Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:4964557.3                       4 END     3          20       75                Unknown (protein for IMAGE:5047593) [Xenopus laevis]
     2   2.0    0Xl3.1-IMAGE:6643750.5                       4 END     1           6       25                LOC431908 protein [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-IMAGE:6643750.5                       4 PI      93          1      882                LOC431908 protein [Xenopus laevis]
     4   0.0    0Xl3.1-IMAGE:4964557.3                       4 PI      91       1246     1611                Unknown (protein for IMAGE:5047593) [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012776554 Xl3.1-IMAGE:4741050-IMAGp.5 - 15 ESTs
                                                                       ...-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:4741050-IMAGp.5                                                      TTAACAATGGCGACTTCCAACCCTAGCGGCAGCAGTGGAAGCAGTGCGGGCCTCGGATTCCAAGGGCAGTCTCAGCAACACAGCACAGTCAACAGCATGCAGGGCCTTCAGATAAACCTCTGTGACAATACACAAAGTAAACGCAAAGCACTGAAGCTGAATTTTGCCAACCCGGCCTTCAAATCGACAGCAAAATTCACACTGAACCCAACTATTCAGAGTACCCACGTGATGCACAAACTGGACGCCATCAGAAAACTTGAGACATCATACCAAAAACAGGATTTGCGGACGTCTGGCGCGAAGGCGTTGAGCACAAATGAACAGGCAACAAAAAACAGGCTAGAGAGGTTGCGGACACACAGTATTGAATCCTCTGGAAAATTAAAGCTGTCTCCAGAACAACATTGGGACTTCACAGCAGAAGACTTGAAGGACCTAGGGGAGATTGGCCGGGGAGCTTATGGCTCAGTTAATAAAATGAGTCATACTCCCAGTGGGCAGATTATGGCTGTTAAGAGGATTCGCTCCACAGTGGATGAGAAAGAACAGAAGCAGCTCCTCATGGATCTGGATGTGGTTATGCGGAGTAGTGACTGCCCGTACATAGTCCAGTTTTACGGAGCACTATTCAGAGAGGGTGACTGCTGGATCTGTATGGAGCTCATGGCTACCTCGTTCGACAAGTTTTACAAATATGTATATAGTTTTTTAGATGACGTTATTCCAGAGGAAATCCTAGGCAAAATCACTTTAGCGACTGTGAAAGCCTTAAATCACTTAAAAGAAAACTTGAAAATCATTCACAGAGACATCAAACCTTCCAATATTCTCCTGGACACAAATGGAAACATTAAACTCTGTGACTTTGGCATTAGCGGGCAGCTGGTGGATTCCATTGCCAAGACCAGAGATGCTGGGTGCAGACCTTACATGGCACCAGAAAGGATAGACCCAAGTGCGTCCAGACAAGGATATGACGTCCGGTCAGACGTGTGGAGCCTCGGGATCACGCTATATGAGTTGGCCACGGGCCGGTTTCCTTACCCCAAGTGGAACAGTGTATTTGATCAGCTGACGCAGGTTGTGAAAGGCGACCCCCCTCAGCTGAGCAATTCAGAAGAGAGGCAGTTCTCCCCGAGCTTCATCAGTTTCGTGAATCAGTGCCTTACCAAGGACGAGTCAAAAAGACCAAAATACAAAGAACTTTTGAAACACCCCTTTATCTTGATGTACGAAGAGCGCACAGTAGACGTGGCAGGGTATGTTGACAAAATCCTGGATCAGATACCAGCTTCCCCCAGCTCCCCGATGTACGTCGATTGACACAGCCCTCATGCGAACTTCTAGCGACAAGGGCTGCGAGTGAACCAAGACGCAGAGAGATTTCAACCCGCGACTGTCAGTGATCGCCTATTCTCCCTCGCTCCAGCGCCACGTGCAATAAGATCGGTGTTCGTTTAATTTCCCTTCCATCGTGTCTGTGTGCTACTGTCACATGTAAATCGCATCCCCCCTTCCTTTTAAAGAAACAGCTGGTCTCATGGGACACCTGTCTGGGTCAGTGGAACGGCCGCGTGTCCACACTCTATTCATAACTGGGTTGGGGGGGAGGGGAAT
                                                  Xl3.1-CHK-1012691665                                                            ATGGCGACTTCCAACCCTAGCGGCAGCAGTGGAAGCAGTGCGGGCCTCGGATTCCAAGGGCAGTCTCAGCAACACAGCACAGTCAACAGCATGCAGGGCCTTCAGATAAACCTCTGTGACAATACACAAAGTAAACGCAAAGCACTGAAGCTGAATTTTGCCAACCCGGCCTTCAAATCGACAGCAAAATTCACACTGAACCCAACTATTCAGAGTACCCACGTGATGCACAAACTGGACGCCATCAGAAAACTTGAGACATCATACCAAAAACAGGATTTGCGGACGTCTGGCGCGAAGGCGTTGAGCACAAATGAACAGGCAACAAAAAACAGGCTAGAGAGGTTGCGGACACACAGTATTGAATCCTCTGGAAAATTAAAGCTGTCTCCAGAACAACATTGGGACTTCACAGCAGAAGACTTGAAGGACCTAGGGGAGATTGGCCGGGGAGCTTATGGCTCAGTTAATAAAATGAGTCATACTCCCAGTGGGCAGATTATGGCTGTTAAGAGGATTCGCTCCACAGTGGATGAGAAAGAACAGAAGCAGCTCCTCATGGATCTGGATGTGGTTATGCGGAGTAGTGACTGCCCGTACATAGTCCAGTTTTACGGAGCACTATTCAGAGAGGGTGACTGCTGGATCTGTATGGAGCTCATGGCTACCTCGTTCGACAAGTTTTACAAATATGTATATAGTTTTTTAGATGACGTTATTCCAGAGGAAATCCTAGGCAAAATCACTTTAGCGACTGTGAAAGCCTTAAATCACTTAAAAGAAAACTTGAAAATCATTCACAGAGACATCAAACCTTCCAATATTCTCCTGGACACAAATGGAAACATTAAACTCTGTGACTTTGGCATTAGCGGGCAGCTGGTGGATTCCATTGCCAAGACCAGAGATGCCGGGTGCAGACCTTACATGGCACCAGAAAGGATAGACCCAAGTGCGTCCAGACAAGGATATGACGTCCGGTCAGACGTGTGGAGCCTCGGGATCACGCTATATGAGTTGGCCACGGGCCGGTTTCCTTACCCCAAGTGGAACAGTGTATTTGATCAGCTGACGCAGGTTGTGAAAGGCGACCCCCCTCAGCTGAGCAATTCAGAAGAGAGGCAGTTCTCCCCGAGCTTCATCAGTTTCGTGAATCAGTGCCTTACCAAGGACGAGTCAAAAAGACCAAAATACAAAGAACTTTTGAAACACCCCTTTATCTTGATGTACGAAGAGCGCACAGTAGACGTGGCAGGGTATGTTGACAAAATCCTGGATCAGATACCAGCTTCCCCCAGCTCCCCGATGTACGTCGATTGACACAGCCCTCATGCGAACTTCTAGCGACAAGGGCTGCGAGTGAACCAAGACGCAGAGAGATTTCAACCCGCGACTGTCAGTGATCGCCTATTCTCCCTCGCTCCAGCGCCACGTGCAATAAGATCGGTGTTCGTTTAATTTCCCTTCCATCGTGTCTGTGTGCTACTGTCACATGTAAATCGCATCCCCCCTTCCTTTTAAAGAAACAGCTGGTCTCATGGGACACCTGTCTGGGTCAGTGGAACGGCCGCGTGTCCACACTCTATTCATAACTGGGTTGGGGGGGAGGGGAATTAAAAA
                                                      consensus depths                                                           2     3     3     4     3     4     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     6     6     5     6     6     7     6     7     6     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     5     4     5     6     7     6     7     6     7     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     8     9     8     9     9     9     9     9     9     9     9     9     9     9     8     8     8     8     8     8     8     9     8     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     8     7     8     7     8     6     8     7     8     7     8     7     8     7     8     7     8     7     8     7     7     7     7     6     6     6     6     5     5     3     3     3     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --------T---
  5   1   2       bld Ov1                             IMAGE:5047593.5p GGCAGGTACACCGGGGGTTGCTGCATTGCAGCCTTCATTTGGTAGCTAATATATTAACAATGGCGACTTCCAACCCTAGCGGCAGCAGTGGAAGCAGTGCGGGCCTCGGATTCCAAGGGCAGTCTCAGCAACACAGCACAGTCAACAGCATGCAGGGCCTTCAGATAAACCTCTGTGACAATACACAAAGTAAACGCAAAGCACTGAAGCTGAATTTTGCCAACCCGGCCTTCAAATCGACAGCAAAATTCTCTCTGAACCCAACTATTCAGAGTACCCACGTGATGCACAAACTGGACGCCATCAGAAAACTTGAGACATCATACCAAAAACAGGATTTGCGGACGTCTGGCGCGAAGGCGTTGAGCACAAATGAACAGGCAACAAAAAACAGGCTAGAGAGGTTGCGGACACACAGTATTGAATCCTCTGGAAAATTAAAGCTGTCTCCAAAACAACATTGGGACTTCACAGCAGAAGACTTGAAGGACCTAGGGGAGATTGGCCGGGGAGCTTATGGCTCAGaaaaaaaa
  5   1   2      skin Brn1                   IMAGE:4741050-IMAGp.IMAGp                                          GTAGCGAATATATTAACAATGGCGACTTCCAACCCTAGCGGCAGCAGTGGAAGCAGTGCGGGCCTCGGATTCCAAGGGCAGTCTCAGCAACACAGCACAGTCAACAGCATGCAGGGCCTTCAGATAAACCTCTGTGACAATACACAAAGTAAACGCAAAGCACTGAAGCTGAATTTTGCCAACCCGGCCTTCAAATCGACAGCAAAATTCACACTGAACCCAACTATTCAGAGTACCCACGTGATGCACAAACTGGACGCCATCAGAAAACTTGAGACATCATACCAAAAACAGGATTTGCGGACGTCTGGCGCGAAGGCGTTGAGCACAAATGAACAGGCAACAAAAAACAGGCTAGAGAGGTTGCGGACACACAGTATTGAATCCTCTGGAAAATTAAAGCTGTCTCCAGAACAACATTGGGACTTCACAGCAGAAGACTTGAAGGACCTAGGGGAGATTGGCCGGGGAGCTTATGGCTCAGTTAATAAAATGAGTCATACTCCCAGTGGGCAGATTATGGCTGTTAAGAGGATTCGCTCCACAGTGGATGAGAAAGAACAGAAGCAGCTCCTCATGGATCTGGATGTGGTTATGCGGAGTAGTGACTGCCCGTACATAGTCCAGTTTTACGGAGCACTATTCAGAGAGGGTGACTGCTGGATCTGTATGGAGCTCATGGCTACCTCGTTCGACAAGTTTTACAAATATGTATATAGTTTTTTAGATGACGTTATTCCAGAGGAAATCCTAGGCAAAATCACTTTAGCGACTGTGAAAGCCTTAAATCACTTAAAAGAAAACTTGAAAATCATTCACAGAGACATCAAACCTTCCAATATTCTCCTGGACACAAATGGAAACATTAAACTCTGTGACTTTGGCATTAGCGGGCAGCTGGTGGATTCCATTGCCAAGACCAGAGATGCCG
  5   1   2       bld Sp1       out                   IMAGE:4964557.5p                                                 AATATATTAACAATGGCGACTTCCAACCCTAGCGGCAGCAGTGGAAGCAGTGCGGGCCTCGGATTCCAAGGGCAGTCTCAGCAACACAGCACAGTCAACAGCATGCAGGGCCTTCAGATAAACCTCTGTGACAATACACAAAGTAAACGCAAGCACTGAAGCTGAATTTTGCCAACCCGGCCTTCAAATCGACAGCAAAATTCACACTGAACCCAACTATTCAGAGTACCCACGTGATGCACAAACTGGACGCCATCAGAAAACTTGAGACATCATACCAAAAACAGGATTTGCGGACGTCTGGCGCGAAGGCGTTGAGCACAAATGAACAGGCAACAAAAAACAGGCTAGAGAGGTTGCGGACACACAGTATTGAATCCTCTGGAAAATTAAAGCTGTCTCCAGAACAACATTGGGACTTCACAGCAGAAGACTTGAAGGACCTAGGGGAGATTGGCCGGGGAGCTTATGGCTCAGTTAATAAAATGAGTCATACTCCCAGTGGGCAGATTATGGCTGTTAAGAGGATTCGCTCCACAGTGGATGAGAAA
  5   1   2      skin Brn1      out                   IMAGE:4741050.5p                                                                CGACTTCCAACCCTAGCGGCAGCAGTGGAAGCAGTGCGGGCCTCGGATTCCAAGGGCAGTCTCAGCAACACAGCACAGTCAACAGCATGCAGGGCCTTCAGATAAACCTCTGTGACAATACACAAAGTAAACGCAAAGCACTGAAGCTGAATTTTGCCAACCCGGCCTTCAAATCGACAGCAAAATTCACACTGAACCCAACTATTCAGAGTACCCACGTGATGCACAAACTGGACGCCATCAGAAAACTTGAGACATCATACCAAAAACAGGATTTGCGGACGTCTGGCGCGAAGGCGTTGAGCACAAATGAACAGGCAACAAAAAACAGGCTAGAGAGGTTGCGGACACACAGTATTGAATCCTCTGGAAAATTAAAGCTGTCTCCAGAACAACATTGGGACTTCACAGCAGAAGACTTGAAGGACCTAGGGGAGATTGGCCGGGGAGCTTATGGCTCAGTTAATAAAATGAGTCATACTCCCAGTGGGCAGATTATGGCTGTTAAGAGGATTCGCTCCACAGTGGATGAGAAAGAACAGAAGCAGCTCCTC
  5   1   2       bld Thy                             IMAGE:8546931.5p                                                                                CGAAATATTAACAATGGCGACTTCCAACCCTAGCGGCAGCAGTGGAAGCAGTGCGGGCCTCGGATTCCAAGGGCAGTCTCAGCAACACAGCACAGTCAACAGCATGCAGGGTAAACGCAAAGCACTGAAGCTGAATTTTGCCAACCCGGCCTTCAAATCGACAGCAAAATTCACACTGAACCCAACTATTCAGAGTACCCACGTGATGCACAAACTGGACGCCATCAGAAAACTTGAGACATCATACCAAAAACAGGATTTGCGGACGTCTGGCGCGAAGGCGTTGAGCACAAATGAACAGGCAACAAAAAACAGGCTAGAGAGGTTGCGGACACACAGTATTGAATCCTCTGGAAAATTAAAGCTGTCTCCAGAACAACATTGGGACTTCACAGCAGAAGACTTGAAGGACCTAGGGGAGATTGGCCGGGGAGCTTATGGCTCAGTTAATAAAATGAGTCATACTCCCAGTGGGCAGATTATGGCTGTTAAGAGGATTCGCTCCACAGTGGATGAGAAAGAACAGAAGCAGCTCCTCATGGATCTGGATGTGGTGATGCGGAGTAGTGACTGCCCGTACATAGTCCAGTTTTACGGAGCACTATTCAGAGAGGGTGACTGCTGGATCTGTATGGAGCTCATGGCTACCTCGTTCGACAAGTTTTACAAATATGTATATAGTTTTTAGAATGACGTATTCAGAGGAAATCTAGGCAAATCACTTAGCGACTGTGAGCCTAATCACTAAAAGAAACTGAATCTTCCAGAACTCAACCTCCATATCTCTGACACATGAACATAACTCGGACTGGATACGGCACTGTGATCATGCAGACAAAGCGTGAACTATGACCGAAGAACAGTGTCGCAGAGATCGC
  5   1   2       bld Lens                                Lens-R359.5p                                                                                                                                                                                                                                                                                                                                                                                                                              CCTCTTTAAGGAATCCTCTGGAAATTAAAGCTGTCTCCAGAACCTTTTTGGGACTTCACAGCAGAAGACTTGAAGGACCTAGGGGAGATTGGCCGGGGAGCTTATGGCTCAGTTAATAAAATGAGTCATACTCCCAGTGGGCAGATTATGGCTGTTAAGAGGATTCGCTCCACAGTGGATGAGAAAGAACAGAAGCAGCTCCTCATGGATCTGGATGTGGTTATGCGGAGTAGTGACTGCCCGTACATAGTCCAGTTTTACGGAGCACTATTCAGAGAGGGTGACTGCTGGATCTGTATGGAGCTCATGGCTACCTCGTTCGACAAGTTTTACAAATATGTATATAGTTTTTTAGATGACGTTATTCCAGAGGAAATCCTAGGCAAAATCACTTTAGCGACTGTGAAAGCCTTAAATCACTTAAAAGAAAACTTGAAAATCATTCACAGAGACATCAAACCTTCCAATATTCTCCTGGACACAAATGGAAACATTAAACTCTGTGACTTTGGCATTAGCGGGCAGCTGGTGGATTCCATTGCCAAGACCAGAGATGCCGGTTGCAGACCTTACATGGCACCCGAAAGGATAGACCCAAGTGCATCCAGGCAAGGATATGATGTCCGGTCCGATGTGTGGAGCCTTGGGATCACGCTATATGAGTTGGCTACGGGCCGGTTTCCATACCCCAAGTGGAACAGTGTATTTGATCAGCTGACACAGGTTGTGAAAGGGGACCCCCCTCAGCTGAGCAACTCGGAAGAGAGAGAGTTCTCCCCGAGCTTTACCAGTTTTGTGAATCAGTGCCTTACCCAGGACG
  5   1   2       bld Brn1      out                   IMAGE:6951214.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGACCGGTCCGGAATTTCCGGGATCTTGAAGGACTAGGGGAGATTGGCCGGGGAGCTTATGGCTCAGTTAATAAAATGAGTCATACTCCCAGTGGGCAGATTATGGCTGTTAAGAGGATTCGCTCCACAGTGGATGAGAAAGAACAGAAGCAGCTCCTCATGGATCTGGATGTGGTTATGCGGAGTAGTGACTGCCCGTACATAGTCCAGTTTTACGGAGCACTATTCAGAGAGGGTGACTGCTGGATCTGTATGGAGCTCATGGCTACCTCGTTCGACAAGTTTTACAAATATGTATATAGTTTTTTAGATGACGTTATTCCAGAGGAAATCCTAGGCAAAATCACTTTAGCGACTGTGAAAGCCTTAAATCACTTAAAAGAAAACTTGAAAATCATTCACAGAGACATCAAACCTTCCAATATTCTCCTGGACACAAATGGAAACATTAAACTCTGTGACTTTGGCATTAGCGGGCAGCTGGTGGATTCCATTGCCAAGACCAGAGATGCCGGTTGCAGACCTTACATGGCACCCGAAAGGATAGACCCAAGTGCATCCAGGCAAGGATATGATGTCCGGTCCGATGTGTGGAGCCTTGGGATCACGCTATATGAGTTGGCTACGGGCCGGTTTCCATACCCCAAGTGGAACAGTGTATTTGATCAGCTGACACAGGTTGTGAAAGGGGACCCCCCTCAGCTGAGCAACTCGGAAGAGAGAGAGTTCTCCCCGAGCTTTACCAGTTTTGTGAATCAGTGCCTTACCAAGGACGAGTCAAAAAGACCCAAATACAAAGAACTTTTTGAAACATCCCTTCCTCTTTGATGTTA
  5   1   2       bld Gas9                                 BG409520.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCACGCGTCCGATTAAACTCTGTGACTTTGGCATTAGCGGGCAGCTGGTGGATTCCATTGCCAAGACCAGAGATGCTGGGTGCAGACCTTACATGGCACCAGAAAGGATAGACCCAAGTGCGTCCAGACAAGGATATGACGTCCGGTCAGACGTGTGGAGCCTCGGGATCACGCTATATGAGTTGGCCACGGGCCGGTTTCCTTACCCCAAGTGGAACAGTGTATTTGATCAGCTGACGCAGGTTGTGAAAGGCGACCCCCCTCAGCTGAGCAATTCAGAAGAGAGGCAGTTCTCCCCGAGCTTCATCAGTTTCGTGAATCAGTGCCTTACCAAGGACGAGTCAAAAAGACCAAAATACAAAGAACTTTTGAAACACCCCTTTATCTTGATGTACGAAGAGCGCACAGTAGACGTGGCAGGGTATGTTGACAAAATCCTGGATCAGATACCAGCTTCCCCCAGCTCCCCGATGTACGTCGATTGACACAGCCCTCATGCGAACTTCTAGCGACAAGGGCTGCGAGTGAACCAAGACGCAGAGAGATTTCAACCCGCGACTGTCAGTGATCGCCTATTCTCCTTGCTCCAGCGCCACGTGCAATAAGATCGGNGTTCGTTTCATTTCCCTTNCATCGGGTCTGNGNGCTACTGCACATGTAAATCGCATCCCCCTTCTTTTAAAGAAACAGCTGGTCTCATGGGA
  5   1   2       bld DMZ       in                         xl308d16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGACTTTGGCATTAGCGGGCAGCTGGTGGATTCCATTGCCAAGACCAGAGATGCTGGGTGCAGACCTTACATGGCACCAGAAAGGATAGACCCAAGTGCGTCCAGACAAGGATATGACGTCCGGTCAGACGTGTGGAGCCTCGGGATCACGCTATATGAGTTGGCCACGGGCCGGTTTCCTTACCCCAAGTGGAACAGTGTATTTGATCAGCTGACGCAGGTTGTGAAAGGCGACCCCCCTCAGCTGAGCAATTCAGAAGAGAGGCAGTTCTCCCCGAGCTTCATCAGTTTCGTGAATCAGTGCCTTACCAAGGACGAGTCAAAAAGACCAAAATACAAAGAACTTTTGAAACACCCCTTTATCTTGATGTACGAAGAGCGCACAGTAGACGTGGCAGGGTATGTTGACAAAATCCTGGATCAGATACCAGCTTCCCCCAGCTCCCCGATGTACGTCGATTGACACAGCCCTCATGCGAACTTCTAGCGACAAGGGCTGCGAGTGAACCAAGACGCAGAGAGATTTCAACCCGCGACTGTCAGTGATCGCCTATTCTCCCTTGCTCCAGCGCCACGTGCAATAAGATCGGTGTTCGTTTCATTTCCCTTCCATCGTGTCTGTGTGCTACTGTCACATGTAAATCGCATCCCCCCTTCCTTTTAAAGAAACAGCTGGTCTCATGGGACACCTGTCTGGGTCAGTGGAACGGCCGCGTGTCCACACTCTATTCATAA
  3   1   2      seed DMZ       in                         xl308d16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGACTTTGGCATTAGCGGGCAGCTGGTGGATTCCATTGCCAAGACCAGAGATGCTGGGTGCAGACCTTACATGGCACCAGAAAGGATAGACCCAAGTGCGTCCAGACAAGGATATGACGTCCGGTCAGACGTGTGGAGCCTCGGGATCACGCTATATGAGTTGGCCACGGGCCGGTTTCCTTACCCCAAGTGGAACAGTGTATTTGATCAGCTGACGCAGGTTGTGAAAGGCGACCCCCCTCAGCTGAGCAATTCAGAAGAGAGGCAGTTCTCCCCGAGCTTCATCAGTTTCGTGAATCAGTGCCTTACCAAGGACGAGTCAAAAAGACCAAAATACAAAGAACTTTTGAAACACCCCTTTATCTTGATGTACGAAGAGCGCACAGTAGACGTGGCAGGGTATGTTGACAAAATCCTGGATCAGATACCAGCTTCCCCCAGCTCCCCGATGTACGTCGATTGACACAGCCCTCATGCGAACTTCTAGCGACAAGGGCTGCGAGTGAACCAAGACGCAGAGAGATTTCAACCCGCGACTGTCAGTGATCGCCTATTCTCCCTTGCTCCAGCGCCACGTGCAATAAGATCGGTGTTCGTTTCATTTCCCTTCCATCGTGTCTGTGTGCTACTGTCACATGTAAATCGCATCCCCCCTTCCTTTTAAAGAAACAGCTGGTCTCATGGGACACCTGTCTGGGTCAGTGGAACGGCCGCGTGTCCACA
  3   1   2       bld Oo1       out                   IMAGE:3403996.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTGATCAGCTACCCAGGTTGTAAAGCCGACCCCTTCAGGTGAGCAATTCAGAAGAGAGGCAGTTCTCCCCGAGCTTCATCAGTTTCGTGAATCAGTGCCTTACCAAGGACGAGTCAAATAGACCAAAATACAAAGAACTTTTGAAACACCCCTTTATCTTGATGTACGAAGAGCGCACAGTAGACGTGGCAGGGTATGTTGACAAAATCCTGGATCAGATACCAGCTTCCCCCAGCTCCCCGATGTACGTCGATTGACACAGCCCTCATGCGAACTTCTAGCGACAAGGGCTGCGAGTGAACCAAGACGCAGAGAGATTTCAACCCGCGACTGTCAGTGATCGCTTATTCTCCCTTGCTCCAGCGCCACGTGCAATAAGATCGGTGTTGGTTTAATTTCCCTTCCATCGGGTCTGTGTGCTACTGTCACATGTAAATCGCATCCCCCCTTCCTTTTAAAGAAACAGCTGGTCTCATGGGACACCTGTCTGGGTCAGTGGAACGGCCGCGTGTCCACACTCTATTCATAACTGGGTTGGGGGGGAGGGGAATTAAAAAAAAAA
  5   1   2       bld Egg1                               PBX0019C11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCGACCCCCCTCAGCTGAGCAATTCAGAAGAGAGGCAGTTCTCCCCGAGCTTCATCAGTTTCGTGAATCAGTGCCTTACCAAGGACGAGTCAAAAAGACCAAAATACAAAGAACTTTTGAAACACCCCTTTATCTTGATGTACGAAGAGCGCACAGTAGACGTGGCAGGGTATGTTGACAAAATCCTGGATCAGATACCAGCTTCCCCCAGCTCCCCGATGTACGTCGATTGACACAGCCCTCATGCGAACTTCTAGCGACAAGGGCTGCGAGTGAACCAAGACGCAGAGAGATTTCAACCCGCGACTGTCAGTGATCGCCTATTCTCCCTCGCTCCAGCGCCACGTGCAATAAGATCGGTGTTCGTTTAATTTCCCTTCCATCGTGTCTGTGTGCTACTGTCACATGTAAATCGCATCCCCCCTTCCTTTTAAAGAAACAGCTGGTCTCATGGGACACCTGTCTGGGTCAGTGGAACGGCCGCGTGTCCACACTCTATTCATAA
  5   1   2       bld Egg1                               PBX0020C11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCGACCCCCCTCAGCTGAGCAATTCAGAAGAGAGGCAGTTCTCCCCGAGCTTCATCAGTTTCGTGAATCAGTGCCTTACCAAGGACGAGTCAAAAAGACCAAAATACAAAGAACTTTTGAAACACCCCTTTATCTTGATGTACGAAGAGCGCACAGTAGACGTGGCAGGGTATGTTGACAAAATCCTGGATCAGATACCAGCTTCCCCCAGCTCCCCGATGTACGTCGATTGACACAGCCCTCATGCGAACTTCTAGCGACAAGGGCTGCGAGTGAACCAAGACGCAGAGAGATTTCAACCCGCGACTGTCAGTGATCGCCTATTCTCCCTCGCTCCAGCGCCACGTGCAATAAGATCGGTGTTCGTTTAATTTCCCTTCCATCGTGTCTGTGTGCTACTGTCACATGTAAATCGCATCCCCCCTTCCTTTTAAAGAAACAGCTGGTCTCATGGGACACCTGTCTGGGTCAGTGGAA
  5   1   2       bld Egg1                               PBX0020D11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCGACCCCCCTCAGCTGAGCAATTCAGAAGAGAGGCAGTTCTCCCCGAGCTTCATCAGTTTCGTGAATCAGTGCCTTACCAAGGACGAGTCAAAAAGACCAAAATACAAAGAACTTTTGAAACACCCCTTTATCTTGATGTACGAAGAGCGCACAGTAGACGTGGCAGGGTATGTTGACAAAATCCTGGATCAGATACCAGCTTCCCCCAGCTCCCCGATGTACGTCGATTGACACAGCCCTCATGCGAACTTCTAGCGACAAGGGCTGCGAGTGAACCAAGACGCAGAGAGATTTCAACCCGCGACTGTCAGTGATCGCCTATTCTCCCTCGCTCCAGCGCCACGTGCAATAAGATCGGTGTTCGTTTAATTTCCCTTCCATCGTGTCTGTGTGCTACTGTCACATGTAAATCGCATCCCCCCTTCCTTTTAAAGAAACAGCTGGTCTCATGGGACACCTGTCTGGGTCAGTGGAACGGCCGCGTGTCCACACTCTATTCATAACTTGGTTgggggggaggggAATTAAAAA
  5   1   2       bld Egg1                               PBX0118C12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGAAACACCCCTTTATCTTGATGTACGAAGAGCGCACAGTAGACGTGGCAGGGTATGTTGACAAAATCCTGGATCAGATACCAGCTTCCCCCAGCTCCCCGATGTACGTCGATTGACACAGCCCTCATGCGAACTTCTAGCGACAAGGGCTGCGAGTGAACCAAGACGCAGAGAGATTTCAACCCGCGACTGTCAGTGATCGCCTATTCTCCCTCGCTCCAGCGCCACGTGCAATAAGATCGGTGTTCGTTTAATTTCCCTTCCATCGTGTCTGTGTGCTACTGTCACATGTAAATCGCATCCCCCCTTCCTTTTAAAGAAACAGCTGGTCTCATGGGACACCTGTCTGGGTCAGTGGAACGGCCGCGTGTCCATACTCTATTCATAACTGGGTTgggggggaggggAATTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)