Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 07 Mar 2021 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     11.3300000000000001    0Xl3.1-IMAGE:4173451-IMAGp.5                 6 END     3          16       50                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:4173451-IMAGp.5                 6 PI      92        156      935                (no blast hit)

 This cluster: approximate FL confidence score = 98%

 1012776394 Xl3.1-XL207j10.5 - 18 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                    2     3     3     3     4     4     4     4     4     5     4     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     6     7     5     6     6     6     5     6     4     6     4     6     3     6     3     6     2     5     2     5     2     5     2     5     3     5     3     4     2     4     2     4     2     4     2     4     3     5     4     5     4     5     3     5     4     5     3     5     4     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     4     4     4     4     4     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     5     5     5     3     5     3     5     3     5     3     5     3     6     3     6     3     6     3     6     3     6     3     6     3     7     3     7     3     7     3     7     3     7     3     7     3     8     4     9     4     8     6     6     6     6     5     5     5     5     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     5     6     5     6     6     6     6     6     5     5     4     5     5     5     4     4     3     3
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTTCGTATACA
                                               BLH ATG     199     614               
                                               BLH MIN     199     147               
                                               BLH MPR     115     147               
                                               BLH OVR     199     836               
                                               CDS MIN     199     147               
                                               EST CLI     -14       1               
                                               ORF LNG     199      70               
                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Ce ==== 5e-029     NP_501645.1 phosphatidylinositol glycan class C like (4K106) [Caenorhabditis elegans] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Sp ==== 2e-040     XP_792701.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Dm ---- 6e-041     NP_647804.1 CG12077-PA [Drosophila melanogaster] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Ag ==== 8e-045     XP_315953.3 AGAP005923-PA [Anopheles gambiae str. PEST] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                        PROTEIN --- ?? ---- 3e-049     XP_637791.1 GlcNAc transferase [Dictyostelium discoideum AX4] ------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Dr ==== 4e-082     NP_998426.1 phosphatidylinositol glycan, class C [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Gg ---- 2e-127     XP_422231.1 PREDICTED: similar to phosphatidylinositol glycan, classC [Gallus gallus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Cf ---- 3e-129     XP_537194.1 PREDICTED: similar to Phosphatidylinositol N-acetylglucosaminyltransferase subunit C (Phosphatidylinositol-glycan biosynthesis, class C protein) (PIG-C) [Canis familiaris] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Mm ---- 2e-129     NP_001034134.1 phosphatidylinositol glycan, classC [Mus musculus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Hs ---- 2e-129     NP_714969.1 phosphatidylinositol glycan, class C; phosphatidylinositol-glycan biosynthesis,class C protein [Homo sapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Bt ---- 6e-131     NP_001029555.1 hypothetical protein LOC510483 [Bos taurus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                            PREDICTED = Xt ==== 3e-172     AAI35978.1 Hypothetical protein LOC549879 [Xenopus tropicalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                            PREDICTED = Xl ==== 0          NP_001088459.1 hypothetical protein LOC495323 [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-XL207j10.5                                                 TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG------------------------------------------------------------------------ATG------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------TAA---------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------------TAA------------ATG------------------------------------------------------------------TGA------------------------------TAA---------------------------------------------------------------TGA------TAA------------------TAA---------------------TAA---------------------------------------------------------------------------------------------TGA------------TAA---------------------------TGA---TGA---------------------------------------------------------------------TAG---------------------TAA------------ATG------------------------TGA------------------------------------------------------ATG------------------TAATAATAA
                                                                   ORF                                                                                                                                                                                                                      [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
  5   1   2       bld Egg1      in                    IMAGE:3300411.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCACGAGGGCTTGGCTTTCACACTCCTTGGCTACATATTATTTGATGCTGTAGACCAAGGAGAAGGAAGAAGAGACAGTGGAAGAACTCACTGGGCTGATCTGAAGAGCGCACTAGTATTTGTAGCGTTTACTTATGGTTTTTCCCCAGTGCTTAAGACACTGACTGAATCTATTAGCACTGACACAATTTATGCCATGTCAGTCCTTATGCTTCTTGGACACCTGGTCTTCTTCGACTTTGGAGCCAATGCCGCTGTAGTTTCTAGTACTCTTTCCATAAACATGGCCATTTTTGCTTCAGTTTGCCTTGCTTCACGACTTCCGCGGTCCCTTCATGCTTTTGCTATGGTCACCTTTGCCATCCAGATTTTTGCTCTGTGGCCGAGCTTGCATAGAAAGCTGAGGGCTAACACTCCTCGAACATACATAAGCGTAACCTTTCTCTTTGCCATTTATGCCTTGGGCGGATTATTGAACATTTCGGGTGTGGGGGCTTTGCTGGTTTTTCTCCCTCTCCTTTCC
  3   1   1       add Sp1       out                   IMAGE:4173451.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTAGTTTCTAGAACTCTTCCCATAAACATGGCCATTTTGGTTTCTGTTGTTCTTGCCTCACGACTCCACGGGTCCCTCCATGCTTTTGCTATGGTCACTTTTGCCATCCAGATTTTTGCTCTGTGGCCCAGCTTGCAAAGAAAGCTGAGGGCTAACACTCCTCGAACATACATAGGCGTAACCTTTCTCTTTGCCATTCTTACCATGGCTGGACTATTGAGCATTTCGGGCGTGGGGGCTTTGCTGTTTTTTCTTCTCCTCCTCTCCGTGACATTTTTATGTCCATACTGCCTAATTCGGCTGCAGCTTTTTAAAGATAACATTTATGGACCATGGGATGAAGCAGAAATTAAAGACGACCTTTCTCGCTTCCTTAATTAGAAATGTGCAAATCAATATGACGCACTTCTGACAGCTTTGTAACTAAGAATAAAGGCAGAATTTCTGTTTTTAACCATTATTAGGGAATATTTTACTAGATTTTTTGATTTTATGTTTGTGGGGTTGATCAGTCATTTCTTAGTAATCATTTTCTTTTTAATCTCTTATTTATTTACATCCATATTCCACATGTGGGTTTATAGACTTTACTAGGTCAATACCAGCTCAATACTGACCAATTATCCACCTATGTAGTTTGTATTGGGCAAATGACTGCACAATTCTGCTTTTAATA
  3   1   2      skin Ga12 5g3  in                         XL207j10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATACAGGGACAATTTTCTTTTTTAACCATTGGGGGTTATTTTACTACAGTTTTTGATTTTATTTCTATGGAGTTGGTCAGTTATTCTTAGTAAGAGTTTAGATAAGAAACGGCAAGCACTCCGAACTCCACTCTTATGGTAAAAAAAACGTTTCGTATACAAGGATACATAGTCATGACTACGTATGCTTGTATACGAAACGTTGGGTTCGGGCGATGCACCCGGGCCACTCGACAATTTGGGTGAGTGCTTTTCTGCCAAAAGGTGTTCCATACCTAAGCGGAGGACCTGGGTTTTATACACCCAGGTCATAGTATTTACAGGGTGAGCGGTTTTGTGTTTTGAGACCCATAAATTGCAATTAAATATAATTAATTCAAGCAGCACCCGTTTAAGTAAAACAAGGAAACAGGACAGAACAGCTTATATTTATGGCTCATATTGCAAGAGTTTAGATATCCTCCCCTGAGACTACATAGCCATTTATTGGCCTGATCAATTACTTTTTAATCTATTTATTTACGTCCATATTCCACATGAGTGTGACATAACATTTGTGGGTTTATAATATATTCTGAAGACCTGATTTCTGGTGTAGGGAGTTTGCCTTGCTGCTAGTCTGTTTTTATAATTTTAAATTAATTTAACCCCAGTATGGCAAACAGGTCCATTTTCACCCGCTGAAAGACCCAGCTCAACTCTGACCTATTTTCCTCTTTTGTACCTTGGCTGTGGCAAATGATTGTACAATTCTTCTTTTAATAANA
  3   1   1       add Tbd7      out                        XL091e14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAAAGGCAGAATTTCTGTTTTTAACCATTATTAGGGAATATTTTACTAGATTTTTTGATTTTATGTTTGTGGGGTTGATCAGTCATTTCTTAGTAANCATTTTCNTTTTAATCTCTTATTTATTTACATCCATATTCCACATGTGGGTTTATAGACTTTACTAGGNCAAAACCAGCTCAANACTGACCAATTANCCNCCTANGTAGTTTGTATTGGGCAAANGACTGCNCAATTCGNCTTTTAATAAAAAAAAAAATG
  5  -1   2       bld Bla2                            IMAGE:7297279.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTTTACCATGGGTATTATCATTTGATTATTTATGAGTGTCATATCTGTAGAGTAGATAGAACGCAGCATCCGACTCACTCTAGGTAAAAAACGTTCGTATACAAGGTACATATCATGACTACGTAGCTTGTTACGAACGTGGGTTCGGGCGATGCACCCGGCCACTCGACAATTGGGTGAGTGTTTTCTGCCAAAAGGTGTTCCATACCTAAGCGGAGGACCTGGGTTTTATACACCCAGGTCATAGTATTTACAGGGTGAGCGGTTTTGTGTTTTGAGACCCATAAATTGCAATTAAATATAATTAATTCAAGCAGCACCCGTTTAAGTAAAACAAGGAAACAGGACAGAACAGCTTATATTTATGGCTCATATTGCAAGAGTTTAGATATCCTCCCCTGAGACTACATAGCCATTTATTGGCCTGATCAATTACTTTTTAATCTATTTATTTACGTCCATATTCCACATGAGTGTGACATAACATTTGTGGGTTTATAATATATTCTGAAGACCTGATTTCTGGTGTAGGGAGTTTGCCTTGCTGCTAGTCTGTTTTTATAATTTTAAATTAATTTAACCCCAGTATGGCAAACAGGTCCATTTTCACCCACTGAAAGACCCAGCTCAACTCTGACCTATTTTCCTCTTTTGTACCTTGGCTGTGGCAAATGATTGTACAATTCTTCTTTTAATAATAAATAGTTTTTTGTTTCTGAATTTaaaaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGTACCCAACGC
  3   1   2       bld Ga12 5g3  in                         XL159i22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AACGTTTCGTATACAAGGATACATAGTCATGACTACGTATGCTTGTATACGAAACGTTGGGTTCGGGCGATGCACCCGGGCCACTCGACAATTTGGGTGAGTGCTTTTCTGCCAAAAGGTGTTCCATACCTAAGCGGAGGACCTGGGTTTTATACACCCAGGTCATAGTATTTACAGGGTGAGCGGTTTTGTGTTTTGAGACCCATAAATTGCAATTAAATATAATTAATTCAAGCAGCACCCGTTTAAGTAAAACAAGGAAACAGGACAGAACAGCTTATATTTATGGCTCATATTGCAAGAGTTTAGATATCCTCCCCTGAGACTACATAGCCATTTATTGGCCTGATCAATTACTTTTTAATCTATTTATTTACGTCCATATTCCACATGAGTGTGACATAACATTTGTGGGTTTATAATATATTCTGAAGACCTGATTTCTGGTGTAGGGAGTTTGCCTTGCTGCTAGTCTGTTTTTATAATTTTAAATTAATTTAACCCCAGTATGGCAAACAGGTCCATTTTCACCCGCTGAAAGACCCAGCTCAACTCTGACCTATTTTCCTCTTTTGTACCT
  3   1   2       bld Ga12 5g3  in                         XL158l13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCGATGCACCCGGGCCACTCGACAATTTGGGTGAGTGCTTTTCTGCCAAAAGGTGTTCCATACCTAAGCGGAGGACCTGGGTTTTATACACCCAGGTCATAGTATTTACAGGGTGAGCGGTTTTGTGTTTTGAGACCCATAAATTGCAATTAAATATAATTAATTCAAGCAGCACCCGTTTAAGTAAAACAAGGAAACAGGACAGAACAGCTTATATTTATGGCTCATATTGCAAGAGTTTAGATATCCTCCCCTGAGACTACATAGCCATTTATTGGCCTGATCAATTACTTTTTAATCTATTTATTTACGTCCATATTCCACATGAGTGTGACATAACATTTGTGGGTTTATAATATATTCTGAAGACCTGATTTCTGGTGTAGGGAGTTTGCCTTGCTGCTAGTCTGTTTTTATAATT
  3   1   2      shim Egg1                            IMAGE:4783435.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCGACAATTTGGGTGAGTGCTTTTCCGCCAAAAGGTGTTCCATACCTAAGCGGAGGACCTGGGTTTTATACACCCAGGTCATAGTATTTACAGGGTGAGCGGTTTTGTGTTTTGAGACCCATAAATTGCAATTAAATATAATTAATTCAAGCAGCACCCGTTTAAGTAAAACAAGGAAACAGGACAGAACAGCTTATATTTATGGCTCATATTGCAAGAGTTTAGATATCCTCCCCTGAGACTACATAGCCATTTATTGGCCTGATCAATTACTTTTTAATCTATTTATTTACGTCCATATTCCACATGAGTGTGACATAACATTTGTGGGTTTATAATATATTCTGAAGACCTGATTTCTGGTGTAGGGAGTTTGCCTTGCTGCTAGTCTGTTTTTATAATTTTAAATTAATTTAACCCCAGTATGGCAAACAGGTCCATTTTCACCCGCTGAAAGACCCAGCTCAACTCTGACCTATTTTCCTCTTTTGTACCTTGGCTGTGGCAAATGATTGTACAATTCTTCTTTTAATAATAAATAGTTTTTTGTTTCTGAAAAA
  3   1   2       bld Egg1      in                    IMAGE:3300411.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGGTCATAGTATTTACAGGGTGAGCGGTTTTGTGTTTTGAGACCCATAAATTGCAATTAAATATAATTAATTCAAGCAGCACCCGTTTAAGTAAAACAAGGAAACAGGACAGAACAGCTTATATTTATGGCTCATATTGCAAGAGTTTAGATATCCTCCCCTGAGACTACATAGCCATTTATTGGCCTGATCAATTACTTTTTAATCTATTTATTTACGTCCATATTCCACATGAGTGTGACATAACATTTGTGGGTTTATAATATATTCTGAAGACCTGATTTCTGGTGTAGGGAGTTTGCCTTGCTGCTAGTCTGTTTTTATAATTTTAAATTAATTTAACCCCAGTATGGCAAACAGGTCCATTTTCACCCGCTGAAAGACCCAGCTCAACTTTGACCTATTTTCCTCTTTTGTACCTTGGCTGTGGCAAATGATTGTCCAATTCTTCTTTTAATAATAAATAGTTTTTTGTTTTTGAATTTAAAAAAAAA
  5  -1   2       bld Ga12                                 XL191c17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGTGAGCGGTTTTGTGTTTTGAGACCCATAAATTGCAATTAAATATAATTAATTCAAGCAGCNCCCGTTTAAGTAAAACAAGGAAACAGGACAGAACAGCTTATATTTATGGNTCATATTGCAAGAGTTTAGATATCCTCCCCTGAGACTACATAGCCATTTATTGGCCTGATCAANTACTTTTTAATNTATTTATTTACGTCCATATTCCACATGAGTGTGACATAACATTTGTGGGTTTATAATATATTTTGAAGACCTGATTTTTGGTGTAGGGAGTTTGCCTTGCTGNTAGTNTGTTTTTATAATTTTAAATTAATTTAACCCCAGTATGGCAAACAGGTCCATTTTCACCCGNTGAAAGACCCAGNTCAACTTTGACCTATTTTCCTNTTTTGTACCTTGGCTGTGGCAAANGATTGTACAAttttttttttaataataaatantttttttGT

In case of problems mail me! (