Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 18 Nov 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xlk145n21ex.3                        11 END     1          25        9                hypothetical protein LOC735101 [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:8548765.5.5                   100 PI      91        253     1135                (no blast hit)
     3   0.0    0Xl3.1-xlk146o06ex.5                         8 PI      86        478      717                cyclin-dependent kinase 9 (CDC2-related kinase) [Xenopus laevis]
     4   0.0    0Xl3.1-IMAGE:3200598.5                       2 PI      95        810     1135                hypothetical protein LOC735101 [Xenopus laevis]

 This cluster: approximate FL confidence score = 95%

 1012776298 Xl3.1-IMAGE:7394489.5 - 4 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7394489.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCGGGAATTTCCCGCGGATCAAAAAGAGTAGTCACATGGTAGGATCACATGATCGTCCCGTCACCAAGGTCCTTTCAGGAGCTTCAGGAACTAGACGCTACTGTTTTTGGAATACGCAACCGTGGCGAACGCTATTGGCCCACAGAGACGGCGTGTGACTGTAAGAAATGCCGCTGCTGTAAGGCCTGTACACTATTATCGAGTTGCTAAGGACGCCTTCCGCGTAGGTCTCACACCCAGCGACCGAGCCTTTGTGGCCTTGCCCAAGCCAATCCATCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGGCGGCCTGTGCCCGGAAACCGATTCGAGAGGGCCTTCCGCCTCCGAGCCCCCTCCTTCCGCCATGGCCAAGAACTACGACTCGGTGGAATTCCCGTACTGCGATGAGGTCTCAAAGTACGAGCGGCTCGCCAAGATAGGCCAGGGCACCTTCGGGGAAGTGTTCAAGGCGAAACATCGGCAGACAGGGAAGAAAGTGGCACTTAAGAAAGTTCTGATGGAAAACGAGAAGGAAGGTTTCCCCATCACGGCTCTGCGAGAGATAAAAATCCTGCAGCTGCTGAAACATGAGAACGTAGTTAACCTTATAGAGATTTGTCGCACTAAAGTTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGAACTATTTTCCTGGTGTTCGACTTTTGTGAGCACGATCTAGCAGGATTGCTGAGCAATGCTCACGTCAAGTTTACGCTCTCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGGCAGCAAACGTACTGATCACGAGAGACGGAGTGCTAAAACTTGCAGACTTNTGGGCTTGCCAGGGCATTCAGCCTTGCCAAGAACAGCCAGCCAAACAAGTACACCAATCGGGTTGTTACACTCTGGTATCGACCCCCTGAGCTGCTTCTAGGGAGAGCGTGATTATGGTCTTCCCATCGATTTGTGGGGGAGCAGGATGCATCATGGGCAAAGATGTGGGACCANAAACCCCCATTATGCGAAGGNAATACAGAACAGCATTCACTTTACACTCCTCAGCCCAACT
                                                  Xl3.1-CHK-1012706144                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATTTCCCGCGGATCAAAAAGAGTAGTCACATGGTAGGATCACATGATCGTCCCGTCACCAAGGTCCTTTCAGGAGCTTCAGGAACTAGACGCTACTGTTTTTGGAATACGCAACCGTGGCGAACGCTATTGGCCCACAGAGACGGCGTGTGACTGTAAGAAATGCCGCTGCTGTAAGGCCTGTACACTATTATCGAGTTGCTAAGGACGCCTTCCGCGTAGGTCTCACACCCAGCGACCGAGCCTTTGTGGCCTTGCCCAAGCCAATCCATCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGGCGGCCTGTGCCCGGAAACCGATTCGAGAGGGCCTTCCGCCTCCGAGCCCCCTCCTTCCGCCATGGCCAAGAACTACGACTCGGTGGAATTCCCGTACTGCGATGAGGTCTCAAAGTACGAGCGGCTCGCCAAGATAGGCCAGGGCACCTTCGGGGAAGTGTTCAAGGCGAAACATCGGCAGACAGGGAAGAAAGTGGCACTTAAGAAAGTTCTGATGGAAAACGAGAAGGAAGGTTTCCCCATCACGGCTCTGCGAGAGATAAAAATCCTGCAGCTGCTGAAACATGAGAACGTAGTTAACCTTATAGAGATTTGTCGCACTAAAGTTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGAACTATTTTCCTGGTGTTCGACTTTTGTGAGCACGATCTAGCAGGATTGCTGAGCAATGCTCACGTCAAGTTTACGCTCTCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGGCAGCAAACGTACTGATCACGAGAGACGGAGTGCTAAAACTTGCAGACTTNTGGGCTTGCCAGGGCATTCAGCCTTGCCAAGAACAGCCAGCCAAACAAGTACACCAATCGGGTTGTTACACTCTGGTATCGACCCCCTGAGCTGCTTCTAGGGAGAGCGTGATTATGGTCTTCCCATCGATTTGTGGGGGAGCAGGATGCATCATGGGCAAAGATGTGGGACCANAAACCCCCATTATGCGAAGGNAATACAGAACAGCATTCACTTTACACTCCTCAGCCCAACTGTGCGG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH MIN     292      78                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     388     537                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     388      35                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ci ---- 3e-019     NP_001071697.1 mitogen-activated protein kinase [Ciona intestinalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 2e-045     NP_730643.1 CG7597-PB, isoform B [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 5e-045     XP_001919337.1 PREDICTED: similar to LOC559027 protein [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 7e-046     XP_863951.1 PREDICTED: similar to CDC2-related kinase 7 isoform 6 [Canis familiaris] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Bt ---- 4e-046     XP_588861.2 PREDICTED: similar to CrkRS [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 3e-046     NP_055898.1 Cdc2-related kinase, arginine/serine-rich isoform 2 [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Os ---- 2e-046     NP_001045450.1 Os01g0958000 [Oryza sativa (japonica cultivar-group)] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 2e-046     NP_081228.2 Cdc2-related kinase, arginine/serine-rich isoform 3 [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - At ---- 1e-046     NP_201301.1 cyclin-dependent kinase, putative / CDK, putative [Arabidopsis thaliana] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ce ---- 2e-062     NP_492906.2 Cyclin-Dependent Kinase family member (cdk-9) [Caenorhabditis elegans] ------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Sp ---- 2e-084     XP_001189401.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN -== Ag ==== 1e-084     XP_314652.2 ENSANGP00000020806 [Anopheles gambiae str. PEST] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Gg ==== 6e-105     NP_001006201.1 similar to Cdk9-prov protein [Gallus gallus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:7394489.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAG------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG---------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------ATG------------------------------------ATG------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ...
  5   1   2       bld Te2  5g                         IMAGE:7394489.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCGGGAATTTCCCGCGGATCAAAAAGAGTAGTCACATGGTAGGATCACATGATCGTCCCGTCACCAAGGTCCTTTCAGGAGCTTCAGGAACTAGACGCTACTGTTTTTGGAATACGCAACCGTGGCGAACGCTATTGGCCCACAGAGACGGCGTGTGACTGTAAGAAATGCCGCTGCTGTAAGGCCTGTACACTATTATCGAGTTGCTAAGGACGCCTTCCGCGTAGGTCTCACACCCAGCGACCGAGCCTTTGTGGCCTTGCCCAAGCCAATCCATCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGGCGGCCTGTGCCCGGAAACCGATTCGAGAGGGCCTTCCGCCTCCGAGCCCCCTCCTTCCGCCATGGCCAAGAACTACGACTCGGTGGAATTCCCGTACTGCGATGAGGTCTCAAAGTACGAGCGGCTCGCCAAGATAGGCCAGGGCACCTTCGGGGAAGTGTTCAAGGCGAAACATCGGCAGACAGGGAAGAAAGTGGCACTTAAGAAAGTTCTGATGGAAAACGAGAAGGAAGGTTTCCCCATCACGGCTCTGCGAGAGATAAAAATCCTGCAGCTGCTGAAACATGAGAACGTAGTTAACCTTATAGAGATTTGTCGCACTAAAGTTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGAACTATTTTCCTGGTGTTCGACTTTTGTGAGCACGATCTAGCAGGATTGCTGAGCAATGCTCACGTCAAGTTTACGCTCTCCG
  5   1   2       bld Kid  5g                         IMAGE:7007677.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCAACCGTGGCGAACGCTATTGGCCCACAGAGACGGCGTGTGACTGTAAGAAATGCCGCTGCTGTAAGGCCTGTACACTATTATCGAGTTGCTAAGGACGCCTTCCGCGTAGGTCTCACACCCAGCGACCGAGCCTTTGTGGCCTTGCCCAAGCCAATCCATCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGGCGGCCTGTGCCCGGAAACCGATTCGAGAGGGCCTTCCGCCTCCGAGCCCCCTCCTTCCGCCATGGCCAAGAACTACGACTCGGTGGAATTCCCGTACTGCGATGAGGTCTCAAAGTACGAGCGGCTCGCCAAGATAGGCCAGGGCACCTTCGGGGAAGTGTTCAAGGCGAAACATCGGCAGACAGGGAAGAAAGTGGCACTTAAGAAAGTTCTGATGGAAAACGAGAAGGAAGGTTTCCCCATCACGGCTCTGCGAGAGATAAAAATCCTGCAGCTGCTGAAACATGAGAACGTAGTTAACCTTATAGAGATTTGTCGCACTAAAGCCAACCAATACAATAGATGCAAAGGAACTATTTTCCTGGTGTTCGACTTTTGTGAGCACGATCTAGCAGGATTGCTGAGCAATGCTCACGTCAAGTTTACGCTCTCCGAGATNCAGAANGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGGCAGCAAACGTACTGA
  5   1   2      seed Te2       out                   IMAGE:7391215.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AACGCTATTGGCCCACAGAGACGGCGTGTGACTGTAAGAAATGCCGCTGCTGTAAGGCCTGTACACTATTATCGAGTTGCTAAGGACGCCTTCCGCGTAGGTCTCACACCCAGCGACCGAGCCTTTGTGGCCTTGCCCAAGCCAATCCATCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGGCGGCCTGTGCCCGGAAACCGATTCGAGAGGGCCTTCCGCCTCCGAGCCCCCTCCTTCCGCCATGGCCAAGAACTACGACTCGGTGGAATTCCCGTACTGCGATGAGGTCTCAAAGTACGAGCGGCTCGCCAAGATAGGCCAGGGCACCTTCGGGGAAGTGTTCAAGGCGAAACATCGGCAGACAGGGAAGAAAGTGGCACTTAAGAAAGTTCTGATGGAAAACGAGAAGGAAGGTTTCCCCATCACGGCTCTGCGAGAGATAAAAATCCTGCAGCTGCTGAAACATGAGAACGTAGTTAACCTTATAGAGATTTGTCGCACTAAAGTTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGAACTATTTTCCTGGTGTTCGACTTTTGTGAGCACGATCTAGCAGGATTGCTGAGCAATGCTCACGTCAAGTTTACGCTCTCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGG
  5   1   2       bld Emb1 5x3                        IMAGE:5156812.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGTTGCTAAGGACGCCTTCCGCGTAGGTCTCACACCCAGCGACCGAGCCTTTGTGGCCTTGCCCAAGCCAATCCATCAGGCAGCCTGAACTCGTCAGCTCAGCACCGGGAAAGGCCGGGGCCCGGTGGCCTGTGCCCGGAAACCGATTCGAGAGGGCCTTCCGCCTCCGAGCCCCCTCCTTCCGCCATGGCCAAGAACTACGACTCGGTGGAATTCCCGTACTGCGATGAGGTCTCAAAGTACGAGCGGCTCGCCAAGATAGGCCAGGGCACCTTCGGGGAAGTGTTCAAGGCGAAACATCGGCAGACAGGGAAGAAAGTGGCACTTAAGAAAGTTCTGATGGAAAACGAGAAGGAAGGTTTCCCCATCACGGCTCTGCGAGAGATAAAAATCCTGCAGCTGCTGAAACATGAGAACGTAGTTAACCTTATAGAGATTTGTCGCACTAAAGTTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGAACTATTTTCCTGGTGTTCGACTTTTGTGAGCACGATCTAGCAGGATTGCTGAGCAATGCTCACGTCAAGTTTACGCTCTCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGGCAGCAAACGTACTGATCACGAGAGACGGAGTGCTAAAACTTGCAGACTTNTGGGCTTGCCAGGGCATTCAGCCTTGCCAAGAACAGCCAGCCAAACAAGTACACCAATCGGGTTGTTACACTCTGGTATCGACCCCCTGAGCTGCTTCTAGGGAGAGCGTGATTATGGTCTTCCCATCGATTTGTGGGGGAGCAGGATGCATCATGGGCAAAGATGTGGGACCANAAACCCCCATTATGCGAAGGNAATACAGAACAGCATTCACTTTACACTCCTCAGCCCAACTGTGCGGGGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)