Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:4173661-IMAGp.5                72 PI      79        127      798                LOC397853 protein [Xenopus laevis]
     2   0.0    0Xl3.1-IMAGE:8738583.5                      56 PI      80        120      810                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:8739020.5                      15 PI      83        118      810                (no blast hit)
     4   0.0    0Xl3.1-IMAGE:8734368.5                      14 PI      84        118      810                (no blast hit)
     5   0.0    0Xl3.1-IMAGE:8737172.5                       8 PI      96        116      816                (no blast hit)

 This cluster: approximate FL confidence score = 90%

 1012776924 Xl3.1-IMAGE:7204713.5 - 6 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7204713.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAAAATGGAGCCGAATCCTGTGAGGAAAGCGACACCAGGGAGGCAGCTGCAGGGAGACTTGTGACAGGAGTGAGAGATGCGATGAAGGAAAGAGAAGCCCTTCATCGCATAAAACAGCTGCCTTTGATGATGACAAGATCATTGGAGGTTCTACCTGTGCCAGGAACTCTGTCCCCTACATCGTCTCCCTAAATGCTGGCTACCATTTCTGTGGGGGGTCTCTGCTCAATAACCAGTGGGTCGTGTCTGCCGCTCACTGTTACCAAGCGAGCATCCAGGTCAGGCTTGGGGAACACAACATCGCCCTAAATGAAGGAACAGAACAATTCATCAACTCTGCCAAGGTCATCAGACACCCCAACTACAACTCCAGGACCATCGACAATGACATCATGTTGATCAAACTTGCCTCTCCTGCCTCCCTTAACTCCAATGTGAATGCTGTGGCTCTGCCTTCTAGTTGTGCCGCCGCTGGTTCCAGCTGCCTGATCTCTGGCTGGGGCAACACTTCCACCAGTGGCTCCAATTACCCCAACCTCCTGCAGTGCTTGAGTGCCCCCATCCTGACTACCGCCCAATGTACAGGTGCCTACCCCGGGCAGATCACCAACAACATGTTCTGTGCTGGATTCTTGGAGGGTGGCAAGGACTCCTGCCAGGGTGACTCTGGTGGCCCCGTGGTGTGTAATGGGCAGTTGCAGGGTATTGTGTCCTGGGGAGTCGGCTGTGCCCAGAGGAACTATCCTGGTGTCTACACCAAGGTCTGCAACTACAACTCCTGGATCCAGAGCACCATTGCTGCCAACTAATCCTTT
                                                  Xl3.1-CHK-1012702802                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGAGCCGAATCCTGTGAGGAAAGCGACACCAGGGAGGCAGCTGCAGGGAGACTTGTGACAGGAGTGAGAGATGCGATGAAGGAAAGAGAAGCCCTTCATCGCATAAAACAGCTGCCTTTGATGATGACAAGATCATTGGAGGTTCTACCTGTGCCAGGAACTCTGTCCCCTACATCGTCTCCCTAAATGCTGGCTACCATTTCTGTGGGGGGTCTCTGCTCAATAACCAGTGGGTCGTGTCTGCCGCTCACTGTTACCAAGCGAGCATCCAGGTCAGGCTTGGGGAACACAACATCGCCCTAAATGAAGGAACAGAACAATTCATCAACTCTGCCAAGGTCATCAGACACCCCAACTACAACTCCAGGACCATCGACAATGACATCATGTTGATCAAACTTGCCTCTCCTGCCTCCCTTAACTCCAATGTGAATGCTGTGGCTCTGCCTTCTAGTTGTGCCGCCGCTGGTTCCAGCTGCCTGATCTCTGGCTGGGGCAACACTTCCACCAGTGGCTCCAATTACCCCAACCTCCTGCAGTGCTTGAGTGCCCCCATCCTGACTACCGCCCAATGTACAGGTGCCTACCCCGGGCAGATCACCAACAACATGTTCTGTGCTGGATTCTTGGAGGGTGGCAAGGACTCCTGCCAGGGTGACTCTGGTGGCCCCGTGGTGTGTAATGGGCAGTTGCAGGGTATTGTGTCCTGGGGAGTCGGCTGTGCCCAGAGGAACTATCCTGGTGTCTACACCAAGGTCTGCAACTACAACTCCTGGATCCAGAGCACCATTGCTGCCAACTAATCCTTTAACTTA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     4     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     5     5     4     5     4     5     4     5     4     5     2     4     2     4     2     4     2     4     2     4
                                               BLH MIN      27     126                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     393     254                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     393      13                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ci ---- 4e-034     NP_001027686.1 sp3 protein [Ciona intestinalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ce ---- 3e-034     NP_494910.2 ZK546.15 [Caenorhabditis elegans] -------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 7e-043     XP_001193851.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ag ---- 1e-046     XP_319102.4 AGAP009966-PA [Anopheles gambiae str. PEST] ------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Dm ---- 2e-048     NP_523518.2 Trypsin 29F CG9564-PA [Drosophila melanogaster] -----------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Dr ---- 1e-098     NP_571783.1 trypsin [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Hs ---- 1e-099     NP_002761.1 protease, serine, 2 preproprotein; trypsinogen 2; anionic trypsinogen; trypsin2; trypsin II [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Gg ---- 4e-100     XP_001231334.1 PREDICTED: similar to trypsinogen [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - ?? ---- 3e-101     XP_001790399.1 PREDICTED: cationic trypsin [Bos taurus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Bt ---- 9e-103     NP_777115.1 pancreatic anionic trypsinogen [Bos taurus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Mm ---- 2e-104     NP_035776.1 trypsin 4 [Mus musculus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Cf ---- 1e-105     XP_532744.1 PREDICTED: similar to trypsin (EC 3.4.21.4) precursor, cationic - dog [Canis familiaris] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Xt ---- 2e-126     NP_001011202.1 hypothetical LOC496627 [Xenopus tropicalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xl ==== 8e-155     AAI06433.1 LOC733345 protein [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:7204713.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGA------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                         ]
  5   1   2       bld Te2N 5x3                        IMAGE:7204713.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGGAGTGAAAATGGAGCCGAATCCTGTGAGGAAAGCGACACCAGGGAGGCAGCTGCAGGGAGACTTGTGACAGGAGTGAGACATGCGATGAAGGAAAGAGAAGCCCTTCATCGCATAAAACAGCTGCCTTTGATGATGACAAGATCATTGGAGGTTCTACCTGTGCCAGGAACTCTGTCCCCTACATCGTCTCCCTAAATGCTGGCTACCATTTCTGTGGGGGGTCTCTGCTCAATAACCAGTGGGTCGTGTCTGCCGCTCACTGTTACCAAGCGAGCATCCAGGTCAGGCTTGGGGAACACAACATCGCCCTAAGTGAAGGAACAGAACAATTCATCAACTCTGCCAAGGTCATCAGACACCCCAACTACAACTCCAGGACCATCGACAATGACATCATGTTGATCAAACTTGCCTCTCCTGCCTCCCTTAACTCCAATGTGAATGCTGTGGCTCTGCCTTCTAGTTGTGCCGCCGCTGGTTCCAGCTGCCTGATCTCTGGCTGGGGCAACACTTCCACCAGTGGCTCCAATTACCCCAACCTCCTGCAGTGCTTGAGTGCCCCCATCCTGACTACCGCCCAATGTACAGGTGCCTACCCCGGGCAGATCACCAACAACATGTTCTGTGCTGGATTCTTGGAGGGTGGCAAGGACTCCTGCCAGGGTGACTCTGGTGGCCCCGTGGTGTGTAATGGGCAGTTGCAGGGTATTGTGTCCTGNGGAGTCGGCTGTGCCCAGAGGAACTATCCTGGTGTCTACACAAGGTCTGCAACTACAACTCCTGGATCAGAGCACCATTGCTGCCNACTAATCCTTTACTTATTGGAAAGTCTCAGTTTTGGGTTCTGACTTGCCCCAGGACTAAAAATAATGTACTACCGTTCCGCAAAA
  5   1   2       chi Te2                             IMAGE:7211385.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAAAATGGAGCCGAATCCTGTGAGGAAAGCGACACCAGGGAGGCAGCTGCAGGGAGACTTGTGACAGGAGTGAGAGATGCGATGAAGGAAAGAGAAGCCCTTCATCGCATAAAACAGCTGCCTTTGATGATGACAAGATCATTGGAGGTTCTACCTGTGCCAGGAACTCTGTCCCCTACATCGTCTCCCTAAATGCTGGCTACCATTTCTGTGGAGGGTCTCTGCTCAATAACCAGTGGGTCGTGTCTGCCGCTCACTGTTACCAAGCGAGCATCCAGGTCAGGCTTGGGGAACACAACATCGCCCTAAATGAAGGAACAGAACAATTCATCAACTCTGCCAAGGTCATCAGACACCCCAACTACAACTCCAGGACCATCGACAATGACATCATGTTGATCAAACTTGCCTCTCCTGCCTCCCTTAACTCCAATGTGAATGCTGTGGCTCTGCCTTCTAGTTGTGCCGCCGCTGGTTCCAGCTGCCTGATCTCTGGCTGGGGCAACACTTCCACCAGTGGCTCCAATTACCCCAACCTCCTGCAGTGCTTGAGTGCCCCCATCCTGACTACCGCCCAATGTACAGGTGCCTACCCCGGGCAGATCACCAACAACATGTTCTGTGCTGGATTCTTGGAGGGTGGCAAGGACTCCTGCCATGGTGACTCTGGTCGGCCTCTGGTGTGCAATGTGTCGTTGCAAGGTTATGTGACGTGAGAAAACAAGCTGAGCAAAGAGAACTAATGTGGTGGCTTTAATAAGTTCCGCAATTGCACCCTTGGGTACAGAGGATTCAATGCGACCCACCTGGCCTTTTATTTTAATGGAAAGGTACCGGGTAAAAATTTCTTAACTGGTGGAAATTTTTTaaaaaaaaaCTCCTTATCTTCTGGGGGAG
  5   1   1       add Emb4                            IMAGE:4201794.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAAATGGAGCCGAATCCTGTGAGGAAAGCGACACCAGGGAGGCAGCTGCAGGGAGACTTGTGACAGGAGTGAGAGATGCGATGAAGGAAAGAGAAGCCCTTCATCGCATAAAACGGCTGAAGGCTGTTGATTAACAGATATAGAGGTGAGCTGACTTTGTTTCAAGAACTGACCACATCCAAGAAATGAAACCAGAAAACAGAAAAGGTTTATAC
  5   1   2      seed Te2N 5g3  in                    IMAGE:7202209.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAGCGACACCAGGGAGGCAGCTGCAGGGAGACTTGTGACAGGAGTGAGACATGCGATGAAGGAAAGAGAAGCCCTTCATCGCATAAAACAGCTGCCTTTGATGATGACAAGATCATTGGAGGTTCTACCTGTGCCAGGAACTCTGTCCCCTACATCGTCTCCCTAAATGCTGGCTACCATTTCTGTGGGGGGTCTCTGCTCAATAACCAGTGGGTCGTGTCTGCCGCTCACTGTTACCAAGCGAGCATCCAGGTCAGGCTTGGGGAACACAACATCGCCCTAAATGAAGGAACAGAACAATTCATCAACTCTGCCAAGGTCATCAGACACCCCAACTACAACTCCAGGACCATCGACAATGACATCATGTTGATCAAACTTGCCTCTCCTGCCTCCCTTAACTCCAATGTGAATGCTGTGGCTCTGCCTTCTAGTTGTGCCGCCGCTGGTTCCAGCTGCCTGATCTCTGGCTGGGGCAACACTTCCACCAGTGGCTCCAATTACCCCAACCTCCTGCAGTGCTTGAGTGCCCCCATCCTGACTACCGCCCAATGTACAGGTGCCTACCCCGGGCAGATCACCAACAACATGTTCTGTGCTGGATTCTTGGAGGGTGGCAAGGACTCCTGCCAGGGTGACTCTGGTGGCCCCGTGGTGTGTAATGGGCAGTTGCAGGGTATTGTGTCCTGNGGAGTCNGCTGTGCCCAGAGGAACTATCCTGGTGTCTACACCAG
  3   1   2       bld Te2N 5g3  in                    IMAGE:7202209.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACTCTGTCCCCTACATCGTCTCCCTAAATGCTGGCTACCATTTCTGTGGGGGGTCTCTGCTCAATAACCAGTGGGTCGTGTCTGCCGCTCACTGTTACCAAGCGAGCATCCAGGTCAGGCTTGGGGAACACAACATCGCCCTAAATGAAGGAACAGAACAATTCATCAACTCTGCCAAGGTCATCAGACACCCCAACTACAACTCCAGGACCATCGACAATGACATCATGTTGATCAAACTTGCCTCTCCTGCCTCCCTTAACTCCAATGTGAATGCTGTGGCTCTGCCTTCTAGTTGTGCCGCCGCTGGTTCCAGCTGCCTGATCTCTGGCTGGGGCAACACTTCCACCAGTGGCTCCAATTACCCCAACCTCCTGCAGTGCTTGAGTGCCCCCATCCTGACTACCGCCCAATGTACAGGTGCCTACCCCGGGCAGATCACCAACAACATGTTCTGTGCTGGATTCTTGGAGGGTGGCAAGGACTCCTGCCAGGGTGACTCTGGTGGCCCCGTGGTGTGTAATGGGCAGTTGCAGGGTATTGTGTCCTGGGGAGTCGGCTGTGCCCAGAGGAACTATCCTGGTGTCTACACCAAGGTCTGCAACTACAACTCCTGGATCCAGAGCACCATTGCTGCCAACTAATCCTTTAACTTATGGAAAGTCTCAGTTTGGTCTGAACTGCACAAACTAATAATG
  5   1   2       bld Tad1 5x3                        IMAGE:6939344.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGAACTCCAGAACCACAGACAATGACATCATGTTGATCAAACTTGCCTCTCCTGCCTCCCTTAACTCCAATGTGAATGCTGTGGCTCTGCCTTCTAGTTGTGCCGCCGCTGGTTCCAGCTGCCTGATCTCTGGCTGGGGCAACACTTCCACCAGTGGCTCCAATTACCCCAACCTCCTGCAGTGCTTGAGTGCCCCCATCCTGACTACCGCCCAATGTACAGGTGCCTACCCCGGGCAGATCACCAACAACATGTTCTGTGCTGGATTCTTGGAGGGTGGCAAGGACTCCTGCCAGGGTGACTCTGGTGGCCCCATGGTGTGTAATGGGCAGTTGCAGGGTATTGTGTCCTGGGGAGTCGGCTGTGCCCAGAGGAACTATCCTGGTGTCTACACCAAGGTCTGCAACTACAACTCCTGGATCCAGAGCACCATTGCTGCCAACTAATCCTTTAACTTATTGGAAAGTCTCAGTTTTGGTTCTGAACTTGCCCAAGACTAAAAATAATGACTACGTCAGCACCAAGGTTTTACTAACGCTTTGGCAGCCCCCACCTCATCCAAATAAATACACTGTGAAGCTACTGGAGCGGATGCAGGAGTAGATGGCGATCGAAAAGTAGCAGCTATGACATTTATTGGCGTGTAAATAACCATTCCGTATAACGCTACACCCCTCGTGTCGGCGCAAAGAATGAAGCCCAATTGAAGCCTACCCTTCTCTCAGGCAACACCCAACTGCAGACCTCTTCCCCGCGAGGAAGACTACACACCTCCTCTATCACTATATCTCAACGTACGCCATCCGCGCTTCGAATAAACGCCGGTGCCGTTTGCTNTCCCCCGGCGGTAGGGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)