Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:7007866.5                      11 END     1           7        9                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012776518 Xl3.1-IMAGE:8545303.5 - 14 ESTs
                                                                       -10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8545303.5           TGTCAATTTGTGTACAACCCTGCACAGTACGACTATGATCGAGATGACGTGGGAGACCGATGTGATAACTGCCCCTACAACCACAACCCAGACCAGGCTGACACAGACCGTAATGGAGAAGGGGACGCCTGTTCTGTGGACATTGATGGAGATGGAATTCTGAATGAGAGAGATAACTGCCCCTATGTGTACAATGTAGACCAGAGAGATACCGATAAGGACGGTGTTGGAGACCAATGTGATAACTGCCCACTGCAACACAATCCAGAACAGACTGACTCTGATTCTGATCTCATTGGAGATAAGTGTGACAACAATCAGGATATAGATGAGGATGGACATCAGAATAACCTAGATAACTGCCCCTATGTCCCCAATGCCAACCAGGCAGATCATGATAAGGATGGCAAGGGTGATGCATGTGACCACGATGATGACAATGATGGTATTCCTGATGACAGAGATAACTGCCGATTGGTCCCTAACCCAGACCAGACAGATACTAATGGAGATGGACGTGGAGATGCTTGCCAGTATGACTTTGATGATGACAACATACCCGATGCAGAAGATGTTTGCCCAGAGAATGTGGAAATCAGTACTACTGACTTCCGTAAATTCCAAATGGTGCCTTTGGATCCTAAAGGGACATTACAGATTGATCCTAACTGGGTGGTGAGACATCAAGGCAAAGAATTGGTGCAGACTGTTAACTGTGATCCTGGAATTGCAGTTGGTTTTGATGAGTTCAGCGCTGTTGACTTCAGTGGCACATTTTTCATCAACACTGAGAGAGATGACGATTATGCTGGCTTTGTGTTTGGATACCAGTCCAGCAGCAGGTTTTACGTGGTTATGTGGAAGCAAATCACACAGACATACTGGGACACAACCCCCACTGTAGCTCAGGGCTACTCTGGCCTCTCAATCAAGGTTGTGAACTCTACCTCTGGACCAGGGGAGCACCTACGAAATGCACTGTGGCACACAGGAAACACTCCAGGGCAGGTTCGCACCTTGTGGCATGATCCTCACCAGATTGGCTGGAAAGATTTCACAGCTTACAGATGGCACCTGACCCACAGACCAAAGACCGGTTTCATTAGAGTCGTCATGCATGAAGGCAAGAAAGTTATGGCCGACTCAGGACCAATTTATGATAAAACATATGCTGGAGGAAGATTAGGATTGTTCGTCTTCTCACAAGAGATGGTCTTCTTTTCTGATCTCAAATACGAGTGCAGAGACTCATAATCCAGAAGTTCTTCATTCCATGAATGTTAAGAGGATGTGATCGCACCTTCATATATGTACCATCCTTTGGACCATTTCTTCCATTTTTTTTTTAAAAAAACTTTTTTCTAAATTCTCTTTTTTTGG
                                                  Xl3.1-CHK-1012692396                 TTTGTGTACAACCCTGCACAGTACGACTATGATCGAGATGACGTGGGAGACCGATGTGATAACTGCCCCTACAACCACAACCCAGACCAGGCTGACACAGACCGTAATGGAGAAGGGGACGCCTGTTCTGTGGACATTGATGGAGATGGAATTCTGAATGAGAGAGATAACTGCCCCTATGTGTACAATGTAGACCAGAGAGATACCGATAAGGACGGTGTTGGAGACCAATGTGATAACTGCCCACTGCAACACAATCCAGAACAGACTGACTCTGATTCTGATCTCATTGGAGATAAGTGTGACAACAATCAGGATATAGATGAGGATGGACATCAGAATAACCTAGATAACTGCCCCTATGTCCCCAATGCCAACCAGGCAGATCATGATAAGGATGGCAAGGGTGATGCATGTGACCACGATGATGACAATGATGGTATTCCTGATGACAGAGATAACTGCCGATTGGTCCCTAACCCAGACCAGACAGATACTAATGGAGATGGACGTGGAGATGCTTGCCAGTATGACTTTGATGATGACAACATACCCGATGCAGAAGATGTTTGCCCAGAGAATGTGGAAATCAGTACTACTGACTTCCGTAAATTCCAAATGGTGCCTTTGGATCCTAAAGGGACATTACAGATTGATCCTAACTGGGTGGTGAGACATCAAGGCAAAGAATTGGTGCAGACTGTTAACTGTGATCCTGGAATTGCAGTTGGTTTTGATGAGTTCAGCGCTGTTGACTTCAGTGGCACATTTTTCATCAACACTGAGAGAGATGACGATTATGCTGGCTTTGTGTTTGGATACCAGTCCAGCAGCAGGTTTTACGTGGTTATGTGGAAGCAAATCACACAGACATACTGGGACACAACCCCCACTGTAGCTCAGGGCTACTCTGGCCTCTCAATCAAGGTTGTGAACTCTACCTCTGGACCAGGGGAGCACCTACGAAATGCACTGTGGCACACAGGAAACACTCCAGGGCAGGTTCGCACCTTGTGGCATGATCCTCACCAGATTGGCTGGAAAGATTTCACAGCTTACAGATGGCACCTGACCCACAGACCAAAGACCGGTTTCATTAGAGTCGTCATGCATGAAGGCAAGAAAGTTATGGCCGACTCAGGACCAATTTATGATAAAACATATGCTGGAGGAAGATTAGGATTGTTCGTCTTCTCACAAGAGATGGTCTTCTTTTCTGATCTCAAATACGAGTGCAGAGACTCATAATCCAGAAGTTCTTCATTCCATGAATGTTAAGAGGATGTGATCGCACCTTCATATATGTACCATCCTTTGGACCATTTCTTCCATTTTTTTTTAAAAAAAACTTTTTTCTAAATTCTCTTTTTTTGGAACAAA
                                                      consensus depths                2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     7     6     7     7     8     7     8     7     8     7     8     7     8     8    10     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     6    10     7    10     7    10     7    10     5    10     6    10     6    10     6     9     7     9     7     9     7     9     7     9     7     9     5     9     4     9     7     9     6     9     7     9     7     9     7     9     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     6     7     5     7     6     7     6     7     4     7     4     7     3     6     3     6     4     6     2     6     2     6     2     6
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   --------T---
  5   1   2       bld Lu1       out                   IMAGE:4057281.5p CACGCGTCCGTGTCAATTTGTGTACAACCCTGCACAGTACGACTATGATCGAGATGACGTGGGAGACCGATGTGATAACTGCCCCTACAACCACAACCCAGACCAGGCTGACACAGACCGTAATGGAGAAGGGGACGCCTGTTCTGTGGACATTGATGGAGATGGAATTCTGAATGAGAGAGATAACTGCCCCTATGTGTACAATGTAGACCAGAGAGATACCGATAAGGACGGTGTTGGAGACCAATGTGATAACTGCCCACTGCAACACAATCCAGAACAGACTGACTCTGATTCTGATCTCATTGGAGATAAGTGTGACAACAATCAGGATATAGATGAGGATGGACATCAGAATAACCTAGATAACTGCCCCTATGTCCCCAATGCCAACCAGGCAGATCATGATAAGGATGGCAAGGGTGATGCATGTGACCACGATGATGACAATGATGGTATTCCTGATGACAGAGATAACTGCCGATTGGTCCCTAACCCAGACCAGACAGATACTAATGGAGATGACGTG
  5   1   2      seed Lu1                    IMAGE:4057281-IMAGp.IMAGp           TGTCAATTTGTGTACAACCCTGCACAGTACGACTATGATCGAGATGACGTGGGAGACCGATGTGATAACTGCCCCTACAACCACAACCCAGACCAGGCTGACACAGACCGTAATGGAGAAGGGGACGCCTGTTCTGTGGACATTGATGGAGATGGAATTCTGAATGAGAGAGATAACTGCCCCTATGTGTACAATGTAGACCAGAGAGATACCGATAAGGACGGTGTTGGAGACCAATGTGATAACTGCCCACTGCAACACAATCCAGAACAGACTGACTCTGATTCTGATCTCATTGGAGATAAGTGTGACAACAATCAGGATATAGATGAGGATGGACATCAGAATAACCTAGATAACTGCCCCTATGTCCCCAATGCCAACCAGGCAGATCATGATAAGGATGGCAAGGGTGATGCATGTGACCACGATGATGACAATGATGGTATTCCTGATGACAGAGATAACTGCCGATTGGTCCCTAACCCAGACCAGACAGATACTAATGGAGATGGACGTGGAGATGCTTGCCAGTATGACTTTGATGATGACAACATACCCGATGCAGAAGATGTTTGCCCAGAGAATGTGGAAATCAGTACTACTGACTTCCGTAAATTCCAAATGGTGCCTTTGGATCCTAAAGGGACATTACAGATTGATCCTAACTGGGTGGTGAGACATCAAGGCAAAGAATTGGTGCAGACTGTTAACTGTGATCCTGGAATTGCAGTTGGTTTTGATGAGTTCAGCGCTGTTGACTTCAGTGGCACATTTTTCATCAACACTGAGAGAGATGACGATTATGCTGGCTTTGTGTTTGGATACCAGTCCAGCAGCAGGGTTTTACGTGGTTATGTGGAAGCAAATCACACAGACATACTGGGACCCAACCCCCACTGTAGCTCAGGGCTACTCTGGCCTCTC
  5   1   2       bld Sp1       out                   IMAGE:4174476.5p                                                    AGATGACGTGGGAGACCGATGTGATAACTGCCCCTACAACCACAACCCAGACCAGGCTGACACAGACCGTAATGGAGAAGGGGACGCCTGTTCTGTGGACATTGATGGAGATGGAATTCTGAATGAGAGAGATAACTGCCCCTATGTGTACAATGTAGACCAGAGAGATACCGATAAGGACGGTGTTGGAGACCAATGTGATAACTGCCCACTGCAACACAATCCAGAACAGACTGACTCTGATTCTGATCTCATTGGAGATAAGTGTGACAACAATCAGGATATAGATGAGGATGGACATCAGAATAACCTAGATAACTGCCCCTATGTCCCCAATGCCAACCAGGCAGATCATGATAAGGATGGCAAGGGTGATGCATGTGACCACGATGATGACAATGATGGTATTCCTGATGACAGAGATAACTGCCGATTGGTCCCTACCCAAGACCAG
  5   1   2       bld Sp1                             IMAGE:4964635.5p                                                                                                                                                                         TCTGAATGAGAGAGATAACTGCCCCTATGTGTACAATGTAGACCAGAGAGATACCGATAAGGACGGTGTTGGAGACCAATGTGATAACTGCCCACTGCAACACAATCCAGAACAGACTGACTCTGATTCTGATCTCATTGGAGATAAGTGTGACAACAATCAGGATATAGATGAGGATGGACATCAGAATAACCTAGATAACTGCCCCTATGTCCCCAATGCCAACCAGGCAGATCATGATAAGGATGGCAAGGGTGATGCATGTGACCACGATGATGACAATGATGGTATTCCTGATGACAGAGATAACTGCCGATTGGTCCCTAACCCAGACCAGACAGATACTAATGGAGATGGACGTGGAGATGCTTGCCAGTATGACTTTGATGATGACAACATACCCGATGCAGAAGATGTTTGCCCAGAGAATGTGGAAATCAGTACTACTGACTTCCGTAAATTCCAAATGGTGCCTTTGGATCCTAAAGGGACATTACAGATTGATCCTAACTGGGTGGTGAGACATCAAGGCAAAGAATTGGTGCAGACTGTTAACTGTGATCCTGGAATTGCAGTT
  5   1   2       bld Sp1                             IMAGE:4965553.5p                                                                                                                                                                                                              GGATATCGTCGACCCACGCGTCCGGACCCACGCGTCCGCCAATGTGATAACTGCCCACTGCAACACAATCCAGAACAGACTGACTCTGATTCTGATCTCATTGGAGATAAGTGTGACAACAATCAGGATATAGATGAGGATGGACATCAGAATAACCTAGATAACTGCCCCTATGTCCCCAATGCCAACCAGGCAGATCATGATAAGGATGGCAAGGGTGATGCATGTGACCACGATGATGACAATGATGGTATTCCTGATGACAGAGATAACTGCCGATTGGTCCCTAACCCAGACCAGACAGATACTAATGGAGATGGACGTGGAGATGCTTGCCAGTATGACTTTGATGATGACAACATACCCGATGCAGAAGATGTTTGCCCAGAGAATGTGGAAATCAGTACTACTGACTTCCGTAAATTCCAAATGGTGCCTTTGGATCCTAAAGGGACATTACAGATTGATCCTAACTGGGTGGTGAGACATCAAGGCAAAGAATTGGTGCAGACTGTTAACTGTGATCCTGGAATTGCAGTTGGTTTTGATGAGTTCAGCGCTGTTGACTTCAGTGGCACATTTTTCATCAACACTGAGAGAGATGACGATTATGCTGGCT
  5   1   2       bld Tad1                            IMAGE:6940835.5p                                                                                                                                                                                                                                                                                                                   GGGAGATAAGTGTGACAACAATCAGGATATAGATGAGGATGGACATCAGAATAACCTAGATAACTGCCCCTATGTCCCCAATGCCAACCAGGCAGATCATGATAAGGATGGCAAGGGTGATGCATGTGACCACGATGATGACAATGATGGTATTCCTGATGACAGAGATAACTGCCGATTGGTCCCTAACCCAGACCAGACAGATACTAATGGAGATGGACGTGGAGATGCTTGCCAGTATGACTTTGATGATGACAACATACCCGATGCAGAAGATGTTTGCCCAGAGAATGTGGAAATCAGTACTACTGACTTCCGTAAATTCCAAATGGTGCCTTTGGATCCTAAAGGGACATCACAGATTGATCCTAACTGGGTGGTGAGACATCAAGGCAAAGAATTGGTGCAGACTGTTAACTGTGATCCTGGAATTGCAGTTGGTTTTGATGAGTTCAGCGCTGTTGACTTCAGTGGCACATTTTTCATCAACACTGAGAGAGATGACGATTATGCTGGCTTTGTGTTTGGATACCAGTCCAGCAGCAGGTTTTATGTGGTTATGTGGAAGCAAATCACACAGACATACTGGGGACACAACCCCCCACTGTAGNCTCAGGGCTACTCTGGGCCTCTCAATCAAGGTTTGTGAAACTCTACCCTCTGGGAACCAGGGGGAGCACCCTACGAAAAATGCCACTGGTGGCCACACCAGGGAAAACCACTTTCCAAGGAACAGGGTTCCGCCACCCTTTGGGGGCCATTGGATTCCTCTCACCAAGAAATTGGGG
  5   1   2       bld Tad2      in                    IMAGE:6872448.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TATTCCTGATGACAGAGATAACTGCCGATTGGTCCCTAACCCAGACCAGACAGATACTAATGGAGATGGACGTGGAGATGCTTGCCAGTATGACTTTGATGATGACAACATACCCGATGCAGAAGATGTTTGCCCAGAGAATGTGGAAATCAGTACTACTGACTTCCGTAAATTCCAAATGGTGCCTTTGGATCCTAAAGGGACATTACAGATTGATCCTAACTGGGTGGTGAGACATCAAGGCAAAGAATTGGTGCAGACTGTTAACTGTGATCCTGGAATTGCAGTTGGTTTTGATGAGTTCAGCGCTGTTGACTTCAGTGGCACATTTTTCATCAACACTGAGAGAGATGACGATTATGCTGGCTCTGTGTTTGGATACCAGTCCAGCAGCAGGTTTTACGTGGTTATGTGGAAGCAAATCACACAGACATACTGGGACACAACCCCCACTGTAACTCAGGGCTACTCTGGCCTCTCAATCAAGGTTGTGAACTCTACCTCTGGACCAGGGGAGCACCTACGAAATGCACTGTGGCACACAGGAAAACACTCCCAGGACAGGTTCGCACCTTTGTGGGCATGATCCCTCACCAGATTGGGCTGGAAAAGATTTCACAGCTTACAGAAGGGCACCTGGACCCCCAGAACCAAAAAACCGGGTTTTCATTTAAAATCCCCCACTGCATGGAAGGGCCAAGAAAAGGTTTTTGGCCCGAACTCCAGGGACCCAATTTTTATTGaaaaaaaaCCATATTGGCTGGGGAGGGAAACCATTAAGGAAATTGTGTCC
  5   1   2       bld Tail                            IMAGE:8545303.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGACTTCCGTAATTCCAATGGTGCCTTTGGATCCTAAAGGGACATCACAGATTGATCCTAACTGGGTGGTGAGACATCAAGGCAAAGAATTGGTGCAGACTGTTAACTGTGATCCTGGAATTGCAGTTGGTTTTGATGAGTTCAGCGCTGTTGACTTCAGTGGCACATTTTTCATCAACACTGAGAGAGATGACGATTATGCTGGCTTTGTGTTTGGATACCAGTCCAGCAGCAGGTTTTACGTGGTTATGTGGAAGCAAATCACACAGACATACTGGGACACAACCCCCACTGTAGCTCAGGGCTACTCTGGCCTCTCAATCAAGGTTGTGAACTCTACCTCTGGACCAGGGGAGCACCTACGAAATGCACTGTGGCACACAGGAAACACTCCAGGGCAGGTTCGCACCCTGTGGCATGATCCTCACCAGATTGGCTGGAAAGATTTCACAGCTTACAGATGGCACCTGACCCACAGACCAAAGACCGGTTTCATTAGAGTCGTCATGCATGAAGGCAAGAAAGTTATGGCCGACTCAGGACCAATTTATGATAAAACATATGCTGGAGGAAGATTAGGATTGTTCGTCTTCTCACAAGAGATGGTCTTCTTTTCTGATCTCAAATACGAGTGCAGAGACTCATAATCCTGAAGTTCTTCATTCCATGAATGTTAAGAGGATGTGATCGCACCTTCATATATGTAC
  3   1   2       add Tad2      in                    IMAGE:6872448.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGCAGAGACTGTTTTTACAACTGGTGTGTATCCCCTGAGGAAATTTTGCCCAGGTTGGGTTTTTTGGAAAAGATGTTTCAAGGCGCCTTTTGGACTTTTCAGGGGGGCCCCACATTTTTTCATTCAAACCCCTTGGGGGGGAGGATTGACCGGTTTTTTGCCTGGGCTTCGGTGGTTTGGATTACCCCGTTCCCAGCCGGCAGGGTTTTTACGTGGTTAATGTGGAAGCCAAATCACACCGACCATACTTGGGACCCAACCCCCCACTGTGGTTCAGGGGTAATTTTGGCCTCTCAATCAAGGTTGTGACTCTACCTCTGACCAGGGGAGCACCTACGAAATGCACTGTGGCACACAGGAAACACTCCAGGACAGGTTCGGCACCTTGTGGCATGATCCTCACCAGATTGGCTGGAAAGATTTCACAGCTTACAGATGGCACCTGACCCACAGACCAAAGACCGGTTTCATTAGAGTCGTCATGCATGAAGGCAAGAAAGTTATGGCCGACTCAGGACCAATTTATGATAAAACATATGCTGGAGGAAGATTAGGATTGTTCGTCTTCTCACAAGAGATGGTCTTCTTTTCTGATCTCAAATACGAGTGCAGAGACTCATAATCCAGAAGTTCTTCATTCCATGAATGTTAAGAGGATGTGATCGCACCTTCATATATGTACCATCCTTTGGACCATTTCTTCCATTTTTTTTTTAAAAAAACTTTTTTCTAAATTCTCTTTTTTTGGAACAAATGATCCATTCCAAAAACATGTAATTAAAGACAGACTTTTAAGTAAAAGGAGGTATATTTTCTCAATGGGAAACCTTTGGCTCAAAAAGATCTGTCACCGAAGAGCAATGACATAGACATATTTTTGTACCCGAACTCCCATGAAAGATTTGTTGTATTATGT
  5   1   2       bld Sp1                             IMAGE:5506642.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACAGATTGATCCTAACTGGGTGGTGAGACATCAAGGCAAAGAATTGGTGCAGACTGTTAACTGTGATCCTGGAATTGCAGTTGGTTTTGATGAGTTCAGCGCTGTTGACTTCAGTGGCACATTTTTCATCAACACTGAGAGAGATGACGATTATGCTGGCTTTGTGTTTGGATACCAGTCCAGCAGCAGGTTTTATGTGGTTATGTGGAAGCAAATCACACAGACATACTGGGACACAACCCCCACTGTAGCTCAGGGCTACTCTGGCCTCTCAATCAAGGTTGTGAACTCTACCTCTGGACCAGGGGAGCACCTACGAAATGCATTGTGGCACACAGGAAACACTCCAGGGCAGGTTCGCACCTTGTGGCATGATCCTCACCAGATTGGCTGGAAAGATTTCACAGCTTACAGATGGCACCTGACCCACAGACCAAAGACCGGTTTCATTAGAGTCGTCATGCATGAAGGCAAGAAAGTTATGGCCGACTCAGGACCAATTTATGATAAAACATATGCTGGAGGAAGATTAGGATTGTTCGTCTTCTCACAAGAGATGGTCTTCTTTTCTGATCTCAAATACGAGTGCAGAGACTCATAATCCAGAAGTTCTTCATTCCATGAATGTTAAGAGGATGTGATCGCACCTTCATATATGTACCATCCTTTGGACCATTTCTTCCAtttttttttaaaaaaacttttttctaattctctttttttGGAACAATGATCATTCCAAACATGTATTAAAGAA
  5   1   2       bld Sp1                             IMAGE:5506876.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                cggacgcgtgggcTGGAATTGCAGTTGGTTTTGATGAGTTCAGCGCTGTTGACTTCAGTGGCACATTTTTCATCAACACTGAGAGAGATGACGATTATGCTGGCTTTGTGTTTGGATACCAGTCCAGCAGCAGGTTTTATGTGGTTATGTGGAAGCAAATCACACAGACATACTGGGACACAACCCCCACTGTAGCTCAGGGCTACTCTGGCCTCTCAATCAAGGTTGTGAACTCTACCTCTGGACCAGGGGAGCACCTACGAAATGCATTGTGGCACACAGGAAACACTCCAGGGCAGGTTCGCACCTTGTGGCATGATCCTCACCAGATTGGCTGGAAAGATTTCACAGCTTACAGATGGCACCTGACCCACAGACCAAAGACCGGTTTCATTAGAGTCGTCATGCATGAAGGCAAGAAAGTTATGGCCGACTCAGGACCAATTTATGATAAAACATATGCTGGAGGAAGATTAGGATTGTTCGTCTTCTCACAAGAGATGGTCTTCTTTTCTGATCTCAAATACGAGTGCAGAGACTCATAATCCAGAAGTTCTTCATTCCATGAATGTTAAGAGGATGTGATCGCACCTTCATATATGTACCATCCTTTGGACCATTTCTTCCAtttttttttaaaaaaaacttttttctaaattctctttttttGGACAAATGATCATTCCAAAACATGTATTAAAGACGACTTTTAGTAAAGGAGTATATTTCTCATGGGAACCCTTGCTCAAAGATCGTCACC
  5   1   2       add FaB                             IMAGE:8072854.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTAACTGCGATCCTGGAATAGCAGTTGGTTTTGACGAGTTCAGCGCTGTTGACTTCAGTGGCACATTTTTCATCAACACCGAGAGAGATGATGATTATGCTGGCTTTGTGTTTGGATACCAGTCCAGCAGCAGGTTTTACGGGGTTATGTGGAAGCAAATCACACAGACATACTGGGACACAACCCCTACGGTAGCTCAGGGCTACTCTGGCCTCTCAATCAAGGTTGTGAACTCTACCTCTGGACCAGGGGAGCACCTACGAAATGCACTGTGGCACACAGGAAACACTCCCGGGCAGGTTCGCACCTTATGGCATGATCCTCACCAGAAAGGCTGGAAAGATTTCACAGCTTACAGATGGCACCTGACACACAGACCAAAGACTGGTTTCATTAGAGTTGTCATGTATGAAGGCAAGAGAGTTATGGCCGACTCAGGACCAATTTATGATAAAACATATGCTGGAGGAAGATTAGGATTGTTCGTCTTCTCACAAGAGATGGTCTTCTTTTCTGATCTCAAATACGAGTGCAGAGACTCATAATTCAGAATTTCTTCATTCCATGAATGTTAAGAGGATATCACGCACCTTCAGATATGTACCATCCTTCGGACCATTTCTTCAAttttttttaaaaaactttttttctaaatttttGGAACAAATGATCTATTCCAAAAACGTGTAATTAAAGACAGACTTTTAAGTAAAAAGAGGAATAT
  5   1   2       bld Tad2                            IMAGE:6934534.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGATTATGCTGGCTTTGTGTTTGGATACCAGTCCAGCAGCAGGTTTTACGTGGTTATGTGGAAGCAAATCACACAGACATACTGGGACCCAACCCCCACTGTAGCTCAGGGCTACTCTGGCCTCTCAATCAAGGTTGTGAACTCTACCTCTGGACCAGGGGAGCACCTACGAAATGCACTGTGGCACACAGGAAACACTCCAGGACAGGTTCGCACCTTGTGGCATGATCCTCACCAGATTGGCTGGAAAGATTTCACAGCTTACAGATGGCACCTGACCCACAGACCAAAGACCGGTTTCATTAGAGTCGTCATGCATGAAGGCAAGAAAGTTATGGCCGACTCAGGACCAATTTATGATAAAACATATGCTGGAGGAAGATTAGGATTGTTCGTCTTCTCACAAGAGATGGTCTTCTTTTCTGATCTCAAATACGAGTGCCAGAGACTCATAATCCAGAAGTTCTTCATTCCATGAATGTTAAGAGGATGTGATCGCACCCTTCATATATGTACCATCCTTTGGACCATTTCTTCCAtttttttttttaaaaaacttttttctaaaatctctttttttGGAACAAATGATCCATTCCAAAAACATGTAATTAAAGACAGACTTTTTAGTAAAAGGAGGTATATTTTCTCCAAGGGAAAACCTTTGGCCTCAAAAAAATCGGTCCCCCGAAGAGCAATGACCTAGGACATTTTTTTGTACCCC
  5   1   2       add Tad1                            IMAGE:6936668.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGCAGGTTTTACGTGGCTATGTGGAAGCAAATCACACAGACATACTGGGACACAACCCCTACAGTAGCTCAGGGCTACTCTGGCCTCTCAACAAGGTTGTGAACTCTACCTCTGGACCAGGGGAGCACCTACGAAATGCACTGTGGCACACAGGAAACACTCCCGGGCAGGTTCACACCTTATGGCATGATCCTCACCAAAAAGGCTGGAAAGATTTCACAGCTTACAGATGGCACCTGACACACAGACCAAAGACTGGTTTCATTAGAGTTGTCATGTATGAAGGCAAGAGAGTTATGGCCGACTCACGACCAATTTATGATAAAACATATGCTGGAGGAAGATTAGGATTGTTCGTCTTCTCACAAGAGATGGTCTTCTTTTCTGATCTCAAATACGAGTGCAGAGACTCATAATTCAGAATTTCTTCATTCCATGAATGTTAAGAGGATATCACGCACCTTCAGATATGTACCATCCTTTGGACCATTTCTTCCAttttttttttaaattttttGGAACAGATGATCTATTCCAAAAACCTGTAATTAAAGACAGACTTTAAGTAAAAAGAAGGAATATTTTCCTCAATGGGAAAACCTTTGGGCAAGAAAAAGATCTGCCCCCAATGGTAAGACttttttttAACCTCCCGGAAACTTTCATGGGAAAGAATTTTGCCAGGGAAAGGGAGAAATAGTAAATGGGTTTTTAAGGAAAAAAGTTAAACCTTTTCCTGCGGAAAACCCCCTTTGGATATATTCGCCGAAAAGCGCCACCAAGGAACAATTTTGGGAGGTGGCCTTTTCACTTCCCCTAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)