Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xl338n15.5                           10 END     5          50       50                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6865351.5                      54 PI      76         42      404                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012776803 Xl3.1-xl263h16.3 - 10 ESTs
                                                                       .-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl263h16.3                                                    CGAACAAGATTTGGGTGCTTCTCTGCCAGCTGAGTACACACGCACACACATGCTATCATCCTTATTTCCTTATGAACTTGTACCAAAGTGTAATAGTTGATGTGCTGATTGGCCTTACTTGTATTTGCCCCTTTTAACCCAGCTTTGGAAAGAAGGATGATTAAATATTTTAAAGGGGAAGTTACCCTTTAATTTAAGTTTAGTATGATACATGCTGATATAATCCGTGCAACTATGCAGTCTTTTTTTTTGTGGTTTTTATTGCGAGGCAGGTTTTTCAGTATTGCTAACATATAAATATATAATATAAAACACAAAACAGTAAAAAGGACAATTTCAAATTTTTGCCTGTTGGTTGTTTGGAGAGCTGATGATCTCTGCAGTGCTCACTCTAATCAAAGGAACCCTGGACAATGGGGCTCCGTAGTCCAGGATAGTGCCAGTGGCCCTTGAATTAGTGCTTTGGCTACAGAATAGCTGTTGAGTAAAGTAATGGTTTTTTTTGTTTTTATTTTGGAGATTGAATGTGATTGGTTGACAAATCACGTGACAAACAGGGATAGTAAAAGATGACAGATTCTGGGCTCTCTCAGTGTGATCCCTTGTGCTTTGTACCCTCACTGTCTGCTGGATCTCCCCCAGTACCAGGGGCAAAGAGTGACTCTTTGTTGTGTAATTTTTGTTGTTTGTTGCTGCAGAGCAGGAGCCGCATTCGGTCGTACTGAAATGTGAAGAGAAATAAACCTATTTAATATT
                                                  Xl3.1-CHK-1012696417                                                          AGATTTGGGTGCTTCTCTGCCAGCTGAGTACACACGCACACACATGCTATCATCCTTATTTCCTTATGAACTTGTACCAAAGTGTAATAGTTGATGTGCTGATTGGCCTTACTTGTATTTGCCCCTTTTAACCCAGCTTTGGAAAGAAGGATGATTAAATATTTTAAAGGGGAAGTTACCCTTTAATTTAAGTTTAGTATGATACATGCTGATATAATCCGTGCAACTATGCAGTCTTTTTTTTTGTGGTTTTTATTGCGAGGCAGGTTTTTCAGTATTGCTAACATATAAATATATAATATAAAACACAAAACAGTAAAAAGGACAATTTCAAATTTTTGCCTGTTGGTTGTTTGGAGAGCTGATGATCTCTGCAGTGCTCACTCTAATCAAAGGAACCCTGGACAATGGGGCTCCGTAGTCCAGGATAGTGCCAGTGGCCCTTGAATTAGTGCTTTGGCTACAGAATAGCTGTTGAGTAAAGTAATGGTTTTTTTTGTTTTTATTTTGGAGATTGAATGTGATTGGTTGACAAATCACGTGACAAACAGGGATAGTAAAAGATGACAGATTCTGGGCTCTCTCAGTGTGATCCCTTGTGCTTTGTACCCTCACTGTCTGCTGGATCTCCCCCAGTACCAGGGGCAAAGAGTGACTCTTTGTTGTGTAATTTTTGTTGTTTGTTGCTGCAGAGCAGGAGCCGCATTCGGTCGTACTGAAATGTGAAGAGAAATAAACCTATTT
                                                      consensus depths                                                         2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     3     4     3     4     3     5     3     6     3     7     3     7     3     7     3     7     3     7     3     7     3     7     3     7     6     7     7     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10    10    10    10     9    10    10    10    10    10    10    10    10    10     8    10    10    10     9    10     9     9     9     9     8     9     9     9     8     9     9     9     9     9     9     9     8     9     8     8     8     8     8     8     8     8     7     8     8     8     6     7     6     7     5     6     5     5     5     5     3     3     3     3     3     3     3     3
                                                      Xl3.1-xl263h16.3                                                                                  TGA---------------------------------------TGA---------------TAATAG---ATG---TGA------------------------------------------------ATG------------------------------TAA------------ATG---------------------------ATG---------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------TAG---------------ATG---------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------ATGTGA
  3   1   2       bld DMZ  5g3  out                        xl263h16.3p TGCATGGGGTGGCATTACAACCAGCTGCACGGTCACCTATTTCCTTTAAAGCGAACAAGATTTGGGTGCTTCTCTGCCAGCTGAGTACACACGCACACACATGCTATCATCCTTATTTCCTTATGAACTTGTACCAAAGTGTAATAGTTGATGTGCTGATTGGCCTTACTTGTATTTGCCCCTTTTAACCCAGCTTTGGAAAGAAGGATGATTAAATATTTTAAAGGGGAAGTTACCCTTTAATTTAAGTTTAGTATGATACATGCTGATATAATCCGTGCAACTATGCAGTCTTTTTTTTTGTGGTTTTTATTGCGAGGCAGGTTTTTCAGTATTGCTAACATATAAATATATAATATAAAACACAAAACAGTAAAAAGGACAATTTCAAATTTTTGCCTGTTGGTTGTTTGGAGAGCTGATGATCTCTGCAGTGCTCACTCTAATCAAAGGAACCCTGGACAATGGGGCTCCGTAGTCCAGGATAGTGCCAGTGGCCCTTGAATTAGTGCTTTGGCTACAGAATAGCTGTTGAGTAAAGTAATGGTTTTTTTTGTTTTTATTTTGGAGATTGAATGTGATTGGTTGACAAATCACGTGACAAACAGGGATAGTAAAAGATGACAGATTCTGGGCTCTCTCAGTGTGATCCCTTGTGCTTTGTACCCTCACTGTCTGCTGGATCTCCCCCAGTACCAGGGGCAAAGAGTGACTCTTTGTTGTGTAATTNTTGTTGTTTGTNGCTGCAGAGCAGGAGCCGCAT
  5   1   2       bld Ga15      in                       XL412d21ex.5p                            CGGTCACCTATTTCCTTTTAAAGCGAACAAGATTTGGGTGCTTCTCTGCCAGCTGAGTACACACGCACACACATGCTATCATCCTTATTTCCTTATGAACTTGTACCAAAGTGTAATAGTTGATGTGCTGATTGGCCTTACTTGTATTTGCCCCTTTTAACCCAGCTTTGGAAAGAAGGATGATTAAATATTTTAAAGGGGAAGTTACCCTTTAATTTAAGTTTAGTATGATACATGCTGATATAATCCGTGCAACTATGCAGTCttttttttttGNGGTTTTTATTGCGAGGCAGGTTTTTCAGTATTGCTAACatataaatatataatataaaacacaaaacagtaaaaaGGACAATTTCAAATTTTTGCCTGTTGGTTGTTTGGANAGCTGATGATCTCTGCAGNGCTCACTCTAATCAAAGGAACCCTGGACAANGGGGCTCCGTAGTCCAGGATAGNGCCAGNGGCCCTTGAATTAGNGCTTTGGCTACANAATAGCTGTTGAGTAAAGTAANGGttttttttgtttttattttGGANATTGAATGNGATTGGTTGACAAATCACGTGACAAACAGGGATAGTAAAANATGACAGATTCTGGGCTCTCTCAGNGTGATCCCTTGNGCTTTGTACCCNCACTGTCTGCTGGATCNCCCCCAGTACCAGGGGCAAAG
  3   1   2       bld DMZ  5g3  out                        xl338n15.3p                                            TTTTAAAGCGAACAAGATTTGGGTGCTTCTCTGCCAGCTGAGTACACACGCACACACATGCTATCATCCTTATTTCCTTATGAACTTGTACCAAAGTGTAATAGTTGATGTGCTGATTGGCCTTACTTGTATTTGCCCCTTTTAACCCAGCTTTGGAAAGAAGGATGATTAAATATTTTAAAGGGGAAGTTACCCTTTAATTTAAGTTTAGTATGATACATGCTGATATAATCCGTGCAACTATGCAGTCTTTTTTTTTGTGGTTTTTATTGCGAGGCAGGTTTTTCAGTATTGCTAACATATAAATATATAATATAAAACACAAAACAGTAAAAAGGACAATTTCAAATTTTTGCCTGTTGGTTGTTTGGAGAGCTGATGATCTCTGCAGTGCTCACTCTAATCAAAGGAACCCTGGACAATGGGGCTCCGTAGTCCAGGATAGTGCCAGTGGCCCTTGAATTAGTGCTTTGGCTACAGAATAGCTGTTGAGTAAAGTAATGGTTTTTTTTGTTTTTATTTTGGAGATTGAATGTGATTGGTTGACAAATCACGTGACAAACAGGGATAGTAAAAGATGACAGATTCTGGGCTCTCTCAGTGTGATCCCTTGTGCTTTGTACCCTCACTGTCTGCTGGATCTCCCCCAGTACCAGGGGCAAAGAGTGACTCTCNGTTGTGTAA
  3   1   2       bld DMZ  5g3  out                        xl269i01.3p                                                                                                                               ACTTGTACCAAAGTGTAATAGTTGATGTGCTGATTGGCCTTACTTGTATTTGCCCCTTTTAACCCAGCTTTGGAAAGAAGGATGATTAAATATTTTAAAGGGGAAGTTACCCTTTAATTTAAGTTTAGTATGATACATGCTGATATAATCCGTGCAACTATGCAGTCTTTTTTTTTGTGGTTTTTATTGCGAGGCAGGTTTTTCAGTATTGCTAACATATAAATATATAATATAAAACACAAAACAGTAAAAAGGACAATTTCAAATTTTTGCCTGTTGGTTGTTTGGAGAGCTGATGATCTCTGCAGTGCTCACTCTAATCAAAGGAACCCTGGACAATGGGGCTCCGTAGTCCAGGATAGTGCCAGTGGCCCTTGAATTAGTGCTTTGGCTACAGAATAGCTGTTGAGTAAAGTAATGGTTTTTTTTGTTTTTATTTTGGAGATTGAATGTGATTGGTTGACAAATCACGTGACAAACAGGGATAGTAAAAGATGACAGATTCTGGGCTCTCTCAGTGTGATCCCTTGTGCTTTGTACCCTCACTGTCTGCTGGATCTCCCCCAGTACCAGGGGCAAAGAGTGACTCTTTGTTGTGTAATTTTTGTTGTTTGTTGCTGCAGAGCAGGAGCCGCA
  5   1   2       bld Tbd7      out                        XL070k22.5p                                                                                                                                                                          CGGGCTGCAGGCTTTTAACCNGCTTTGGAAAGAAGGATGATTAAATATTTTAAAGGGGAAGTTACCCTTTAATTTAAGTTTAGTATGATACATGCTGATATAATCCGTGCAACTATGCAGTCtttttttttttGGGGTTTTTATTGCNAGGCAGGTTTTTCAGTNTTGCTAACatataaatatataatataaaacacaaaacagtaaaaNGGACAATTTCAAATTTTTGCCTGTTGGTTGTTTGGANAGCTGATGATCTNTGCAGNGCTCACTNTAATCAAAGGAACCCTGGACAATGGGGCTCCGTAGTCCAGGATAGNGCCAGNGGCCCTTGAATTAGNGCTTTGGCT
  3   1   2       bld Egg2                            IMAGE:5162464.3p                                                                                                                                                                                   TTTAACCCAGCTTTGGAAAGAAGGATGATTAAATATTTTAAAGGGGAAGTTACCCTTTAATTTAAGTTTAGTATGATACATGCTGATATAATCCGTGCAACTATGCAGTCTTTTTTTTTTTTTTGTGGTTTTTATTGCGAGGCAGGTTTTTCAGTATTGCTAACATATAAATATATAATATAAAACACAAAACAGTAAAAAGGACAATTTCAAATTTTTGCCTGTTGGTTGTTTGGAGAGCTGATGATCTCTGCAGTGCTCACTCTAATCAAAGGAACCCTGGACAATGGGGCTCCGTAGTCCAGGATAGTGCCAGTGGCCCTTGAATTAGTGCTTTGGCTACAGAATAGCTGTTGAGTAAAGTAATGGTTTTTTTTGTTTTTATTTTGGAGATTGAATGTGATTGGTTGACAAATCACGTGACAAACAGGGATAGTAAAAGATGACAGATTCTGGGCTCTCTCAGTGTGATCCCTTGTGCTTTGTACCCTCACTGTCTGCTGGATCTCCCCCAGTACCAGGGGCAAAGAGTGACTCTTTGTTGTGTAATTTTTGTTGTTTGTTGCTGCAGAGCAGGAGCCGCATTCGGTCGTACTGAAATGTGAAGAGAAATAAACCTATTTAATATT
  3   1   2       bld Emb1 5g3  out                   IMAGE:3402954.3p                                                                                                                                                                                                  GAAAGAAGGATGATTAAATATTTTAAAGGGGAAGTTACCCTTTAATTTAAGTTTAGTATGATACATGNTGATATAATCCGTGCAACTATGCAGTCTTTTTTTTTTTTTTGTGGTTTTTATTGCGAGGCAGGTTTTTCAGTATTGCTAACATATAAATATATAATATAAAACACAAAACAGTAAAAAGGACAATTTCAAATTTTTGCCTGTTGGTTGTTTGGAGAGCTGATGATCTCTGCAGTGCTCACTCTAATCAAAGGAACCCTGGACAATGGGGCTCCGTAGTCCAGGATAGTGCCAGTGGCCCTTGAATTAGTGCTTTGGCTACAGAATAGCTGTTGAGTAAAGTAATGGTTTTTTTTGTTTTTATTTTGGAGATTGAATGTGATTGGTTGACAAATCACGTGACAAACAGGGATAGTAAAAATTCTTTTTA
  3   1   2      seed Ooc1                             Ooc1-db33c05.x1                                                                                                                                                                                                                                                                                                         TTTTTTGTGGTTTTTATTGCGAGGCAGGTTTTTCAGTATTGCTAACATATAAATATATAATATAAAACACAAAACAGTAAAAAGGACAATTTCAAATTTTTGCCTGTTGGTTGTTTGGAGAGCTGATGATCTCTGCAGTGCTCACTCTAATCAAAGGAACCCTGGACAATGGGGCTCCGTAGTCCAGGATAGTGCCAGTGGCCCTTGAATTAGTGCTTTGGCTACAGAATAGCTGTTGAGTAAAGTAATGGTTTTTTTTGTTTTTATTTTGGAGATTGAATGTGATTGGTTGACAAATCACGTGACAAACAGGGATAGTAAAAGATGACAGATTCTGGGCTCTCTCAGTGTGATCCCTTGTGCTTTGTACCCTCACTGTCTGCTGGATCTCCCCCAGTACCAGGGGCAAAGAGTGACTCTTTGTTGTGTAATTTTTGTTGTTTGTTGCTGCAGAGCAGGAGCCGCATTCGGTCGTACTGAAATGTGAAGAGAAATAAACCTATTTAATATTTAAAAAAAAAAAAAAAAA
  3   1   2       bld Ga15      in                       XL412d21ex.3p                                                                                                                                                                                                                                                                                                                         TTGCGAGGCAGGTTTTTCAGTATTGCTAACATATAAATATATAATATAAAACnCAAAACAGTAAAAAGGACAATTTCAAATTTTTGCCTNTTGGTTGTTTGGAGAGCTGATGATCTCTGCAGTGCTCACTCTAATCAAAGGAACCCTGGACAATGGGGCTCCGTAGTCCAGGATAGTGCCAGTGGCCCTTGAATTAGTGCTTTGGCTACAGAATAGCTGTTGAGTAAAGTAATGGTTTTTTTTGTTTTTATTTTGGAGATTGAATGTGATTGGTTGACAAATCACGTGACAAACAGGGATAGTAAAAGATGACAGATTCTGGGCTCTCTCAGTGTGATCCCTTGTGCTTTGTACCCTCACTGTCTGNTGGATCTCCCCCAGTACCAGGGGCAAANGAGTGAACTCCTTTGTTGTGTAATTCTTGTTG
  3   1   2       bld Li1  5g3  out                   IMAGE:3397343.3p                                                                                                                                                                                                                                                                                                                                                                                                               CCTGTTGGTTGTTTGGAGAGCTGATGATCTCTGCAGTGCTCACTCTAATCAAAGGAACCCTGGACAATGGGGCTCCGTAGTCCAGGATAGTGCCAGTGGCCCTTGAATTAGTGCTTTGGNTACAGAATAGCTGTTGAGTAAAGTAATGTTTTTTTTTGTTTTTATTTTGGAGATTGAATGTGATTGGTTGACAAATCACGTGACAAACAGGGATAGTAAAAGATGACAGATTCTGGGCTCTCTCAGTGTGATCCCTTGTGCTTTGTACCCTCACTGTCTGCTGGATCTCCCCCAGTACCAGGGGCAAAGAGTGACTCTTTGTTGTGTAATTTTTGTTGTTTGTTGCTGCAGAGCAGGAGCCGCATTCGGTCGTACTGAAATGTGAAGAGAAATAAACCTATTTAATATTTAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)