Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Nov 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     11.3300000000000001    0Xl3.1-IMAGE:4173451-IMAGp.5                 6 END     3          16       50                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:4173451-IMAGp.5                 6 PI      92        156      935                (no blast hit)

 This cluster: approximate FL confidence score = 98%

 1012776394 Xl3.1-XL207j10.5 - 18 ESTs
                                                                       ....-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL207j10.5               TTGGCTGCCAAGCTTTGACTGCTCAGGCAAAGGTTAAGAGGGCTGGAGAAACCCGGAAGCCTGGCGTTGGGAAATCAGGTGTGTAATATCTGAAGCCAGGAATCATTTGCAAAAGCAGAAATACAAGTCTTTTCTTACAGACAGGCTGCTACAGTTAAATGTCTGGTTTTACACTGAGAGCATCTGGCAAAGAAGAGGTATGAGCCCAGTGCTGCAAAGTCCCAACCCTGGTGTTGACCATTACTCCAGTCTGTCATGGGGAGCAGGAAATCCTCCTCCAGCTCCAGTGGGTTCCCCGCCTATCTGGAAAAAGGTGTTATATGAGCATCAGCCGTTTCCTGATAATTATGTGGATAACCGCTTCCTGGAGGAACTGAGGAAGAACATTTATGTACGTCGGTATCACTATTGGGCAGTGGTGTTTGAAGCTGGAGTAGTAATCCAACAGCTCTGCAGTGTTTGTGTGTTCTCTTTTATTTGGTGGTACATGGACCAGGATTTGCTGTCTCCTCAGAAGCTGTGTGGGGTTGGCTTGGCTTTCACACTCCTTGGCTACATATTATTTGATGCTGTAGACCAAGGAGAAGGAAGAAGAGACAGTGGAAGAACTCACTGGGCTGATCTGAAGAGCGCACTAGTATTTGTAGCGTTTACTTATGGTTTTTCCCCAGTGCTTAAGACACTGACTGAATCTATTAGCACTGACACAATTTATGCCATGTCAGTCCTTATGCTTCTTGGACACCTGGTCTTCTTCGACTTTGGAGCCAATGCCGCTGTAGTTTCTAGTACTCTTTCCATAAACATGGCCATTTTTGCTTCAGTTTGCCTTGCTTCACGACTTCCGCGGTCCCTTCATGCTTTTGCTATGGTCACCTTTGCCATCCAGATTTTTGCTCTGTGGCCGAGCTTGCATAGAAAGCTGAGGGCTAACACTCCTCGAACATACATAGGCGTAACCTTTCTCTTTGCCATTCTTACCATGGCTGGACTATTGAGCATTTCGGGCGTGGGGGCTTTGCTGTTTTTTCTTCTCCTCCTCTCCGTGACATTTTTATGTCCATACTGCCTAATTCGGCTGCAGCTTTTTAAAGATAACATTTATGGACCATGGGATGAAGCAGAAATTAAAGACGACCTTTCTCGCTTCCTTAATTAGAAATGTGCAAATCAATATGACGCACTTCTGACAGCTTTGTAACTAAGAATAAAGGCAGAATTTCTGTTTTTAACCATTATTAGGGAATATTTTACTAGATTTTTTGATTTTATGTTTGTGGGGTTGATCAGTCATTTCTTAGTAATCATTTTCTTTTTAATCTCTTATTTATTTACATCCATATTCCACATGTGGGTTTATAGACTTTAAGGATACATAGTCATGACTACGTATGCTTGTATACGAAACGTTGGGTTTGTATTGGGCAACCGGGCCACTCGACAATTTGGGTGAGTGCTTTTCTGCCAAAAGGTGTTCCATACCTAAGCGGAGGACCTGGGTTTTATACACCCAGGTCATAGTATTTACAGGGTGAGCGGTTTTGTGTTTTGAGACCCATAAATTGCAATTAAATATAATTAATTCAAGCAGCACCCGTTTAAGTAAAACAAGGAAACAGGACAGAACAGCTTATATTTATGGCTCATATTGCAAGAGTTTAGATATCCTCCCCTGAGACTACATAGCCATTTATTGGCCTGATCAATTACTTTTTAATCTATTTATTTACGTCCATATTCCACATGAGTGTGACATAACATTTGTGGGTTTATAATATATTCTGAAGACCTGATTTCTGGTGTAGGGAGTTTGCCTTGCTGCTAGTCTGTTTTTATAATTTTAAATTAATTTAACCCCAGTATGGCAAACAGGTCCATTTTCACCCGCTGAAAGACCCAGCTCAACTCTGACCTATTTTCCTCTTTTGTACCTTGGCTGTGGCAAATGATTGTACAATTCTTCTTTTAATAATAAATAGTTTTTTGTTTCTG
                                                  Xl3.1-CHK-1012690618                     GCCAAGCTTTGACTGCTCAGGCAAAGGTTAAGAGGGCTGGAGAAACCCGGAAGCCTGGCGTTGGGAAATCAGGTGTGTAATATCTGAAGCCAGGAATCATTTGCAAAAGCAGAAATACAAGTCTTTTCTTACAGACAGGCTGCTACAGTTAAATGTCTGGTTTTACACTGAGAGCATCTGGCAAAGAAGAGGTATGAGCCCAGTGCTGCAAAGTCCCAACCCTGGTGTTGACCATTACTCCAGTCTGTCATGGGGAGCAGGAAATCCTCCTCCAGCTCCAGTGGGTTCCCCGCCTATCTGGAAAAAGGTGTTATATGAGCATCAGCCGTTTCCTGATAATTATGTGGATAACCGCTTCCTGGAGGAACTGAGGAAGAACATTTATGTACGTCGGTATCACTATTGGGCAGTGGTGTTTGAAGCTGGAGTAGTAATCCAACAGCTCTGCAGTGTTTGTGTGTTCTCTTTTATTTGGTGGTACATGGACCAGGATTTGCTGTCTCCTCAGAAGCTGTGTGGGGTTGGCTTGGCTTTCACACTCCTTGGCTACATATTATTTGATGCTGTAGACCAAGGAGAAGGAAGAAGAGACAGTGGAAGAACTCACTGGGCTGATCTGAAGAGCGCACTAGTATTTGTAGCGTTTACTTATGGTTTTTCCCCAGTGCTTAAGACACTGACTGAATCTATTAGCACTGACACAATTTATGCCATGTCAGTCCTTATGCTTCTTGGACACCTGGTCTTCTTCGACTTTGGAGCCAATGCCGCTGTAGTTTCTAGTACTCTTTCCATAAACATGGCCATTTTTGCTTCAGTTTGCCTTGCTTCACGACTTCCGCGGTCCCTTCATGCTTTTGCTATGGTCACCTTTGCCATCCAGATTTTTGCTCTGTGGCCGAGCTTGCATAGAAAGCTGAGGGCTAACACTCCTCGAACATACATAGGCGTAACCTTTCTCTTTGCCATTCTTACCATGGCTGGACTATTGAGCATTTCGGGCGTGGGGGCTTTGCTGTTTTTTCTTCTCCTCCTCTCCGTGACATTTTTATGTCCATACTGCCTAATTCGGCTGCAGCTTTTTAAAGATAACATTTATGGACCATGGGATGAAGCAGAAATTAAAGACGACCTTTCTCGCTTCCTTAATTAGAAATGTGCAAATCAATATGACGCACTTCTGACAGCTTTGTAACTAAGAATAAAGGCAGAATTTCTGTTTTTAACCATTATTAGGGAATATTTTACTAGATTTTTTGATTTTATGTTTGTGGGGTTGATCAGTCATTTCTTAGTAATCATTTTCTTTTTAATCTCTTATTTATTTACATCCATATTCCACATGTGGGTTTATAGxxTxxAAGGATACATAGTCATGACTACGTATGCTTGTATACGAAACGTxxxGTTTGTATTxxGCAxCCGGGCCACTCGACAATTTGGGTGAGTGCTTTTCTGCCAAAAGGTGTTCCATACCTAAGCGGAGGACCTGGGTTTTATACACCCAGGTCATAGTATTTACAGGGTGAGCGGTTTTGTGTTTTGAGACCCATAAATTGCAATTAAATATAATTAATTCAAGCAGCACCCGTTTAAGTAAAACAAGGAAACAGGACAGAACAGCTTATATTTATGGCTCATATTGCAAGAGTTTAGATATCCTCCCCTGAGACTACATAGCCATTTATTGGCCTGATCAATTACTTTTTAATCTATTTATTTACGTCCATATTCCACATGAGTGTGACATAACATTTGTGGGTTTATAATATATTCTGAAGACCTGATTTCTGGTGTAGGGAGTTTGCCTTGCTGCTAGTCTGTTTTTATAATTTTAAATTAATTTAACCCCAGTATGGCAAACAGGTCCATTTTCACCCGCTGAAAGACCCAGCTCAACTCTGACCTATTTTCCTCTTTTGTACCTTGGCTGTGGCAAATGATTGTACAATTCTTCTTTTAATAATAAATAGTTTTTTG
                                                      consensus depths                    2     3     3     3     4     4     4     4     4     5     4     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     6     7     5     6     6     6     5     6     4     6     4     6     3     6     3     6     2     5     2     5     2     5     2     5     3     5     3     4     2     4     2     4     2     4     2     4     3     5     4     5     4     5     3     5     4     5     3     5     4     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     4     4     4     4     4     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     5     5     5     3     5     3     5     3     5     3     5     3     6     3     6     3     6     3     6     3     6     3     6     3     7     3     7     3     7     3     7     3     7     3     7     3     8     4     9     4     8     6     6     6     6     5     5     5     5     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     5     6     5     6     6     6     6     6     5     5     4     5     5     5     4     4     3     3
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTTCGTATACA
                                               BLH ATG     199     614               
                                               BLH MIN     199     147               
                                               BLH MPR     115     147               
                                               BLH OVR     199     836               
                                               CDS MIN     199     147               
                                               EST CLI     -14       1               
                                               ORF LNG     199      70               
                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Ce ==== 5e-029     NP_501645.1 phosphatidylinositol glycan class C like (4K106) [Caenorhabditis elegans] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Sp ==== 2e-040     XP_792701.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Dm ---- 6e-041     NP_647804.1 CG12077-PA [Drosophila melanogaster] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Ag ==== 8e-045     XP_315953.3 AGAP005923-PA [Anopheles gambiae str. PEST] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                        PROTEIN --- ?? ---- 3e-049     XP_637791.1 GlcNAc transferase [Dictyostelium discoideum AX4] ------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Dr ==== 4e-082     NP_998426.1 phosphatidylinositol glycan, class C [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Gg ---- 2e-127     XP_422231.1 PREDICTED: similar to phosphatidylinositol glycan, classC [Gallus gallus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Cf ---- 3e-129     XP_537194.1 PREDICTED: similar to Phosphatidylinositol N-acetylglucosaminyltransferase subunit C (Phosphatidylinositol-glycan biosynthesis, class C protein) (PIG-C) [Canis familiaris] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Mm ---- 2e-129     NP_001034134.1 phosphatidylinositol glycan, classC [Mus musculus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Hs ---- 2e-129     NP_714969.1 phosphatidylinositol glycan, class C; phosphatidylinositol-glycan biosynthesis,class C protein [Homo sapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Bt ---- 6e-131     NP_001029555.1 hypothetical protein LOC510483 [Bos taurus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                            PREDICTED = Xt ==== 3e-172     AAI35978.1 Hypothetical protein LOC549879 [Xenopus tropicalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                            PREDICTED = Xl ==== 0          NP_001088459.1 hypothetical protein LOC495323 [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-XL207j10.5                                                 TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG------------------------------------------------------------------------ATG------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------TAA---------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------------TAA------------ATG------------------------------------------------------------------TGA------------------------------TAA---------------------------------------------------------------TGA------TAA------------------TAA---------------------TAA---------------------------------------------------------------------------------------------TGA------------TAA---------------------------TGA---TGA---------------------------------------------------------------------TAG---------------------TAA------------ATG------------------------TGA------------------------------------------------------ATG------------------TAATAATAA
                                                                   ORF                                                                                                                                                                                                                      [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
  5   1   2      seed Ga12 5g3  in                         XL158l13.5p GGGCTGAGGAATTCGGCACGAGGCAGCTTTGACTGCTCAGGCAAAGGTTAAGAGGGCTGGAGAAACCCGGAAGCCTGGCGTTGGGAAATCAGGTGTGTAATATCTGAAGCCAGGAATCATTTGCAAAAGCAGAAATACAAGTCTTTTCTTACAGACAGGCTGCTACAGTTAAATGTCTGGTTTTACACTGAGAGCATCTGGCAAAGAAGAGGTATGAGCCCAGTGCTGCAAAGTCCCAACCCTGGTGTTGACCATTACTCCAGTCTGTCATGGGGAGCAGGAAATCCTCCTCCAGCTCCAGTGGGTTCCCCGCCTATCTGGAAAAAGGTGTTATATGAGCATCAGCCGTTTCCTGATAATTATGTGGATAACCGCTTCCTGGAGGAACTGAGGAAGAACATTTATGTACGTCGGTATCACTATTGGGCAGTGGTGTTTGAAGCTGGAGTAGTAATCCAACAGCTCTGCAGTGTTTGTGTGTTCTCTTTTATTTGGTGGTACATGGACCAGGATTTGCTGTCTCCTCAGAAGCTGTGTGGGGTTGGCTTGGCTTTCACACTCCTTGGCTACATATTATTTGATGCTGTAGACCA
  5   1   2       bld Emb1 5g                         IMAGE:6866663.5p   GACCTCTTCCGATTGGCTGCCAAGCTTTGACTGCTCAGGCAAAGGTTAAGAGGGCTGGAGAAACCCGGAAGCCTGGCGTTGGGAAATCAGGTGTGTAATATCTGAAGCCAGGAATCATTTGCAAAAGCAGAAATACAAGTCTTTTCTTACAGACAGGCTGCTACAGTTAAATGTCTGGTTTTACACTGAGAGCATCTGGCAAAGAAGAGGTATGAGCCCAGTGCTGCAAAGTCCCAACCCTGGTGTTGACCATTACTCCAGTCTGTCATGGGGAGCAGGAAATCCTCCTCCAGCTCCAGTGGGTTCCCCGCCTATCTGGAAAAAGGTGTTATATGAGCATCAGCCGTTTCCTGATAATTATGTGGATAACCGCTTCCTGGAGGAACTGAGGAAGAACATTTATGTACGTCGGTATCACTATTGGGCAGTGGTGTTTGAAGCTGGAGTAGTAATCCAACAGCTCTGCAGTGTTTGTGTGTTCTCTTTTATTTGGTGGTACATGGACCAGGATTTGCTGTCTCCTCAGAAGCTGTGTGGGGTTGGCTTGGCTTTCACACTCCTTGGCTACATATTATTTGATGCTGTAGACCAAGGAGAAGGAAGAAGAGACAGTGGAAGAACTCCCTGGGGCTGATCTTGAAAAGCGCACAAAAttttttttGGCGGCTTACATATGGGGGGTTCTCCCCCCGGTTGaaaaaaaaagcctggaatgaaattttttttGGGCACGCGGATTATATTTTTTATGCCCAGGTTCCAAATCCCTTTATTGCTTTCCTTGGGAACACCCTTGGGTCTTTTCTTTCCAACTTTTTGGGACCCCAATTGGCCCCCCTGTTAAATTTTTCCTAAGATACACCCCTTTTCCCCAAAAAACAAGGGGGCCCCttttttttGGCTTCCAAAGTTTTGGCCCCTTG
  5   1   2       bld Egg1 5g                            PBX0085H06.5p               TTGGCTGCCAAGCTTTGACTGCTCAGGCAAAGGTTAAGAGGGCTGGAGAAACCCGGAAGCCTGGCGTTGGGAAATCAGGTGTGTAATATCTGAAGCCAGGAATCATTTGCAAAAGCAGAAATACAAGTCTTTTCTTACAGACAGGCTGCTACAGTTAAATGTCTGGTTTTACACTGAGAGCATCTGGCAAAGAAGAGGTATGAGCCCAGTGCTGCAAAGTCCCAACCCTGGTGTTGACCATTACTCCAGTCTGTCATGGGGAGCAGGAAATCCTCCTCCAGCTCCAGTGGGTTCCCCGCCTATCTGGAAAAAGGTGTTATATGAGCATCAGCCGTTTCCTGATAATTATGTGGATAACCGCTTCCTGGAGGAACTGAGGAAGAACATTTATGTACGTCGGTATCACTATTGGGCAGTGGTGTTTGAAGCTGGAGTAGTAATCCAACAGCTCTGCAGTGTTTGTGTGTTCTCTTTTATTTGGTGGTACATGGACCAGGATTTGCTGTCTCCTCAGAAGCTGTGTGGGGTTGGCT
  5   1   2       bld Ga12 5g3  in                         XL207j10.5p                                  TGCTCAGGCAAAGGTTAAGAGGGCTGGAGAAACCCGGAAGCCTGGCGTTGGGAAATCAGGTGTGTAATATCTGAAGCCAGGAATCATTTGCAAAAGCAGAAATACAAGTCTTTTCTTACAGACAGGCTGCTACAGTTAAATGTCTGGTTTTACACTGAGAGCATCTGGCAAAGAAGAGGTATGAGCCCAGTGCTGCAAAGTCCCAACCCTGGTGTTGACCATTACTCCAGTCTGTCATGGGGAGCAGGAAATCCTCCTCCAGCTCCAGTGGGTTCCCCGCCTATCTGGAAAAAGGTGTTATATGAGCATCAGCCGTTTCCTGATAATTATGTGGATAACCGCTTCCTGGAGGAACTGAGGAAGAACATTTATGTACGTCGGTATCACTATTGGGCAGTGGTGTTTGAAGCTGGAGTAGTAATCCAACAGCTCTGCAGTGTTTGTGTGTTCTCTTTTATTTGGTGGTACATGGACCAGGATTTGCTGTCTCCTCAGAAGCTGTGTGGGGTTGGCTTGGCTTTCACACTCCTTGGCTACATATTATTTGATGCTGTAGACCAAGGAGAAGGAAGAAGAGACAGTGGAAGAACTCACTGGGCTGATCTGAAGAGCGCACTACCTATTTGTAGCGTTTACTTATGGTTTTTCCCCAGTGCTTAAGACACTGACTGAATCTATTANCACTGACACAATTTATGCCA
  5   1   2       bld Ga12 5g3  in                         XL159i22.5p                                                               GAAACCCGGAAGCCTGGCGTTGGGAAATAGGTGTGTAATATCTGAAGCCAGGAATCATTTGCAAAAGCAGAAATACAAGTCTTTTCTTACAGACAGGCTGCTACAGTTAAATGTCTGGTTTTACACTGAGAGCATCTGGCAAAGAAGAGGTATGAGCCCAGTGCTGCAAAGTCCCAACCCTGGTGTTGACCATTACTCCAGTCTGTCATGGGGAGCAGGAAATCCTCCTCCAGCTCCAGTGGGTTCCCCGCCTATCTGGAAAAAGGTGTTATATGAGCATCAGCCGTTTCCTGATAATTATGTGGATAACCGCTTCCTGGAGGAACTGAGGAAGAACATTTATGTACGTCGGTATCACTATTGGGCAGTGGTGTTTGAAGCTGGAGTAGTAATCCAACAGCTCTGCAGTGTTTGTGTGTTCTCTTTTATTTGGTGGTACATGGACCAGGATTTGCTGTCTCCTCAGAAGCTGTGTGGGGTTGGCTTGGCTTTCACACTCCTTGGCTACATATTATTTGATGCTGTAGACCAAGGAGAAGGAAGAAGAGACAGTGGAAGAACTCACTGGGCTGATCTGAAGAGCGCACTAGTATTTGTAGCGTTTACTTATGGTTTTTCCCCA
  5   1   2       bld Egg1 5g                            PBX0086H02.5p                                                                                              TGTGTAATATCTGAAGCCAGGAATCATTTGCAAAAGCAGAAATACAAGTCTTTTCTTACAGACAGGCTGCTACAGTTAAATGTCTGGTTTTACACTGAGAGCATCTGGCAAAGAAGAGGTATGAGCCCAGTGCTGCAAAGTCCCAACCCTGGTGTTGACCATTACTCCAGTCTGTCATGGGGAGCAGGAAATCCTCCTCCAGCTCCAGTGGGTTCCCCGCCTATCTGGAAAAAGGTGTTATATGAGCATCAGCCGTTTCCTGATAATTATGTGGATAACCGCTTCCTGGAGGAACTGAGGAAGAACATTTATGTACGTCGGTATCACTATTGGGCAGTGGTGTTTGAAGCTGGAGTAGTAATCCAACAGCTCTGCAGTGTTTGTGTGTTCTCTTTTATTTGGTGGTACATGGACCAGGATTTGCTGTCTCCTCAGAAGCTGTGTGGGGTTGGCTTGGCTTTCACACTCCTTGGCTACATATTATTTGATGCTGTA
  5   1   2       bld Egg1      in                    IMAGE:3300411.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCACGAGGGCTTGGCTTTCACACTCCTTGGCTACATATTATTTGATGCTGTAGACCAAGGAGAAGGAAGAAGAGACAGTGGAAGAACTCACTGGGCTGATCTGAAGAGCGCACTAGTATTTGTAGCGTTTACTTATGGTTTTTCCCCAGTGCTTAAGACACTGACTGAATCTATTAGCACTGACACAATTTATGCCATGTCAGTCCTTATGCTTCTTGGACACCTGGTCTTCTTCGACTTTGGAGCCAATGCCGCTGTAGTTTCTAGTACTCTTTCCATAAACATGGCCATTTTTGCTTCAGTTTGCCTTGCTTCACGACTTCCGCGGTCCCTTCATGCTTTTGCTATGGTCACCTTTGCCATCCAGATTTTTGCTCTGTGGCCGAGCTTGCATAGAAAGCTGAGGGCTAACACTCCTCGAACATACATAAGCGTAACCTTTCTCTTTGCCATTTATGCCTTGGGCGGATTATTGAACATTTCGGGTGTGGGGGCTTTGCTGGTTTTTCTCCCTCTCCTTTCC
  5   1   2       bld Egg2                   IMAGE:3300411-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGGGCTTGGCTTTCACACTCCTTGGCTACATATTATTTGATGCTGTAGACCAAGGAGAAGGAAGAAGAGACAGTGGAAGAACTCACTGGGCTGATCTGAAGAGCGCACTAGTATTTGTAGCGTTTACTTATGGTTTTTCCCCAGTGCTTAAGACACTGACTGAATCTATTAGCACTGACACAATTTATGCCATGTCAGTCCTTATGCTTCTTGGACACCTGGTCTTCTTCGACTTTGGAGCCAATGCCGCTGTAGTTTCTAGTACTCTTTCCATAAACATGGCCATTTTTGCTTCAGTTTGCCTTGCTTCACGACTTCCGCGGTCCCTTCATGCTTTTGCTATGGTCACCTTTGCCATCCAGATTTTTGCTCTGTGGCCGAGCTTGCATAGAAAGCTGAGGGCTAACACTCCTCGAACATACATAGGCGTAACCTTTCTCTTTGCCATTTTTGCCTTGGCCGGATTATTGAGCATTTCGGGTGTGGGGGCTTTGCTGTTTTTTCTCCTCCTCCTCTCCGTGGCATTTTTGTGTCCGTACTGCTTAATTCGGCTGCAGCTTTTTAAAGATAATATTCATGGACCGTGGGATGAAGCAGAAATTAAAGAAGACCTTTCTCGCTTCCTTAATTAGATATGTGCAAGTAAATATGATGCATTGCTGACAGCTTTGTAAGGAAGAATACAGGGACAATTTTCTTTTTTAACCATTGGGGGTTATTTTACTACAGTTTTTGATTTTATTTCTATGGAGTTGGTCAGTTATTCTTAGTAAGAGTTTAGATAATAAACGGCAAGCACTCCGAACTCCACTCTTATGGTaaaaaaaaCGTTTCGTATACAAGGATACATAGTCATGACTACATATGCTTGTATACGAAACGTTTGGGTTCGGGCGATGCACCCGGGCCACTCGACAATTTGGGTGAGTGCTTTTCCGCCAAAGGTGTTCCATACCTAAGCGGAGGAC
  3   1   2       add Thy  5g3  out                   IMAGE:8549395.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATATGTTTGAATGCCTGTTGGACAAAAGGAGGAAAGGAAGAAAGAGACAAGTGACGAACGCATGGGCTGATCGAGAGCGCACTTGTATTTGTAGCAATTACTTATGGGTTTTCCCCAGTGCTTAAAACACTGACTGAATCTATTAGCACGACACAATTTATGCCATGTCAGTCATTATGCTCTTGGACACCTGGTCTTTTTCGACTATGGAGCCAATGCTGCTGTAGTTTCTAAGTACTCTTTCCATAAACATGGCCATTTTTGCTTCTGTTTGTCTTGCCTCACGACTTCCACGGTCCCTCCATGCTTTTGCTATGGTCACTTTTGCCATCCAGATTTTTGCTCTGTGGCCCAGCTTGCAAAGAAAGCTGAGGGCTAACACTCCTCGAACATACATAGGCGTAACCTTTCTCTTTGCCATTCTTACCATGGCTGGACTATTGAGCATTTCGGGCGTGGGGGCTTTGCTGTTTTTTCTTCTCCTCCTCTCCGTGACATTTTTATGTCCATACTGCCTAATTCGGCTGCAGCTTTTTAAAGATAACATTTATGGACCATGGGATGAAGCAGAAATTAAAGACGACCTTTCTCGCTTCCTTAATTAGAAATGTGCAAATCAATATGACGCACTTCTGACAGCTTTGTAACTAAGAATAAAGGCAGAATTTCTGTTTTTAACCATTATTAGGGAATATTTTACTAGATTTTTTGATTTTATGTTTGTGGGGTTGATCAGTCATTTCTTAGTAATCATTTTCTTTTTAATCTCTTATTTATTTACATCCATATTCCACATGTGGGTTTATAGACTTTACTAGGTCAATACCAGCTCAATACTGACCAATTATCCACCTATGTAGTTTGTATTGGGCAAAAGACCCCACAATTCTGCATTTAATAAAACAAAAAAACAAG
  3   1   1       add Sp1       out                   IMAGE:4173451.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTAGTTTCTAGAACTCTTCCCATAAACATGGCCATTTTGGTTTCTGTTGTTCTTGCCTCACGACTCCACGGGTCCCTCCATGCTTTTGCTATGGTCACTTTTGCCATCCAGATTTTTGCTCTGTGGCCCAGCTTGCAAAGAAAGCTGAGGGCTAACACTCCTCGAACATACATAGGCGTAACCTTTCTCTTTGCCATTCTTACCATGGCTGGACTATTGAGCATTTCGGGCGTGGGGGCTTTGCTGTTTTTTCTTCTCCTCCTCTCCGTGACATTTTTATGTCCATACTGCCTAATTCGGCTGCAGCTTTTTAAAGATAACATTTATGGACCATGGGATGAAGCAGAAATTAAAGACGACCTTTCTCGCTTCCTTAATTAGAAATGTGCAAATCAATATGACGCACTTCTGACAGCTTTGTAACTAAGAATAAAGGCAGAATTTCTGTTTTTAACCATTATTAGGGAATATTTTACTAGATTTTTTGATTTTATGTTTGTGGGGTTGATCAGTCATTTCTTAGTAATCATTTTCTTTTTAATCTCTTATTTATTTACATCCATATTCCACATGTGGGTTTATAGACTTTACTAGGTCAATACCAGCTCAATACTGACCAATTATCCACCTATGTAGTTTGTATTGGGCAAATGACTGCACAATTCTGCTTTTAATA
  3   1   2      skin Ga12 5g3  in                         XL207j10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATACAGGGACAATTTTCTTTTTTAACCATTGGGGGTTATTTTACTACAGTTTTTGATTTTATTTCTATGGAGTTGGTCAGTTATTCTTAGTAAGAGTTTAGATAAGAAACGGCAAGCACTCCGAACTCCACTCTTATGGTAAAAAAAACGTTTCGTATACAAGGATACATAGTCATGACTACGTATGCTTGTATACGAAACGTTGGGTTCGGGCGATGCACCCGGGCCACTCGACAATTTGGGTGAGTGCTTTTCTGCCAAAAGGTGTTCCATACCTAAGCGGAGGACCTGGGTTTTATACACCCAGGTCATAGTATTTACAGGGTGAGCGGTTTTGTGTTTTGAGACCCATAAATTGCAATTAAATATAATTAATTCAAGCAGCACCCGTTTAAGTAAAACAAGGAAACAGGACAGAACAGCTTATATTTATGGCTCATATTGCAAGAGTTTAGATATCCTCCCCTGAGACTACATAGCCATTTATTGGCCTGATCAATTACTTTTTAATCTATTTATTTACGTCCATATTCCACATGAGTGTGACATAACATTTGTGGGTTTATAATATATTCTGAAGACCTGATTTCTGGTGTAGGGAGTTTGCCTTGCTGCTAGTCTGTTTTTATAATTTTAAATTAATTTAACCCCAGTATGGCAAACAGGTCCATTTTCACCCGCTGAAAGACCCAGCTCAACTCTGACCTATTTTCCTCTTTTGTACCTTGGCTGTGGCAAATGATTGTACAATTCTTCTTTTAATAANA
  3   1   1       add Tbd7      out                        XL091e14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAAAGGCAGAATTTCTGTTTTTAACCATTATTAGGGAATATTTTACTAGATTTTTTGATTTTATGTTTGTGGGGTTGATCAGTCATTTCTTAGTAANCATTTTCNTTTTAATCTCTTATTTATTTACATCCATATTCCACATGTGGGTTTATAGACTTTACTAGGNCAAAACCAGCTCAANACTGACCAATTANCCNCCTANGTAGTTTGTATTGGGCAAANGACTGCNCAATTCGNCTTTTAATAAAAAAAAAAATG
  5  -1   2       bld Bla2                            IMAGE:7297279.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTTTACCATGGGTATTATCATTTGATTATTTATGAGTGTCATATCTGTAGAGTAGATAGAACGCAGCATCCGACTCACTCTAGGTAAAAAACGTTCGTATACAAGGTACATATCATGACTACGTAGCTTGTTACGAACGTGGGTTCGGGCGATGCACCCGGCCACTCGACAATTGGGTGAGTGTTTTCTGCCAAAAGGTGTTCCATACCTAAGCGGAGGACCTGGGTTTTATACACCCAGGTCATAGTATTTACAGGGTGAGCGGTTTTGTGTTTTGAGACCCATAAATTGCAATTAAATATAATTAATTCAAGCAGCACCCGTTTAAGTAAAACAAGGAAACAGGACAGAACAGCTTATATTTATGGCTCATATTGCAAGAGTTTAGATATCCTCCCCTGAGACTACATAGCCATTTATTGGCCTGATCAATTACTTTTTAATCTATTTATTTACGTCCATATTCCACATGAGTGTGACATAACATTTGTGGGTTTATAATATATTCTGAAGACCTGATTTCTGGTGTAGGGAGTTTGCCTTGCTGCTAGTCTGTTTTTATAATTTTAAATTAATTTAACCCCAGTATGGCAAACAGGTCCATTTTCACCCACTGAAAGACCCAGCTCAACTCTGACCTATTTTCCTCTTTTGTACCTTGGCTGTGGCAAATGATTGTACAATTCTTCTTTTAATAATAAATAGTTTTTTGTTTCTGAATTTaaaaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGTACCCAACGC
  3   1   2       bld Ga12 5g3  in                         XL159i22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AACGTTTCGTATACAAGGATACATAGTCATGACTACGTATGCTTGTATACGAAACGTTGGGTTCGGGCGATGCACCCGGGCCACTCGACAATTTGGGTGAGTGCTTTTCTGCCAAAAGGTGTTCCATACCTAAGCGGAGGACCTGGGTTTTATACACCCAGGTCATAGTATTTACAGGGTGAGCGGTTTTGTGTTTTGAGACCCATAAATTGCAATTAAATATAATTAATTCAAGCAGCACCCGTTTAAGTAAAACAAGGAAACAGGACAGAACAGCTTATATTTATGGCTCATATTGCAAGAGTTTAGATATCCTCCCCTGAGACTACATAGCCATTTATTGGCCTGATCAATTACTTTTTAATCTATTTATTTACGTCCATATTCCACATGAGTGTGACATAACATTTGTGGGTTTATAATATATTCTGAAGACCTGATTTCTGGTGTAGGGAGTTTGCCTTGCTGCTAGTCTGTTTTTATAATTTTAAATTAATTTAACCCCAGTATGGCAAACAGGTCCATTTTCACCCGCTGAAAGACCCAGCTCAACTCTGACCTATTTTCCTCTTTTGTACCT
  3   1   2       bld Ga12 5g3  in                         XL158l13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCGATGCACCCGGGCCACTCGACAATTTGGGTGAGTGCTTTTCTGCCAAAAGGTGTTCCATACCTAAGCGGAGGACCTGGGTTTTATACACCCAGGTCATAGTATTTACAGGGTGAGCGGTTTTGTGTTTTGAGACCCATAAATTGCAATTAAATATAATTAATTCAAGCAGCACCCGTTTAAGTAAAACAAGGAAACAGGACAGAACAGCTTATATTTATGGCTCATATTGCAAGAGTTTAGATATCCTCCCCTGAGACTACATAGCCATTTATTGGCCTGATCAATTACTTTTTAATCTATTTATTTACGTCCATATTCCACATGAGTGTGACATAACATTTGTGGGTTTATAATATATTCTGAAGACCTGATTTCTGGTGTAGGGAGTTTGCCTTGCTGCTAGTCTGTTTTTATAATT
  3   1   2      shim Egg1                            IMAGE:4783435.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCGACAATTTGGGTGAGTGCTTTTCCGCCAAAAGGTGTTCCATACCTAAGCGGAGGACCTGGGTTTTATACACCCAGGTCATAGTATTTACAGGGTGAGCGGTTTTGTGTTTTGAGACCCATAAATTGCAATTAAATATAATTAATTCAAGCAGCACCCGTTTAAGTAAAACAAGGAAACAGGACAGAACAGCTTATATTTATGGCTCATATTGCAAGAGTTTAGATATCCTCCCCTGAGACTACATAGCCATTTATTGGCCTGATCAATTACTTTTTAATCTATTTATTTACGTCCATATTCCACATGAGTGTGACATAACATTTGTGGGTTTATAATATATTCTGAAGACCTGATTTCTGGTGTAGGGAGTTTGCCTTGCTGCTAGTCTGTTTTTATAATTTTAAATTAATTTAACCCCAGTATGGCAAACAGGTCCATTTTCACCCGCTGAAAGACCCAGCTCAACTCTGACCTATTTTCCTCTTTTGTACCTTGGCTGTGGCAAATGATTGTACAATTCTTCTTTTAATAATAAATAGTTTTTTGTTTCTGAAAAA
  3   1   2       bld Egg1      in                    IMAGE:3300411.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGGTCATAGTATTTACAGGGTGAGCGGTTTTGTGTTTTGAGACCCATAAATTGCAATTAAATATAATTAATTCAAGCAGCACCCGTTTAAGTAAAACAAGGAAACAGGACAGAACAGCTTATATTTATGGCTCATATTGCAAGAGTTTAGATATCCTCCCCTGAGACTACATAGCCATTTATTGGCCTGATCAATTACTTTTTAATCTATTTATTTACGTCCATATTCCACATGAGTGTGACATAACATTTGTGGGTTTATAATATATTCTGAAGACCTGATTTCTGGTGTAGGGAGTTTGCCTTGCTGCTAGTCTGTTTTTATAATTTTAAATTAATTTAACCCCAGTATGGCAAACAGGTCCATTTTCACCCGCTGAAAGACCCAGCTCAACTTTGACCTATTTTCCTCTTTTGTACCTTGGCTGTGGCAAATGATTGTCCAATTCTTCTTTTAATAATAAATAGTTTTTTGTTTTTGAATTTAAAAAAAAA
  5  -1   2       bld Ga12                                 XL191c17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGTGAGCGGTTTTGTGTTTTGAGACCCATAAATTGCAATTAAATATAATTAATTCAAGCAGCNCCCGTTTAAGTAAAACAAGGAAACAGGACAGAACAGCTTATATTTATGGNTCATATTGCAAGAGTTTAGATATCCTCCCCTGAGACTACATAGCCATTTATTGGCCTGATCAANTACTTTTTAATNTATTTATTTACGTCCATATTCCACATGAGTGTGACATAACATTTGTGGGTTTATAATATATTTTGAAGACCTGATTTTTGGTGTAGGGAGTTTGCCTTGCTGNTAGTNTGTTTTTATAATTTTAAATTAATTTAACCCCAGTATGGCAAACAGGTCCATTTTCACCCGNTGAAAGACCCAGNTCAACTTTGACCTATTTTCCTNTTTTGTACCTTGGCTGTGGCAAANGATTGTACAAttttttttttaataataaatantttttttGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)