Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:8071674.5                      16 PI      91         14      452                (no blast hit)

 This cluster: approximate FL confidence score = 79%

 1012776556 Xl3.1-IMAGE:8527944.5 - 9 ESTs
                                                                       .........-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8527944.5                                        CGTCCCCTCGTGTCCAAGGAACAACATGTCTTTCGGTGCCATTAACAACCCTCCTGTTCCCTTTACATTGCCGCTATCCCACGGTCTCCATGATGGGTTTTTAGTGGTCATCAGTGGAGCTGTCACTCATTCAGGAGACAGGTTTAATATAAACTTTCAATGTGGTCATTCTTCGAATGATGACATTGCCTTTCATTTCAACCCCCGTTTTATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTCAGAGCTGGGGGAAAGAGGAAAACAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTAGTTACTAACCACAGTTATAATGTTTCTGTGAACAGGAATCATTACTTGGAATACCATCACCGAATCCCAATACAAAGAGTCAATACAATGACCATAGGTGGATGTGTTGCCTTAACATGTGTCAATGCACAAGGGCCCCAGCACCCTGGATATGCTCCTCAACCATTCCCACCTGGAGGTGCATTCAATCCACAGTTTCCCTCTGCTCCACATCAGCAACAATCTTATGCAATGCCATACCAAACTAATATCTATGGAGGTTTGTTTCCATCCAAGACGATTGTCATAAGAGGAACAGTTACTGCAAACCCAAAAAGGTTTCATATCAACCTCAAATTCCATGGTGGTACAGCATTACACTTCAACCCGAGGTTTGATGAGCGCACAATTGTACGAAACAGTCACCTTGAATGGCAGCTGGGGCAATGAAGAGCGCAATCTACAAGAGGGATGTGCTTTGCGCCAGGACAGAGCTTTGTGATTGAAATTAG
                                                  Xl3.1-CHK-1012696599                                              CTCGTGTCCAAGGAACAACATGTCTTTCGGTGCCATTAACAACCCTCCTGTTCCCTTTACATTGCCGCTATCCCACGGTCTCCATGATGGGTTTTTAGTGGTCATCAGTGGAGCTGTCACTCATTCAGGAGACAGGTTTAATATAAACTTTCAATGTGGTCATTCTTCGAATGATGACATTGCCTTTCATTTCAACCCCCGTTTTATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTCAGAGCTGGGGGAAAGAGGAAAACAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTAGTTACTAACCACAGTTATAATGTTTCTGTGAACAGGAATCATTACTTGGAATACCATCACCGAATCCCAATACAAAGAGTCAATACAATGACCATAGGTGGATGTGTTGCCTTAACATGTGTCAATGCACAAGGGCCCCAGCACCCTGGATATGCTCCTCAACCATTCCCACCTGGAGGTGCATTCAATCCACAGTTTCCCTCTGCTCCACATCAGCAACAATCTTATGCAATGCCATACCAAACTAATATCTATGGAGGTTTGTTTCCATCCAAGACGATTGTCATAAGAGGAACAGTTACTGCAAACCCAAAAAGGTTTCATATCAACCTCAAATTCCATGGTGGTACAGCATTACACTTCAACCCGAGGTTTGATGAGCGCACAATTGTACGAAACAGTCACCTxxAxxGGCAGCTGGGGCAATGAAGAGCGCAATCTACAAGAGGGATGTGCTTTGCGCCAGGACAGAGCTTTGTGATTGAAATTAGATGTGA
                                                      consensus depths                                             2     3     4     5     4     5     5     6     5     6     6     7     6     7     6     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     7     8     7     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     8     7     8     7     8     7     8     7     8     6     8     7     8     7     8     5     8     4     8     4     8     4     8     2     8     2     7     2     7     2     7     2     7     2     7     2     7
                                               BLH ATG      25     170                                        
                                               BLH MIN      25      76                                        
                                               BLH OVR      25      46                                        
                                               EST CLI     -39      18                                        
                                               ORF LNG      25       1                                        
  5   1   2       bld Int2 5g                         IMAGE:8821124.5p CCCAACCGCCTAGGTCCGTACGccccccccccTCTTATTCGTCCCCTCGTGTCCAAGGAACAACATGTCTTTCGGTGCCATTAACAACCCTCCTGTTCCCTTTACATTGCCGCTATCCCACGGTCTCCATGATGGGTTTTTAGTGGTCATCAGTGGAGCTGTCACTCATTCAGGAGACAGGTTTAATATAAACTTTCAATGTGGTCATTCTTCGAATGATGACATTGCCTTTCATTTCAACCCCCGTTTTATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTCAGAGCTGGGGGAAAGAGGAAAACAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTAGTTACTAACCACAGTTATAATGTTTCTGTGAACAGGAATCATTACTTGGAATACCATCACCGAATCCCAATACAAAGAGTCAATACAATGACCATAGGTGGATGTGTTGCCTTAACATGTGTCAATGCACAAGGGCCCCAGCACCCTGGATATGCTCCTCAACCATTCCCACCTGGAGGTGCATTCAATCCACAGTTTCCCTCTGCTCCACATCAGCAACAATCTTATGCAATGCCATACCAAACTAATATCTATGGAGGTTTGTTTCCATCCAAGACGATTGTCATAAGAGGAACAGTTACTGCAAACCCAAAAAGGTTTCATATCAACCTCAAATTCCATGGTGGTACAGCATTACACTTTCAACCCGAGGTTTGATGAGCGCACAATTGTACGAAACAGTCACCTGAATGGCAGCTGGGGCAATGAAGAGCGCAATCTACCAGAGGATGTGCTTTGCGCCAAGGACAGGGCTTTGTGATGAAATAGATGTGAGCACACCGCATTCAGGTGAATGTGATGGCAGCCAAACATGGTGAATTTTCTTCACG
  5   1   2       bld Int2 5g                         IMAGE:8821526.5p    CCCCCCTGAATGCCACAGGACCCAACAAAAACGATTCGTCCCCTCGTGTCCAAGGAACAACATGTCTTTCGGTGCCATTAACAACCCTCCTGTTCCCTTTACATTGCCGCTATCCCACGGTCTCCATGATGGGTTTTTAGTGGTCATCAGTGGAGCTGTCACTCATTCAGGAGACAGGTTTAATATAAACTTTCAATGTGGTCATTCTTCGAATGATGACATTGCCTTTCATTTCAACCCCCGTTTTATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTCAGAGCTGGGGGAAAGAGGAAAACAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTAGTTACTAACCACAGTTATAATGTTTCTGTGAACAGGAATCATTACTTGGAATACCATCACCGAATCCCAATACAAAGAGTCAATACAATGACCATAGGTGGATGTGTTGCCTTAACATGTGTCAATGCACAAGGGCCCCAGCACCCTGGATATGCTCCTCAACCATTCCCACCTGGAGGTGCATTCAATCCACAGTTTCCCTCTGCTCCACATCAGCAACAATCTTATGCAATGCCATACCAAACTAATATCTATGGAGGTTTGTTTCCATCCAAGACGATTGTCATAAGAGGAACAGTTACTGCAAACCCAAAAAGGTTTCATATCAACCTCAAATTCCATGGTGGTACAGCATTACACTTCAACCCGAGTTTGATGAGCGCACAATTGTACGAAACAGTCACCTGATGGCAGCTGGGGCATGAGAGCGCATCTACAGGAGGATGTGCTTTGCGCAGACAGGCTTTGTGATGAATAGATGTGAGCCACCGCAATCCAGTGATGTGATGGAGCCCAACATGTGAATTCATCACCGCGGTGCATCAGTTCACGCGA
  5   1   2       bld Int2 5g                         IMAGE:8823264.5p                           CAAGCGGTATaaaaaaaaaaacaaaaaaaaaaaaTTCGTCCCGTCTTTCGGTGCAATTAAAAACCCTCCTGCTTTAAAAATAAAAGCCGCTATCCCAGGTCTCATGATGGGTTTTTAATGGAATCAATGGAGCTGTCACTCATTCAGGAGACAGGTTTAATATAAACTTTCAATGTGGTCATTCTTCCAATGATGACATTGCCTTTCATTTCAACCCCCGTTTTATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTCAGAGCTGGGGGAAAGAGGAAAACAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTAGTTACTAACCACAGTTATAATGTTTCTGTGAACAGGAATCATTACTTGGAATACCATCACCGAATCCCAATACAAAGAGTCAATACACTTACCATAGGTGGATGTGTTGCCTTAACATGTGTCAATGCACAAGGGCCCCAGCACCCTGGATATGCTCCTCAACCATTCCCACCTGGAGGTGCATTCAATCCACAGTTTCCCTCTGCTCCACATCAGCAACAATCTTATGCAATGCCATACCAAACTAATATCTATGGAGGTTTTGTTTCCATCCAAGACGATTGTCATAAGAGGAACAGTTACTGCAAACCCAAAAAGGTTTCATATCAACCTCAAATTCCATGGTGGTACGGCATTACACTTCATCCCGAGGTTTGATGAGCGCACAATTGTACAAAACATTCACCTGAATGGCAGCTGGGGCAATGAAGAGCGCAATCTACAAGAGGGATGTGCTTTGCGCCAGGAACGAGCTTTGTGATTGAAATTAGATGTGGAGCCACCACGCTTTCCAGGTGAAACGTGAAATGGAGCCCAACATGGAGAAATTCATCAACCGGCGGTGCATCATTTTCAGCAGATTGAACCCCGTTGCCTGATTGACAGGAAAAGGTTGGTCCTACACACCATGTGGTGACTGCA
  5   1   2       bld Int2 5g                         IMAGE:8529936.5p                                               CTCGTGTCCAGGAACAACATGTCTTTCGGTGCCATTAACAACCCTCCTGTTCCCTTTACATTGCCGCTATCCCACGGTCTCCATGATGGGTTTTTAGTGGTCATCAGTGGAGCTGTCACTCATTCAGGAGACAGGTTTAATATAAACTTTCAATGTGGTCATTCTTCGAATGATGACATTGCCTTTCATTTCAACCCCCGTTTTATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTCAGAGCTGGGGGAAAGAGGAAAACAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTAGTTACTAACCACAGTTATAATGTTTCTGTGAACAGGAATCATTACTTGGAATACCATCACCGAATCCCAATACAAAGAGTCAATACAATGACCATAGGTGGATGTGTTGCCTTAACATGTGTCAATGCACAAGGGCCCCAGCACCCTGGATATGCTCCTCAACCATTCCCACCTGGAGGTGCATTCAATCCACAGTTTCCCTCTGCTCCACATCAGCAACAATCTTATGCAATGCCATACCAAACTAATATCTATGGAGGTTTGTTTCCATCCAAGACGATTGTCATAAGAAGAACAGTTACTGCAAACCCAAAAAGGTTTCATATCAACCTCNAATTCCATGGTGGTACAGCATTACACTTCAACCGAGGTTGATGAGCGCACATTGTACGAACAGTCACTGAATGCAGCTGGGCATGAAGACGCATCTACAAGAGGATTGCTTGCGCCAGAAGGCTTGTGATGAATAGAGTACACAGCATCAGTGATGGATGACC
  5   1   2      seed Int2 5g                         IMAGE:8527051.5p                                                 CGTGTCCAGGAACAACATGTCTTTCGGTGCCATTAACAACCCTCCTGTTCCCTTTACATTGCCGCTATCCCACGGTCTCCATGATGGGTTTTTAGTGGTCATCAGTGGAGCTGTCACTCATTCAGGAGACAGGTTTAATATAAACTTTCAATGTGGTCATTCTTCGAATGATGACATTGCCTTTCATTTCAACCCCCGTTTTATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTCAGAGCTGGGGGAAAGAGGAAAACAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTAGTTACTAACCACAGTTATAATGTTTCTGTGAACAGGAATCATTACTTGGAATACCATCACCGAATCCCAATACAAAGAGTCAATACAATGACCATAGGTGGATGTGTTGCCTTAACATGTGTCAATGCACAAGGGCCCCAGCACCCTGGATATGCTCCTCAACCATTCCCACCTGGAGGTGCATTCAATCCACAGTTTCCCTCTGCTCCACATCAGCAACAATCTTATGCAATGCCATACCAAACTAATATCTATGGAGGTTTGTTTCCATCCAAGACGATTGTCATAAGAGGAACAGTTACTGCAAACCCAAAAAGGTTTCATATCAACCTNCAATTCCATGGTGGTACAGCATTACACTTCAACCCGAGGTTTGATGAGCGCACAATTGTACGAAACAGTCACCTGAATGGCAGCTGGGGCA
  5   1   2       bld Int2                            IMAGE:8527944.5p                                                                   GTCTTTCGGTGCCATTAACAACCCTCCTGTTCCCTTTACATTGCCGCTATCCCACGGTCTCCATGATGGGTTTTTAGTGGTCATCAGTGGAGCTGTCACTCATTCAGGAGACAGGTTTAATATAAACTTTCAATGTGGTCATTCTTCGAATGATGACATTGCCTTTCATTTCAACCCCCGTTTTATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTCAGAGCTGGGGGAAAGAGGAAAACAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTAGTTACTAACCACAGTTATAATGTTTCTGTGAACAGGAATCATTACTTGGAATACCATCACCGAATCCCAATACAAAGAGTCAATACAATGACCATAGGTGGATGTGTTGCCTTAACATGTGTCAATGCACAAGGGCCCCAGCACCCTGGATATGCTCCTCAACCATTCCCACCTGGAGGTGCATTCAATCCACAGTTTCCCTCTGCTCCACATCAGCAACAATCTTATGCAATGCCATACCAAACTAATATCTATGGAGGTTTGTTTCCATCCAAGACGATTGTCATAAGAGGAACAGTTACTGCAAACCCAAAAAGGTTTCATATCAACCTCAAATTCCATGGTGGTACAGCATTACACTTCAACCCGAGGTTTGATGAGCGCACAATTGTACGAAACAGTCACCTGAATGCAGCTGGGGCATGAGAGCGCATCTAACAGAAGGAGTGCTTTGCGCAGACAGGCTTGTGATGAATTAGATTNACACCGCATTCAGTGATGGATGGAGCAACTGTGATTCTCCGCNGCTCATTCA
  5   1   2       bld Int2                            IMAGE:8527593.5p                                                                                           TCCTGTTCCCTTTACATTGCCGCTATCCCACGGTCTCCATGATGGGTTTTTAGTGGTCATCAGTGGAGCTGTCACTCATTCAGGAGACAGGTTTAATATAAACTTTCAATGTGGTCATTCTTCGAATGATGACATTGCCTTTCATTTCAACCCCCGTTTTATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAGCGTCAGAGCTGGGGGAAAGAGGAAAACAAGCGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTAGTTACTAACCACAGTTATAATGTTTCTGTGAACAGGAATCATTACTTGGAATACCATCACCGAATCCCAATACAAAGAGTCAATACAATGACCATAGGTGGATGTGTTGCCTTAACATGTGTCAATGCACAAGGGCCCCAGCACCCTGGATATGCTCCTCAACCATTCCCACCTGGAGGTGCATTCAATCCACAGTTTCCCTCTGCTCCACATCAGCAACAATCTTATGCAATGCCATACCAAACTAATATCTATGGAGGTTTGTTTCCATCCAAGACGATTGTCATAAGAGGAACAGTTACTGCAAACCCAAAAAGGTTTCATATCAACCTCAAATTCCATGGTGGTACAGCATTACACTTNCACCCGAGGTTTGATGAGCGCACAATTGTACGAAACAGTCACCTGAATGCAGCTGGNNGCATGAGAGCGCATCTACCAGAGGGAGTGCTTGCGCCAGACAGGCTTGTGATGAATTGATGTGACACCGCATCAAGTGAGTGATGAGCCAACTGTGATTCTCACGCTGCTATTCACAATGACCTGGATGAGAAGTGCTAACT
  5   1   2       add Int2                            IMAGE:8527640.5p                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGGGGNNCCATGTGCANNNGAGAAACATCGATACAATTCGTCCCGGATGTGTTGCCTTAACATGTGTCAATGCACAAGGGCCCCAGCACCCTGGATATGCTCCTCAACCATTCCCACCTGGAGGTGCATTCAATCCACAGTTTCCCTCTGCTCCACATCAGCAACAATCTTATGCAATGCCATACCAAACTAATATCTATGGAGGTTTGTTTCCATCCAAGACGATTGTCATAAGAGGAACAGTTACTGCAAACCCAAAAAGGTTTCATATCAACCTCAAATTCCATGGTGGTACAGCATTACACTTCAACCCGAGGTTTGATGAGCGCACAATTGTACGAAACAGTCACCTGAATGGCAGCTGGGGCAATGAAGAGCGCAATCTACCAAGAGGGATGTGCTTTGCGCCAGGACAGAGCTTTGTGATTGAAATTAGATGTGAGCAACACGCATTCAAGGTGAATGTGAATGGAGCCCAAACATGTGAATTTCATCACCGCGTGCATCAGTTTCAGCAGATAGACACCTTGCAGATTGACGGAGATGTTGTCCTACAACATGTGCAGGTCTAGGAGTGGATGAACCATAGAAAAATTTAAATATATGACTTTCTTTTCATATGATCTTGCTTTGAAACAATTTAGTTAATTTTTATATAGAGTCTGGTATTGGAGCAAAACCTACTTGACCTGTAGAATTTTATGGGGATGTAGTAACGACACAAGTTTTCACCAGTCTACTAACCATAGCACTATTANGGTATGCTTCAAAAGTAATACACCTCTGATGGTGCTATGCTACAGACACTNAATGTGCACTTTATGCACATTATTTCAGAGATGATATGCTGACTGAATCCTATCTAACAGTGAGCACACAATGCTCATAGTGTCTCC
  3   1   0       add Int2                            IMAGE:8822099.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCATACATGTCCAAGGTCTAAGAATGGGATGAATCATGGAAATGATATTAGACCTCTTCATTGAATCCTGCTTGGAAACAATTAGTTAATTTATATAAAGTCGTATGAGCAAAACTACTGACTGTAGATTTTATGGGAATGTAGTAACGAACACAAAGTTTTCACCAGGTCTTACTAACCCATAGCAACTAATAGGGTATGCTTCAAACAGTAAATACTACTTCTGATTGGTTGCTATGGCTTACCAGAACACTTAAAATGTGCTACTTTTATGCATCATTTAATTTCAGGAGGTATTGATTATTGCGTGAACTGAATATCACTTTATTTCATAAACAGTATGAATGTGAGCCACCATATTGCTTCCAGTAAAGTGGTCGTTCACCTTGATATTAACTTCTAGTATGAAGTGGACAGCAATATTCTGAGACACTTTTTTTTTATTAAGCTTTTTTTTAGTTTAGAATTTCAGCAGCTATCTAAGAGCCACTTTATCTCATCTACCAAGCAGTGGTTTCAATGAGATACTTAAATAAGGATTGAGAAGGCTCTGAATAGAAAGAGTAAGTAATAAAAAGTAACATAGCAATAGTCTTTTTTGATGCCTGGGATCAGATCAGTGACTTCTATTTAAAAACAGCAAAAAGAAAGTAGACAAAGGTAAATGAAGACCAATTGAAAAGTTGCCCGGAATAGGTAATTCTTTGAAAAGGTAAATAACCGTATTAACTGCAGTCATCCTGTCACCTTTCCGTTGTTCTTATTAATAAGAACAGAACGGGAATATTGAACACCTTATTGCATTTGCAAACATTTCAAGACATGTCAGTTTCCTACCATATCATAAGACTAAAGCTATGTTACTTTTGGAACCCACTCTTTCTAGGCTGAGCCATCTCTCTCCTTATTAAAGTATCCCATAGAAACCACTGCTTGGTAGATGAGATAAAGTGCTCTTAGATAGCTGGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)