Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 27 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL447p20ex.3                         10 END     5          83       50                caudal type homeo box 4 [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL199g07.5                            7 PI      94         61      630                Cdx4 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 88%

 1012776963 Xl3.1-XL039h11.5 - 6 ESTs
                                                                       ...-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL039h11.5                                                                                                                                                                                                  TATATAGCCGTAGAACTATTAGACACCATAGTTGAAGAAGTATTCTTAACTGGGTTGAGAGCAAAGATGACCACCAAGGATCTAGTATAGAGATGGACATCACATGTGGGAGACAGACTATGCACAAGGACGCTACCATGTATCCACTTTCTGTAAGATCCACCAGCAACAACCACACAGCGCAGAACTACGTCTCCAATCAACCTTATTTCAACTATGTGGCGTATCATCATGTTCCACCTATGGATGACCAAGGGCAGCCCTGTGGAGTTTGGGGACCTCAGTATGGATCACCGAGGGAGGAATGGAACTCTTATGGAGCTGGACCTTCTAACACAAATATGGCACAATCATCTGATTTATCACCTAACCAGTTTGCTTATAATTCCTCTGGCTATAGCTCTCCTCATCCATCTGGGACTGGGATTTTACACTCTGTAGATTTGACTCATGCAGCTGCCAACTCACCCAGCGCTCTTAATCAGAATTCTTACGAATGGATGGGGAAAACTGTGCAATCGACTTCTACAGGCAAGACGAGGACCAAGGAAAAATACCGTGTGGTTTACACTGACCATCAGAGGCTGGAACTGGAAAAAGAATTTCATTACAGCAGATATATCACTATCAGGCGGAAGACAGAACTGG
                                                  Xl3.1-CHK-1012702516                                                                                                                                                                                                        GCCGTAGAACTATTAGACACCATAGTTGAAGAAGTATTCTTAACTGGGTTGAGAGCAAAGATGACCACCAAGGATCTAGTATAGAGATGGACATCACATGTGGGAGACAGACTATGCACAAGGACGCTACCATGTATCCACTTTCTGTAAGATCCACCAGCAACAACCACACAGCGCAGAACTACGTCTCCAATCAACCTTATTTCAACTATGTGGCGTATCATCATGTTCCACCTATGGATGACCAAGGGCAGCCCTGTGGAGTTTGGGGACCTCAGTATGGATCACCGAGGGAGGAATGGAACTCTTATGGAGCTGGACCTTCTAACACAAATATGGCACAATCATCTGATTTATCACCTAACCAGTTTGCTTATAATTCCTCTGGCTATAGCTCTCCTCATCCATCTGGGACTGGGATTTTACACTCTGTAGATTTGACTCATGCAGCTGCCAACTCACCCAGCGCTCTTAATCAGAATTCTTACGAATGGATGGGGAAAACTGTGCAATCGACTTCTACAGGCAAGACGAGGACCAAGGAAAAATACCGTGTGGTTTACACTGACCATCAGAGGCTGGAACTGGAAAAAGAATTTCATTACAGCAGATATATCACTATCAGGCGGAAGACAGAACTGGCTGCAA
                                                      consensus depths                                                                                                                                                                                                       3     6     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     6     6     6     6     6     6     6     6     5     6     5     6     5     6     5     6     4     5     4     5     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     3     2     3
                                               BLH ATG      92     394                                                                                                                                                                                                  
                                               BLH MIN      92      57                                                                                                                                                                                                  
                                               BLH OVR      92      23                                                                                                                                                                                                  
                                               EST CLI     -24      10                                                                                                                                                                                                  
                                               ORF LNG      92       1                                                                                                                                                                                                  
                                                                                                                                                                                                                                                                                   PROTEIN --- Ce ---- 2e-009     NP_001021210.1 Posterior ALae in males family member (pal-1) [Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 7e-014     NP_599128.1 caudal CG1759-PB [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                             PROTEIN --- Ag ---- 1e-016     XP_318681.1 AGAP009646-PA [Anopheles gambiae str. PEST] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================
                                                                                                                                                                             PROTEIN --- Ci ---- 2e-017     NP_001071669.1 transcription factor protein [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================
                                                                                                                                                                                                                                                              PREDICTED - Sp ---- 2e-018     XP_001182111.1 PREDICTED: similar to transcription factor Cad [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Bt ---= 3e-028     XP_876098.1 PREDICTED: similar to Homeobox protein CDX-2 (Caudal-type homeobox protein 2) (CDX-3) [Bos taurus] ====================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Hs ==== 8e-035     NP_005184.1 caudal type homeo box transcription factor 4 [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                               PREDICTED - Cf ---- 7e-035     XP_549080.1 PREDICTED: similar to Homeobox protein CDX-4 (Caudal-type homeobox protein 4) [Canis familiaris] ----================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Mm ==== 4e-035     NP_031700.1 caudal type homeo box 4 [Mus musculus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Dr ---= 6e-047     NP_571184.1 caudal homeobox 1 [Danio rerio] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Gg ---= 9e-054     XP_420293.1 PREDICTED: similar to caudal-type homeobox protein CDXB [Gallus gallus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Xt ==== 2e-103     NP_989417.1 cad3 [Xenopus tropicalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Xl ==== 2e-109     AAH55999.2 Cdx4 protein [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-XL039h11.5                                                                                                                                                                                                                                  TGA---------------------------------------------------------ATG------------------------ATG---------------ATG------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                              [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ...
  5   1   2       bld Tbd7 5g3  out                        XL075a17.5p                                                                                                                                                          GCAGGNAATTCGGCACGAGGCGACCCAACAGNAGGTCACTTATATAGCCGTAGAACTATTAGACACCATAGTTGAAGAAGTATTCTTAACTGGGTTGAGAGCAAAGATGACCACCAAGGATCTAGTATAGAGATGGACATCACATGTGGGAGACAGACTATGCACAAGGACGCTACCATGTATCCACTTTCTGTAAGATCCACCAGCAACAACCACACAGCGCAGAACTACGTCTCCAATCAACCTTATTTCAACTATGTGGCGTATCATCATGTTCCACCTATGGATGACCAAGGGCAGCCCTGTGGAGTTTGGGGACCTCAGTATGGATCACCGAGGGAGGAATGGAACTCTTATGGAGCTGGACCTTCTAACACAAATATGGCACAATCATCTGATTTATCACCTAACCAGTTTGCTTATAATTCCTCTGGCTATAGCTCTCCTCATCCATCTGGGACTGGGATTTTACACTCTGTAGATTTGACTCATGCAGCTGCCAACTCACCCAGCGCTCTTAATCAGAATTCTTACGAATGGATGGGGAAA
  5   1   2       bld DMZ  5g3  out                        xl281o12.5p                                                                                                                                                                          ACCGACCCAACAGAGGTCACTTATATAGCCAGCTAGAACTATTAGACACCATAGCTTGAAGAAGTATTCTTAACTGGGTTCAGAGCAAAGATGACCACCAAGGATCTAGTATAGAGATGGACATCACATGTGGGAGACAGACTATGCACAAGGACGCTACCATGTATCCACTTTCTGTAAGATCCACCAGCAACAACCACACAGCGCAGAACTACGTCTCCAATCAACCTTATTTCAACTATGTGGCGTATCATCATGTTCCACCTATGGATGACCAAGGGCAGCCCTGTGGAGTTTGGGGACCTCAGTATGGATCACCGAGGGAGGAATGGAACTCTTATGGAGCTGGACCTTCTAACACAAATATGGCACAATCATCTGATTTATCACCTAACCAGTTTGCTTATAATTCCTCTGGCTATAGCTCTCCTCATCCATCTGGGACTGGGATTTTACACTCTGTAGATTTGACTCATGCAGCTGCCAACTCACCCAGCGCTCTTAGTCAGAATTCTTACGAATGGATGGGGAAAACTGTGCAATCGACTTCTACAGGCAAGACGAGGACCAAGGAAAAATACCGTGTGGTTTACACTGACCATCAGAGGCTGGAACTGGAAAAAGAATTTCATTACAGCAGATATATCACTATCAGG
  5   1   2       bld DMZ  5g3  out                        xl247c01.5p                                                                                                                                                                           CACCGACCCAACAGAGGTCACTTATATAGCCAGTAGAACTATTAGACACCATAGTTGAAGAAGTATTCTTAACTGGGTTGAGAGCAAAGATGACCACCAAGGATCTAGTATAGAGATGGACATCACATGTGGGAGACAGACTATGCACAAGGACGCTACCATGTATCCACTTTCTGTAAGATCCACCAGCAACAACCACACAGCGCAGAACTACGTCTCCAATCAACCTTATTTCAACTATGTGGCGTATCATCATGTTCCACCTATGGATGACCAAGGGCAGCCCTGTGGAGTTTGGGGACCTCAGTATGGATCACCGAGGGAGGAATGGAACTCTTATGGAGCTGGACCTTCTAACACAAATATGGCACAATCATCTGATTTATCACCTAACCAGTTTGCTTATAATTCCTCTGGCTATAGCTCTCCTCATCCATCTGGGACTGGGATTTTACACTCTGTAGATTTGACTCATGCAGCTGCCAACTCACCCAGCGCTCTTAATCAGAATTCTTACGAATGGATGGGGAAAACTGTGCAATCGACTTCTACAGGCAAGACGAGGACCAAGGAAAAATACCGTGTGGTTTACACTGACCATCAGAGGCTGGAACTGGAAAAAGAATTTCATTACAGCAGATATATCACTATCAGGCGGAAGACAGAACTGGCTGCAAACTTAAGACTATCTG
  5   1   2       bld Emb9 5g                         IMAGE:7973759.5p                                                                                                                                                                              CCGACCCCTTTAGGTCACTTATATAGCCAGTAGAACTATTAGACACCATATTTGAAGAATTATTCTTAACTGGGTTGAGAGCAAAGATGACCACCAAGGATCTAGTATAGAGATGGACATCACATGTGGGAGACAGACTATGCACAAGGACGCTACCATGTATCCACTTTCTGTAAGATCCACCAGCAACAACCACACAGCGCAGAACTACGTCTCCAATCAACCTTATTTCAACTATGTGGCGTATCATCATGTTCCACCTATGGATGACCAAGGGCAGCCCTGTGGAGTTTGGGGACCTCACTATGGATCACCGAGGGAGGAACGGAACTCTTATGGAGCTGGACCTTCTAACACACATATGGCACAATCATCTGATTTATCACCTACTCAGTTTGCTCATAATTCCTCTGGCTATATTTTTCACCATCCCTCTGGGACTGGGATTTTACTCTCTGTAGATTTGACTCATGCATCTGGCCAACTCATCCTGTGCTCTTAGTAAGAATTTCTTACCAATGGATGGGGGAAAACTTTGCAATCCACTTCTACAGGCAAGATAAGACCAGGAAAAATACCTTGGGTTTACACGACCATCTAGGCTGGACTTGAATAGAATTTATATCGCGATTATCCTTTCAGGCGAAGTAGAACGGATCACATTCTGATATCTCACACAGAAAAATTGTTCCAATCGAGAGCCAAAAGGATCTTCAAAGAAATACAATTATGCTGTTTTGTCAGCATCAGTTTCTTTCACCTTTTGATTGTTATTG
  5   1   2       bld Neu7 5g3  out                        XL019o24.5p                                                                                                                                                                                       CAGAGGTCACTTATATAGCCGTAGAACTATTAGACACCATAGTTGAAGAAGTATTCTTAACTGGGTTGAGAGCAAAGATGACCACCAAGGATCTAGTATAGAGATGGACATCACATGTGGGAGACAGACTATGCACAAGGACGCTACCATGTATCCACTTTCTGTAAGATCCACCAGCAACAACCACACAGCGCAGAACTACGTCTCCAATCAACCTTATTTCAACTATGTGGCGTATCATCATGTTCCACCTATGGATGACCAAGGGCAGCCCTGTGGAGTTTGGGGACCTCAGTATGGATCACCGAGGGAGGAATGGAACTCTTATGGAGCTGGACCTTCTAACACAAATATGGCACAATCATCTGATTTATCACCTAACCAGTTTGCTTATAATTCCTCTGGCTATAGCTCTCCTCATCCATCTGGGACTGGGATTTTACACTCTGTAGATTTGACTCATGCAGCTGCCAACTCACCCAGCGCTCTTAATCAGAATTCTTACGAATGGATGGGGAAAACTGTGCAATCGACTTCTACAGGCAAGA
  5   1   2      seed Neu7 5g3  out                        XL039h11.5p                                                                                                                                                                                       CAGNGGTNACTTATATAGCCGTAGAACTATTAGACACCATAGTTGAAGAAGTATTCTTAACTGGGTTGAGAGCAAAGATGACCACCAAGGATCTAGTATAGAGATGGACATCACATGTGGGAGACAGACTATGCACAAGGACGCTACCATGTATCCACTTTCTGTAAGATCCACCAGCAACAACCACACAGCGCAGAACTACGTCTCCAATCAACCTTATTTCAACTATGTGGCGTATCATCATGTTCCACCTATGGATGACCAAGGGCAGCCCTGTGGAGTTTGGGGACCTCAGTATGGATCACCGAGGGAGGAATGGAACTCTTATGGAGCTGGACCTTCTAACACAAATATGGCACAATCATCTGATTTATCACCTAACCAGTTTGCTTATAATTCCTCTGGCTATAGCTCTCCTCATCCATCTGGGACTGGGATTTTACACTCTGTAGATTTGACTCATGCAGCTGCCAACTCACCCAGCGCTCTTAATCAGAATTCTTACGAATGGATGGGGAAAACTGTGCAATCGACTTCTACAGGCAAGACGAGGACCAAGGAAAAATACCGTGTGGTTTACACTGACCATCAGAGGCTGGAACTGGAAAAAGAATTTCATTACAGCAGATATATCACTATCAGGCGGAAGACAGAACTGGCTGCAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)