAGTATTGCATGGGCGATCGTCCAATTGAGTTTGAGGTTCTGAGTGACCAGTCTGTAAATTTTGGCTATAGCAAATTTCCTTGGGTGAATTACCAGGATAACAATCTGAATATTTCTCTGCCAGTCTTCAGTGTGCATGGAAACCACGATGACCCAACAGGGGCA
  5   1   2       bld Te2  5g3  out                   IMAGE:7391659.5p                                                                             TCAGGCTGCTTGTGAGGTGAAGAGAGAGAAGTGGTTCCTCGGTTCAGCAATCAAGCAACAGCGTAACTCAGCCGGCAGATATGAGTTCTTCTAGTAGCTCTCTGGATGATGAGGATACCTTTAAGATCCTGGTTGCTACTGACATTCACTTGGGCTTTATGGAGAAAGATGCTGTGCGGGGAAATGACAGCTTTGTGGCTTTTGATGAAATCCTCCGACTCGCTCAAGACAATGAAGTTGACTTCCTACTTTTGGGTGGAGATCTTTTCCATGACAACAAACCCTCCAGAAGGACCCTCCACATTTGTCTAGAACAGTTGAGGAAGTATTGCATGGGCGATCGTCCAATTGAGTTTGAGGTTCTGAGTGACCAGTCTGTAAATTTTGGCTATAGCAAATTTCCTTGGGTGAATTACCAGGATAACAATCTGAATATTTCTCTGCCAGTCTTCAGTGTGCATGGGAACCACGATGANCCACAGGGGCAGATGCTNCTTGCGCTTTGGATATTTTAGCAGCGCTGGGCTCGTGAATCACTTTGGACGTGCTACATCTGTAGAAAGGTAGACATTACCCTGATTGCTGCAGAAGGCCACTCAAGATCGCTCTGTATGATCCGGTCATCCTGATGGCGATGGATCGATGTTTGTTATAACAGTCTGATGTGCCCCTCAAAGAGATCCGCTGGTTACTGGTT
  5   1   2       bld Egg1 5g                            PBX0098G10.5p                                                                                             GTGAAGAGAGAGAAGTGGTTCCTCGGTTCAGCAATCAAGCAACAGCGTAACTCAGCCGGCAGATATGAGTTCTTCTAGTAGCTCTCTGGATGATGAGGATACCTTTAAGATCCTGGTTGCTACTGACATTCACTTGGGCTTTATGGAGAAAGATGCTGTGCGGGGAAATGACAGCTTTGTGGCTTTTGATGAAATCCTCCGACTCGCTCAAGACAATGAAGTTGACTTCCTTCTTTTGGGTGGAGATCTTTTCCATGACAACAAACCCTCCAGAAGGACCCTCCACATTTGTTTAGAACAGTTGAGGAAGTATTGCATGGGCGATCGTCCAATTGAGTTTGAGGTTCTGAGTGACCAGTCTGTAAATTTTGGCTATAGCAAATTTCCTTGGGTGAATTACCAGGATAACAATCTGAATATTTCTCTGCCAGTCTTCAGTGTGCATGGAAACCACGATGACCCAACAGGGGCAGATGCTCTTTGCGCTTTGGATATTTTAAGCAGCGCTGGGCTCGTGAATCACTTTGGACGTGCTACATCTGTAGAAAAGATAGACATTAGCCCTGTATTGCTGCAG
  5   1   2       bld Ga12 5g3  out                        XL169j05.5p                                                                                                                                        CAGCGTAACTAGCCGGCAGATATGAGTTCTTCTAGTAGCTCTCTGGATGATGAGGATACCTTTAAGATCCTGGTTGCTACTGACATTCACTTGGGCTTTATGGAGAAAGATGCTGTGCGGGGAAATGACAGCTTTGTGGCTTTTGATGAAATCCTCCGACTCGCTCAAGACAATGAAGTTGACTTCCTTCTTTTGGGTGGAGATCTTTTCCATGACAACAAACCCTCCAGAAGGACCCTCCACATTTGTTTAGAACAGTTGAGGAAGTATTGCATGGGCGATCGTCCAATTGAGTTTGAGGTTCTGAGTGACCAGTCTGTAAATTTTGGCTATAGCAAATTTCCTTGGGTGAATTACCAGGATAACAATCTGAATATTTCTCTGCCAGTCTTCAGTGTGCATGGAAACCACGATGACCCAACAGGGGCAGATGCTCTTTGCGCTTTGGATATTTTAAGCAGCGCTGGGCTCGTGAATCACTTTGGACGTGCTACATCTGTAGAAAAGATAGACATTAGCCCTGTATTGC
  5   1   2       bld Egg3                            IMAGE:6868438.5p                                                                                                                                                                                      CCCGGGGAGGATACCTTTATACTCCTGGTTGCTACTGACTTCACTTGGGCTTTATGGAGAAAGATGCTGTGCGGGGAAATGACAGCTTTGTGGCTTTTGATGAAATCCTCCGACTCGCTCAAGACAATGAAGTTGACTTCCTTCTTTTGGGTGGAGATCTTTTCCATGACAACAAACCCTCCAGAAGGACCCTCCACATTTGTTTAGAACAGTTGAGGAAGTATTGCATGGGCGATCGTCCAATTGAGTTTGAGGTTCTGAGTGACCAGTCTGTAAATTTTGGCTATAGCAAATTTCCTTGGGTGAATTACCAGGATAACAATCTGAATATTTCTCTGCCAGTCTTCAGTGTGCATGGAAACCACGATGACCCAACAGGGGCAGATGCTCTTTGCGCTTTGGATATTTTAAGCAGCGCTGGGCTCGTGAATCACTTTGGACGTGCTACATCTGTAGAAAAGATAGACATTAGCCCTGATGAGCGACTGTATCGAATGTTTGTTAATAAACAAGTCATGATGCTGCGCCCTCGAGAGGATGAGTCCAGCTGGTTTAACTTGTTTGTTATCCATCAGAACAGGAGTAAACATGGCCCAACAAATTACATCCCGGAACAGTTTTTAGATGAGTTTTTGGATTTGGTTATTTGGGGTCACGAGCATGAGTGCAAAATCGCGCCAACAAGGAATGAACAGCAACTCTTCTACGTGTCCCAGCCTGGAAAGTTCGGGGGCACATCCCTTTTCTCCAGGGAGGCAGAAAAAAAGCATGTGGGTTTATTGCGAATTAAAGGGAAAAAAATGAACATGCAGAAGATTCCCCTGCAGACAGTCCGCCAGTTCTTCATTGAAAACCTTGTTCTTAAGGGACTACCCTGAATATATTTCAACCAGGACAAT
  5   1   2       bld Tbd7      out                        XL084c20.5p                                                                                                                                                                                                         GATCCTGGTTGCTACTGACATTCACTTGGGCTTTATGGAGAAAGATGCAGTGCGGGGAAATGACAGCTTTGTGGCTTTTGATGAAATCCTCCGACTCGCTCAAGACAATGAAGTTGACTTCCTACTTTTGGGTGGAGATCTTTTCCATGACAACAAACCCTCCAGAAGGACCCTCCACATTTGTTTAGAACAGTTGAGGAAGTATTGCATGGGCGATCGTCCAATTGAGTTTGAGGTTCTGAGTGACCAGTCTGTAAATTTTGGCTATAGCAAATTTCCTTGGGTGAACTACCAGGATAACAATCTGAATATTTCTCTGCCAGTCTTCAGTGTGCATGGAAACCACGATGACCCAACAGGGGCAGATGCTCTTTGCGCTTTGGATATTTTAAGCAGCGCTGGGCTCGTGAATCACTTTGGACGTGCTACATCTGTAGAAAAGATAGACATTAGCCCTGTATTGCTGCAGAAGGGCCACTCAAAGATCGCTCTGTATGGACTCGGGTCCATACCTGATGAGCGACTGTATCGAATGTTTGTTAATAAACAAGTCATGATGCTGCGCCCTCGAGAAGATGAGTCCAGCTGGTTT
  5   1   2       bld Sp1       out                   IMAGE:4969120.5p                                                                                                                                                                                                                                                               CCACGCGTCCGGCTTTGTGGCTTTTGATGAAATCCTCCGACTCGCTCAAGACAATGAAGTTGACTTCCTTCTTTTGGGTGGAGATCTTTTCCATGACAACAAACCCTCCAGAAGGACCCTCCACATTTGTTTAGAACAGTTGAGGAAGTATTGCATGGGCGATCGTCCAATTGAGTTTGAGGTTCTGAGTGACCAGTCTGTAAATTTTGGCTATAGCAAATTTCCTTGGGTGAATTACCAGGATAACAATCTGAATATTTCTCTGCCAGTCTTCAGTGTGCATGGAAACCACGATGACCCAACAGGGGCAGATGCTCTTTGCGCTTTGGATATTTTAAGCAGCGCTGGGCTCGTGAATCACTTTGGACGTGCTACATCTGTAGAAAAGATAGACATTAGCCCTGTATTGCTGCAGAAGGGCCACTCAAAGATCGCTCTGTATGGACTCGGGTCCATACCTGATGAGCGACTGTATCGAATGTTTGTTAATAAACAAGTCATGATGCTGCGCCCTCGAGAGGATGAGTCCAGCTGGTTTAACTTGTTTGTTATCCATCAGAACAGGAGTAAACATGGCCCAACAAATTACATCCCGGAACAGTTTTTAGATGAGTTTTTGGATTTGGTTATTTGGGGTCACGAGCATGAGTGC
  5   1   2       bld Egg1                               PBX0134B07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAATTTCCTTGGGTGAATTACCAGGATAACAATCTGAATATTTCTCTGCCAGTCTTCAGCGTGCATGGAAACCACGATGACCCAACAGGGGCAGATGCTCTTTGCGCTTTGGATATTTTAAGCAGCGCTGGGCTCGTGAATCACTTTGGACGTGCTACATCTGTAGAAAAGATAGACATTAGCCCTGTATTGCTGCAGAAGGGCCACTCAAAGATCGCTCTGTATGGACTCGGGTCCATACCTGATGAGCGACTGTATCGAATGTTTGTTAATAAACAAGTCATGATGCTGCGCACTCGAGAGGATGAGTCCAGCTGGTTTAACTTGTTTGTTATCCATCAGAACAGGAGTGAACATGGCCCAACAAATTACATCCCGGAACAGTTTTTAGATGAGTTTTTGGATTTGGATATTTGGGGTCACTAGCATGAGTGCAAAATCGCGCCAACAAGGAATGAACAGCAACTCTTCTACGTGTCCCAGCCTGGAAGTTCGGTGGCCACATCCCTTTCTCCAGGGGAGGCAGAAAAAAAGCATGTGGGTTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)