Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 05 Jun 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

 This cluster: approximate FL confidence score = 91%

 1012776241 Xl3.1-xl304l23.3 - 14 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           2     2     2     2     2     2     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     6     6     6     6     5     6     5     6     5     6     5     6     5     6     5     6     4     5     4     5     5     5     5     5     3     4     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     4     3     5     3     5     3     5     3     5     3     5     3     5     4     6     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     8     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     6     6     6     6     6     5     6     4     6     4     6     4     6     4     6     4     6     3     6     2     5
                                               BLH ATG      42     611                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Gg ---- 3e-008     XP_415415.2 PREDICTED: hypothetical protein [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- At ---- 3e-011     NP_001030635.1 ankyrin repeat family protein [Arabidopsis thaliana] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Os ---- 1e-012     NP_001056893.1 Os06g0163000 [Oryza sativa (japonica cultivar-group)] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Dm ---- 3e-035     NP_001097405.1 CG13502 CG13502-PC, isoform C [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Ag ---- 1e-040     XP_554753.3 AGAP011462-PA [Anopheles gambiae str. PEST] ------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xt ==== 6e-149     AAI58492.1 Unknown (protein for IMAGE:7793997) [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Sp ---- 3e-150     XP_001182473.1 PREDICTED: similar to outer arm dynein binding protein [Strongylocentrotus purpuratus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Dr ==== 8e-159     NP_956610.1 hypothetical protein MGC56362 [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Cf ==== 1e-171     XP_548096.2 PREDICTED: similar to CG13502-PA, isoform A [Canis familiaris] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Mm ---- 5e-172     NP_083194.2 tetratricopeptide repeat domain 25 [Mus musculus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Bt ==== 1e-172     NP_001096778.1 tetratricopeptide repeat domain 25 [Bos taurus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Hs ==== 2e-174     NP_113609.1 hypothetical protein LOC83538 [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Xl ==== 0          AAH68935.1 LOC414568 protein [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-xl304l23.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATG---------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
  5   1   2      skin DMZ  5g3  in                         xl304l23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CACAACACGCTGGTGCCGCTGGTGCAGAGAGAAGGCAAAGCTATGGCTGAGGAGACGGACGAGCAACAGGCGCCCCAAAGCACATTCAGCACTTACATGGCAGAGGGGGAGCAGCTGTATCACAAGGCGGAGTACAAGAAGGCCTCAGACAGTTTCACTGCGGCACTTCAGCTCCAACCTGAAGAGAAGAACTGCCTCGTTGCTCGTTCCAAGTGTTTCCTAAAACTCGGGGAGCCAGAATGTGCCCTGAAGGATGCAGAGGCCTCTCTACAGATCGAAAACGATTTCTTCAAGGGTCTTTACCAGAAGGCAGAGGCGCTCTACGCCATGGGAGACTTTGAGTTTGCCCTTGTGCATTACCACAGAGGGTACAAGCTGCGACCAGAATTTCAGGGATTCCGTCTGGGGATACAAAAGGCTCAGGAAGCAATTGAGAACTCAGTCGGAACTCCTGCCAGTGTTAAACTCGAAAATAAAACAGACTTACAGTTTATAAGCCGACAAGAAGAGAGCAAGAAGGCTAAACAAAAGGCTCAGGTCAAGGTGCAGAAGAAGGATTCAAAGCAGCAGAAGAAAGTAGATCCTGAAAGGAGCCAGAAGACCGTGCGCCAGCTCCTCGGAGAACTGTACAGTGATAAGGAATATCTGGAATCATTATTAAGGGATGAAGCTCTAGTGAAAGGCAATACACGAGGTGGGGTCAAACTGCACGACCTGA
  5   1   2       bld Neu7 5g3  in                         XL036p21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGCAAAGCTATGGCTGAGGAGACGGACGAGCAACAGGCGCCCCAAAGCACATTCAGCACTTACATGGCAGAGGGGGAGCAGCTGTATCACAAGGCGGAGTACAAGAAGGCCTCAGACAGTTTCACTGCGGCACTTCAGCTCCAACCTGAAGAGAAGAACTGCCTCGTTGCTCGTTCCAAGTGTTTCCTAAAACTCGGGGAGCCAGAATGTGCCCTGAAGGATGCAGAGGCCTCTCTACAGATCGAAAACGATTTCTTCAAGGGTCTTTACCAGAAGGCAGAGGCGCTCTACGCCATGGGAGACTTTGAGTTTGCCCTTGTGCATTACCACAGAGGGTACAAGCTGCGACCAGAATTTCAGGGATTCCGTCTGGGGATTCAGAAGGCTCAGGAAGCAATTGAGAACTCAGTCGGAACTCCTGCCAGTGTTAAACTCGAAAATAAAACAGACTTACAGTTTATAAGCCGACAAGAAGAGAGCAAGAAGGCTAAACAAAAGGCTCAGGTCAAGGTGCAGAAGAAGGATTCAAAGCAGCAGAAGAAAGTAGATCCTGAAAGGAGCCAGAAGACCGTGCGCCAGCTCCTCGGAGAACTGTACAGTGATAAGGA
  5   1   2       bld Emb1 5g                         IMAGE:6631998.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAAGCTATGGCTGAGGAGACGGACGAGCAACAGGCGCCCCAAAGCACATTCAGCACTTACATGGCAGAGGGGGAGCAGCTGTATCACAAGGCGGAGTACAAGAAGGCCTCAGACAGTTTCACTGCGGCACTTCAGCTCCAACCTGAAGAGAAGAACTGCCTCGTTGCTCGTTCCAAGTGTTTCCTAAAACTCGGGGAGCCAGAATGTGCCCTGAAGGATGCAGAGACCTCTCTACAGATCGAAAACGATTTCTTCAAGGGTCTTTACCAGAAGGCAGAGGCGCTCTACGCCATGGGAGACTTTGAGTTTGCCCTTGTGCATTACCACAGAGGGTACAAGCTGCGACCAGAATTTCAGGGATTCCGTCTGGGGATTCAAAAGGCTCAGGAAGCAATTGAGAACTCAGTCGGAACTCCTGCCAGTGTTAAACTCGAAAATAAAACAAACTTACAGTTTATAAGCCGACAAGAAGAGAGCAAGAAGGCTAAACAAAAGGCTCAGGTCAAGGTGCAGAAGAAGGATTCAAAGCAGCAGAAGAAAGTAGATCCTGAAAGGAGCCAGAAGACCGTGCGCCAGCTCCTCGGAGAACTGTACAGTGATAAGGAATATCTGGAATCATTATTAAGGGATGAAGCTCTAGTGAAAGGCAATACACGAGGTGGGGTCAAACTGCACGACCTGATCATTAATGGAATCCTGTACCTGGACACGCGCTCTGAGTTCTGGAGGCAGCAGAAGCCCATCTATGCGCGCCAGCGGGACCGCAAGATCATGCAGCAGAAAGTGGAAGCGGGGATAAGAACAAATCTGCTGACCCTAGNCCAATACATTTGTAAAAGAGCCTTGGGAGGGAGNATAGACCCACCTGGCTCC
  5   1   2       bld Ga12 5g3  in                         XL184c06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGAGGCTGAGGAGACGGACGAGCAACAGGCGCCCCAAAGCACATTCAGCACTTACATGGCAGAGGGGGAGCAGCTGTATCACAAGGCGGAGTACAAGAAGGCCTCAGACAGTTTCACTGCGGCACTTCAGCTCCAACCTGAAGAGAAGAACTGCCTCGTTGCTCGTTCCAAGTGTTTCCTAAAACTCGGGGAGCCAGAATGTGCCCTGAAGGATGCAGAGGCCTCTCTACAGATCGAAAACGATTTCTTCAAGGGTCTTTACCAGAAGGCAGAGGCGCTCTACGCCATGGGAGACTTTGAGTTTGCCCTTGTGCATTACCACAGAGGGTACAAGCTGCGACCAGAATTTCAGGGATTCCGTCTGGGGATTCAGAAGGCTCAGGAAGCAATTGAGAACTCAGTCGGAACTCCTGCCAGTGTTAAACTCGAAAATAAAACAGACTTACAGTTTATAAGCCGACAAGAAGAGAGCAAGAAGGCTAAACAAAAGGCTCAGGTCAAGGTGCAGAAGAAGGATTCAAAGCAGCAGAAGAAAGTAGATCCTGAAAGGAGCCAGAAGACCGTGCGCCAGCTCCTCGGAGAACTGTACAGTGATAAGGAATATCTGGAATCATTATTAAGGGATGAAGCTCTAGTGAAAGGC
  5   1   2       bld Tbd7                                 XL052n18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTCAAGGTGCAGAAGAAGGATTCAAAGCAGCAGAAGAAAGTAGATCCTGAAAGGAGCCAGAAGACCGTGCGCCAGCTCCTCGGAGAACTGTACAGTGATAAGGAATATCTGGAATCATTATTAAGGGATGAAGCTCTAGTGAAAGGCAATACACGAGGTGGGGTCAAACTGCACNACCTGATCATTAATGGAATCCTGTACCTGGACACGCGCTCTGAGTTCTGGAGGCAGCAGAAGCCCATCTATGCGCGCCAGCGGGACCGCAAGATCATGCAGCAGAAGTGGAAGCGGGATAAGAACAAATCTGCTGACCCTAGCCAATACATTGTAAAGAGCTTGGAGGAGATAGACCAGCTGCTCTCAAGTGGAAAAGCAGAAGAAAGTTACAAAAAGGCCCAACTTGTGCTAAAGAAAGTTGAACGATGGACATCGGTAGATATCCACAACAGGGAAGAGCTAACTGGGAGTCTCCACAGCTGCATTGGGAATGCTCAGATGGACATGGGTCAGATAGAGGCAGCACTGCAGAGCC
  3   1   2       bld Te2       in                    IMAGE:7208660.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AATTTTTTGTTCCGGGAAATCCCCGGGAATAAAAAGGGGAAGGGGGATAAGACCAATTCGGCTGAACCTAGCCAATTACTTGTTAAGGAGCTGGAGGAGATAGACCAGCTGCTCTCAAGTGAAAAGCAGAAGAAAGTTACAAAAAGGCCCAACTTGTGCTAAAGAAAGTTGAACGATGGACATCGGTAGATATCCACAACAGGGAAGAGCTAACTGGGAGTCTCCACAGCTGCATTGGGAATGCTCAGATGGACATGGGTCAGATAGAGGCAGCACTGCAGAGCCACAAGAAGGACTTGGCTATAGCAGAGAAATACAAATTGCTGGAGGCGAAATCCCGAGCGTTAGATAATATCGGGAGAGTATATGCACGCATTGGGAAATTCAATGAAGCCATCAAGGTATGGGAAGAGAAGATCCCTCTGGCCAATTCAAGCTTAGAAAAGACCTGGTTGTATCATGAGATTGGGAGATGTTACCTGGAGCTGGAGCAAACTGCTGAAGCTAAGGAATATGGGGAAAAGTCGCAGCAGGAGGCTGATGCAGCTGAAGATATTGAGTGGCAGCTCAATGCCTGTGTGTTATTAGCTCAAGCAGAAGTGAAGCTGAAGCATTACCAGTCTGCCATTAGCAGTTTTGAGAATGCGTTGGAGAGAGCACGACTGCTTCACAATAAGGATGCAGAGCAAGCCATCCTCGTTGCCTTGGAGGATGCAAAGCAGGGGATGGAAGAGCAGCAGGAATCAGAACAGAACAATGATGAAAATGACAATTTAATGGCAGATGGGAACACAGCGAGGGACGAGGAGGAGGAGGAGGAGGACGTACAAAGAACAGAAGAGGATGAAGGCTGAACAGAAATGTATAATTGTAAGGGAAGCAACATTCAGACACATGACATTTGGGGCATTCTGGGAAATAAAGTTGGG
  5   1   2      seed Ga12      in                         XL141c13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGCAAGNATNTGCAGCAGAAGTGGAAGCGGGATAAGAACAAATCTGCTGACCCTAGCCAATACATTGTAAAGAGCTTGGAGGAGATAGACCAGCTGCTCTCAAGTGGAAAAGCAGAAGAAAGTTACAAAAAGGCCCAACTTGTGCTAAAGAAAGTTGAACGATGGACATCGGTAGATATCCACAACAGGGAAGAGCTTACTGGGAGTCTCCACAGCTGCATTGGGAATGCTCAGATGGACATGGGTCAGATAGAGGCAGCACTGCAGAGCCACAAGAAGGACTTGGCTATAGCAGAGAAATACAAATTGCTGGAGGCGAAATCCCGAGCGTTAGATAATATCGGGAGAGTATATGCACGCATTGGGAAATTCAATGAAGCCATCAAGGTATGGGAAGAGAAGATCCCTCTGGCCAATTCAAGCTTAGAAAAGACCTGGTTGTATCATGAGATTGGGAGATGTTACCTGGAGCTGGAGCAAACTGCTGAAGCTAAGGAATATGGGGAAAAGTCGCAGCAGGAGGCTGATGCAGCTGAAGATATTGAGTGGCAGCTCAATGCCTGTGTGTTATTAGCTCAAGCAGAAGTGAAGCTGAAGCATTACCAGTCTGCCATTAGCAGTTTTGAGAATGCGTTGGAGAGAGCACGACTGCTTCA
  5   1   2       bld Te2       in                    IMAGE:7208660.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAAGTGGAAGCGGGATAAGAACAAATCTGCTGACCCTAGCCAATACATTGTAAAGAGCTTGGAGGAGATAGACCAGCTGCTCTCAAGTGGAAAAGCAGAAGAAAGTTACAAAAAGGCCCAACTTGTGCTAAAGAAAGTTGAACGATGGACATCGGTAGATATCCACAACAGGGAAGAGCTAACTGGGAGTCTCCACAGCTGCATTGGGAATGCTCAGATGGACATGGGTCAGATAGAGGCAGCACTGCAGAGCCACAAGAAGGACTTGGCTATAGCAGAGAAATACAAATTGCTGGAGGCGAAATCCCGAGCGTTAGATAATATCGGGAGAGTATATGCACGCATTGGGAAATTCAATGAAGCCATCAAGGTATGGGAAGAGAAGATCCCTCTGGCCAATTCAAGCTTAGAAAAGACCTGGTTGTATCATGAGATTGGGAGATGTTACCTGGAGCTGGAGCAAACTGCTGAAGCTAAGGAATATGGGGAAAAGTCGCAGCAGGAGGCTGATGCAGCTGAAGATATTGAGTGGCAGCTCAATGCCTGTGTGTTATTAGCTCAAGCAGAAGTGAAGCTGAAGCATTACCAGTCTGCCATTAGCAGTTTTGAGAATGCGTTGGAGAGAGCACGACTGCTTCACAATAAGGATGCAGAGCAAGCCATCCTCTTGCCTTGGAGATGCAAGCAGGGGATGGAGAGCAGCAGGATCAGACAGAACATGATGAAATGACATTTATGGCGATGGACACACA
  5   1   2       bld Te2N                            IMAGE:7205514.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGATAGACCAGCTGCTCTCAAGTGGAAAAGCAGAAGAAAGTTACAAAAAGGCCCAACTTGTGCTAAAGAAAGTTGAACGATGGACATCGGTAGATATCCACAACAGGGAAGAGCTAACTGGGAGTCTCCACAGCTGCATTGGGAATGCTCAGATGGACATGGGTCAGATAGAGGCAGCACTGCAGAGCCACAAGAAGGACTTGGCTATAGCAGAGAAATACAAATTGCTGGAGGCGAAATCCCGAGCGTTAGATAATATCGGGAGAGTATATGCACGCATTGGGAAATTCAATGAAGCCATCAAGGTATGGGAAGAGAAGATCCCTCTGGCCAATTCAAGCTTAGAAAAGACCTGGTTGTATCATGAGATTGGGAGATGTTACCTGGAGCTGGAGCAAACTGCTGAAGCTAAGGAATATGGGGAAAAGTCGCAGCAGGAGGCTGATGCAGCTGAAGATATTGAGTGGCAGCTCAATGCCTGTGTGTTATTAGCTCAAGCAGAAGTGAAGCTGAAGCATTACCAGTCTGCCATTAGCAGTTTTGAGAATGCGTTGGAGAGAGCACGACTGCTTCACAATAAGGATGCAGAGCAAGCCATCCTCGTTGCCTTGGAGGATGCAAAGCAGGGGATGGAAGAGCAGCAGGAATCAGAACAGAACAATGATGAAAATGACAATTTAATGGCAGATGGGAACACAGcgagggacgaggaggaggagggaggaggaCGTACAAAGACAGAAGAAGATGAAGGGCTGACAGAAATGTATAAATTGTAGGGAAGCACATTCAGACACATGACATTTGGGGCATTCTGGGGAAATTTAAGTTTGGGGGGTTTCAGTAGCTTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaGGGCGGGCCCCT
  3   1   2       bld DMZ  5g3  in                         xl304l23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTAAAGAAAGTTGAACGATGGACATCGGTAGATATCCACAACAGGGAAGAGCTTACTGGGAGTCTCCACAGCTGCATTGGGAATGCTCAGATGGACATGGGTCAGATAGAGGCAGCACTGCAGAGCCACAAGAAGGACTNGGCTATAGCAGAGAAATACAAATTGCTGGAGGCGAAATCCCGAGCGTTAGATAATATCGGGAGAGTATATGCACGCATTGGGAAATTCAATGAAGCCATCAAGGTATGGGAAGAGAAGATCCCTCTGGCCAATTCAAGCTTAGAAAAGACCTGGTTGTATCATGAGATTGGGAGATGTTACCTGGAGCTGGAGCAAACTGCTGAAGCTAAGGAATATGGGGAAAAGTCGCAGCAGGAGGCTGATGCAGCTGAAGATATTGAGTGGCAGCTCAATGCCTGTGTGTTATTAGCTCAAGCAGAAGTGAAGCTGAAGCATTACCAGTCTGCCATTAGCAGTTTTGAGAATGCGTTGGAGAGAGCACGACTGCTTCACAATAAGGATGCAGAGCAAGCCATCCTCGTTGCCTTGGAGGATGCAAAGCAGGGGATGGAAGAGCAGCAGGAATCAGAACAGAACAATGATGAAAATGACAATTTAAGGGCAGATGGGAACACAGCGAGGGACGAGGAGGAGGAGGAGGAGGACGTGCATGTACAAAGAACAGAAGAGGATGAAGGCTGAACAGAAATTTATAATTGTAAGGGAAGCAACCATTCAGAC
  3   1   2       bld Ga12 5g3  in                         XL184c06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCACAGCTGCATTGGGAATGCTCAGATGGACATGGGTCAGATAGAGGCAGCACTGCAGAGCCACAAGAAGGACTTGGCTATAGCAGAGAAATACAAATTGCTGGAGGCGAAATCCCGAGCGTTAGATAATATCGGGAGAGTATATGCACGCATTGGGAAATTCAATGAAGCCATCAAGGTATGGGAAGAGAAGATCCCTCTGGCCAATTCAAGCTTAGAAAAGACCTGGTTGTATCATGAGATTGGGAGATGTTACCTGGAGCTGGAGCAAACTGCTGAAGCTAAGGAATATGGGGAAAAGTCGCAGCAGGAGGCTGATGCAGCTGAAGATATTGAGTGGCAGCTCAATGCCTGTGTGTTATTAGCTCAAGCAGAAGTGAAGCTGAAGCATTACCAGTCTGCCATTAGCAGTTTTGAGAATGCGTTGGAGAGAGCACGACTGCTTCACAATAAGGATGCAGAGCAAGCCATCCTCGTTGCCTTGGAGGATGCAAAGCAGGGGATGGAAGAGCAGCAGGAAGCAGAACAGAACAATGATGAAAATGACAATTTAAGGGCAGATGGGAACACAGCGAGGGACGAGGAGGAGGAGGAGGAGGACGTGCATGTAGAAAGAACAGAAGAGGATGAAGGCTGAACAGAAATGTATAATTGTAAGGGAAGCAACATTCAGACACATGACATT
  3   1   2       bld Neu7 5g3  in                         XL036p21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGCAGCACTGCAGAGCCACAAGAAGGACTTGGCTATAGCAGAGAAATACAAATTGCTGGAGGCGAAATCCCGAGCGTTAGATAATATCGGGAGAGTATATGCACGCATTGGGAAATTCAATGAAGCCATCAAGGTATGGGAAGAGAAGATCCCTCTGGCCAATTCAAGCTTAGAAAAGACCTGGTTGTATCATGAGATTGGGAGATGTTACCTGGAGCTGGAGCAAACTGCTGAAGCTAAGGAATATGGGGAAAAGTCGCAGCAGGAGGCTGATGCAGCTGAAGATATTGAGTGGCAGCTCAATGCCTGTGTGTTATTAGCTCAAGCAGAAGTGAAGCTGAAGCATTACCAGTCTGCCATTAGCAGATTTGAGAATGCGTTGGAGAGAGCACGACTGCTTCACAATAAGGATGCAGAGCAAGCCATCCTCGTTGCCTTGGAGGATGCAAAGCAGGGGATGGAAGAGCAGCAGGAAGCAGAACAGAACAATGATGAAAATGACAATTTAAGGGCAGATGGGAACACAGCGAGGGACGAGGAGGAGGAGGAGGAGGACGTGCATGTAGAAAGAACAGAAGAGGATGAAGGCTGAACAGAAATGTATAATTGTAAGGGAAGCAACATTCAGACACATACATTTGGGGCATTNCTGGGAAATAAAGT
  3   1   2       bld Ga12      in                         XL141c13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TATCATGAGATTGGGAGATGTTACNTGGAGCTGGAGCAAACTGCTGAAGNTAAGGAATATGGGGAAAAGTCGCAGCAGGAGGCTGATGCAGCTGAAGATATTGAGTGGCAGCTCAATGCCTGTGTGTTATTAGCTCAAGCAGAAGTGAAGCTGAAGCATTACCAGTCTGCCATTAGCAGTTTTGAGAATGCGTTGGAGAGAGCACGACTGCTTCACAATAAGGATGCAGAGCAAGCCATCCTCGTTGCCTTGGAGGATGCAAAGCAGAGGATGGAAGAGCAGCAGGAATCAGAACAGAACAATGATGAAAATGACAATTTAAGGGCAGATGGGAACACAGCGAGGGACGAGGAGGAGGAGGAGGAGGACGTGCATGTACAAAGAACAGAAGAGGATGAAGGCTGAACAGAAATTTATAATTGTAAGGGAAGCAACATTCAGACACATGACATTTGGGGCATTCTGGGGAAATAAAGTTGGGGGTTTCAGTAGCTCATGGCCTACAATATCATTGTTGTTATTATTATTATTACTACATATTTATAAAGCT

In case of problems mail me! (