Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:7297116.5                       9 END     4          40       44                hypothetical protein LOC414600 [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6643932.5                       4 PI      93        676     1176                hypothetical protein LOC779843 [Xenopus tropicalis]
     3   0.0    0Xl3.1-IMAGE:5083711.5                       2 PI      94          6     1142                hypothetical protein LOC495110 [Xenopus laevis]

 This cluster: approximate FL confidence score = 98%

 1012777099 Xl3.1-IMAGE:7206428.5 - 10 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7206428.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGGAGAGAGAACTGAGCGGCGGGCAGAGTGAAAAGCCTGGACTTTGTTGTTATTGTTGTCTCAGCACCGCTTCTCCCTGGCCGGGAAGCAAGGGACAAGTCTGCGCGGCCAGAATGTATGTGCAAAATGCGACAGATCAACTGCAGCTTAGTTGACACCTGAATAGGAAATCTGAAAATGGATAAATGTAAACATGTTGGCCGCTTGCGTCTTGCCCAAGATCATTCAATTTTGAACCCTCAGAAGTGGCACTGTGTGGATTGCAACACTACAGAATCAGTGTGGGCTTGCCTAAGCTGTTCACATGTTGCGTGTGGTCGATACATTGAAGAGCATGCACTGCGTCACTTTCAGGACAGTAAGCATCCTTTGGCTTTGGAGGTTAATGAACTTTATGTTTTTTGTTACCTCTGTGATGATTATGTTCTCAATGACAACACCACTGGTGACCTTAAACTTTTACGAAGCACATTAAGTGCCATCAAAAGTCAGAATTATGACTGTACAACACGTAGTGGTCGGACTTTGCGTTCTATGGTAACTGCAGATGATTCATTCATTTCACATGAAGGTGCACAAGCCTTTCTTCAGAATGAAGACCGTGCATTCACTGCATTGTGGCATCGGAGGCATGCTCTCTTAGGGAAGGTTTTTAGGTCGTGGTTTGCGTTGACTCCAAAAGGCAAGCAAAGGTTAGAAGAGGAACGCTTGAGGGAAGAGGTAGAGCAGAAGAGGGAGGAAGCGAGAAAAAAGCGGCAGCAGTTGAAGCGCAAATTAAAGGAAGAAATGGAAAGCACTTCCCCTAGAAAAAGTTCACGTTTGCAACATCAAATACAGCCTTCACCCAAAACTGAATTGCCCTCTGTGCAAAAAATGAACCAAAAAAACTCTCCTACCACAAAACAAAAAACACCAGCACCTACCTCTGATAAAGCATGCTTCAAGAAAATCGGTAATTCTCCAATAAAAAGGAAGCCCACTGTGACCCCCGGAGTAACAGGACTGAGGAATCTGGGGAACACCTGCTATATGAACTCAATACTTCAGATACTGAGTCATTTGCACGTTTTCCGGGAGTGTTTTTTACAACTTGATCTCAATCAAACTCAGGAGTTGTTGGCAGCTGCTGGCAGTGGAAAAACAAGGTTGTCCAGCAAATACCCACCTGGTGCTGA
                                                  Xl3.1-CHK-1012695368                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGAGAACTGAGCGGCGGGCAGAGTGAAAAGCCTGGACTTTGTTGTTATTGTTGTCTCAGCACCGCTTCTCCCTGGCCGGGAAGCAAGGGACAAGTCTGCGCGGCCAGAATGTATGTGCAAAATGCGACAGATCAACTGCAGCTTAGTTGACACCTGAATAGGAAATCTGAAAATGGATAAATGTAAACATGTTGGCCGCTTGCGTCTTGCCCAAGATCATTCAATTTTGAACCCTCAGAAGTGGCACTGTGTGGATTGCAACACTACAGAATCAGTGTGGGCTTGCCTAAGCTGTTCACATGTTGCGTGTGGTCGATACATTGAAGAGCATGCACTGCGTCACTTTCAGGACAGTAAGCATCCTTTGGCTTTGGAGGTTAATGAACTTTATGTTTTTTGTTACCTCTGTGATGATTATGTTCTCAATGACAACACCACTGGTGACCTTAAACTTTTACGAAGCACATTAAGTGCCATCAAAAGTCAGAATTATGACTGTACAACACGTAGTGGTCGGACTTTGCGTTCTATGGTAACTGCAGATGATTCATTCATTTCACATGAAGGTGCACAAGCCTTTCTTCAGAATGAAGACCGTGCATTCACTGCATTGTGGCATCGGAGGCATGCTCTCTTAGGGAAGGTTTTTAGGTCGTGGTTTGCGTTGACTCCAAAAGGCAAGCAAAGGTTAGAAGAGGAACGCTTGAGGGAAGAGGTAGAGCAGAAGAGGGAGGAAGCGAGAAAAAAGCGGCAGCAGTTGAAGCGCAAATTAAAGGAAGAAATGGAAAGCACTTCCCCTAGAAAAAGTTCACGTTTGCAACATCAAATACAGCCTTCACCCAAAACTGAATTGCCCTCTGTGCAAAAAATGAACCAAAAAAACTCTCCTACCACAAAACAAAAAACACCAGCACCTACCTCTGATAAAGCATGCTTCAAGAAAATCGGTAATTCTCCAATAAAAAGGAAGCCCACTGTGACCCCCGGAGTAACAGGACTGAGGAATCTGGGGAACACCTGCTATATGAACTCAATACTTCAGATACTGAGTCATTTGCACGTTTTCCGGGAGTGTTTTTTACAACTTGATCTCAATCAAACTCAGGAGTTGTTGGCAGCTGCTGGCAGTGGAAAAACAAGGTTGTCCAGCAAATACCCACCTGG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     4     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     6     7     7     8     7     8     7     8     7     8     7     8     6     8     6     8     6     8     6     8     6     8     5     7     4     7     4     7     4     6     4     6     3     6     4     7     4     7     4     7     4     7     4     7     4     7     5     6     5     6     5     5     4     5     3     4     3     4     3     4     3     4     3     4     4     4     4     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3
                                               BLH ATG     178     623                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     172     158                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     178     855                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     178      74                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PROTEIN --- Dm ---- 9e-013     NP_727843.1 HDAC6 CG6170-PC, isoform C [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 5e-013     NP_001122780.1 F41H10.6c [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 3e-019     XP_647029.1 UBP-type Zn finger-containing protein [Dictyostelium discoideum AX4] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Ci ---- 1e-053     NP_001041464.1 zinc finger protein 3 [Ciona intestinalis] ----------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Sp ==== 3e-064     XP_001193512.1 PREDICTED: similar to MGC83063 protein [Strongylocentrotus purpuratus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Mm ==== 2e-102     XP_001480112.1 PREDICTED: hypothetical protein [Mus musculus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = Cf ==== 9e-118     XP_532654.1 PREDICTED: similar to ubiquitin specific protease 44 [Canis familiaris] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = Bt ==== 1e-121     XP_595186.2 PREDICTED: similar to ubiquitin specific protease 44 isoform 1 [Bos taurus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Hs ==== 3e-122     NP_001035862.1 ubiquitin specific protease 44 [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Dr ==== 7e-126     NP_956551.1 hypothetical protein MGC55661 [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Gg ==== 3e-144     XP_416154.2 PREDICTED: hypothetical protein [Gallus gallus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Xt ==== 0          NP_001072389.1 hypothetical protein LOC779843 [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Xl ==== 0          NP_001084641.1 hypothetical protein LOC414600 [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:7206428.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGA------------------------------------------------------------------------------------------------------ATG------ATG------------------------------TGA---------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ...
  5   1   2       add Ov1  5g                         IMAGE:6316014.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGACGCGTGGGCTGCCAGGCCGTCTCTTGACGTCATCTTCGTCGTCACCGTGTACTGGGAGAGAGAACTGAGCGGCGGGCAGAGTGAAAAGCCTGGACTTTGTTGTTATTGTTGTCTCAGCACCGCTTCTCCCTGGCCGGGAAGCAAGGGACAAGTCTGCGCGGCCAGAATGTATGTGCAAAATGCGACAGATCAACTGCAGCTTAGTTGACACCTGAATAGGAAATCTGAAAATGGATAAATGTAAACATGTTGGCCGCTTGCGTCTTGCCCAAGATCATTCAATTTTGAACCCTCAGAAGTGGCACTGTGTGGATTGCAACACTACAGAATCAGTGTGGGCTTGCCTAAGCTGTTCACATGTTGCGTGTGGTCGATACATTGAAGAGCATGCACTGCGTCACTTTCAGGACAGTAAGCATCCTTTGGCTTTGGAGGTTAATGAACTTTATGTTTTTTGTTACCTCTGTGATGATTATGTTCTCAATGACAACACCACTGGTGACCTTAAACTTTTACGAAGCACATTAAGTGCCATCANAAGTCAGAATTATGACTGTACAACACGTAGTGGTCGGACTTTGCGTTCTATGGTAACTGCAGATGATTCATTCATTTCACATGAAGGTGCACAAGCCCTTTCTTCAGAATGAAGAACCGTGCATTCCACTGGATTTGTGGCATCGGGAGGCATGCTTCTCTTGGGGGAAGGGTTTTTAGGTCGTTGGTTTGCCGTTGACTCCCAAAAGGCAAGCAAAAGGTTTAGAAGAAGGAACCCCTTGAAGGGAAGAAAGGCCAAACCCAAAAAGAGGGA
  5   1   2       bld Oo1  5g                         IMAGE:6637611.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTGGTACCGCGTCCGCGAATTCTCCGGATCCTGTACTGGGAGAGNAACTGAGCCGCGGGCAGAGTGAAAAGCCTGGACTTTGTTGTTATTGTTGTCTCAGCACCGCTTCTCCCTGGCCGGGAAGCAAGGGACAAGTCTGCGCGGCCAGAATGTATGTGCAAAATGCGACAGATCAACTGCAGCTTAGTTGACACCTGAATAGGAAATCTGAAAATGGATAAATGTAAACATGTTGGCCGCTTGCGTCTTGCCCAAGATCATTCAATTTTGAACCCTCAGAAGTGGCACTGTGTGGATTGCAACACTACAGAATCAGTGTGGGCTTGCCTAAGCTGTTCACATGTTGCGTGTGGTCGATACATTGAAGAGCATGCACTGCGTCACTTTCAGGACAGTAAGCATCCTTTGGCTTTGGAGGTTAATGAACTTTATGTTTTTTGTTACCTCTGTGATGATTATGTTCTCAATGACAACACCACTGGTGACCTTAAACTTTTACGAAGCACATTAAGTGCCATCAAAAGTCAGAATTATGACTGTACAACACGTAGTGGTCGGACTTTGCGTTCTATGGTAACTGCAGATGATTCATTCATTTCACATGAAGGTGCACAAGCCTTTCTTCAGAATGAAGACCGTGCATTCACTGCATTGTGGCATCGGAGGCATGCTCTCTTAGGGAAGGTTTTTAGGTCCTGGGTTTGCGTTGACTCCAAAAGGCAAGCAAAGGTTAGAAGAGGAACGCTTGTAGGGAAGAGGTACAGCACAAAAAGGGAGGAAACCCACAAAAAAGCGCGCAGCCACTTGAAAGCGCAAATTAAAGGGAAGAAATGGGAAAGCCACTCCCCCCCaaaaaaaaGTTTCCCCTTTTGCCACCATCCAATAACGGGCCTTCCACCCAAAACTGAAATTGGCCCTCTCGGGGCAT
  5   1   2       bld Tbd3 5g                IMAGE:3548435-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAATTTTTGAATTTCCCCGGGGGAACTGAGCGGCGGGCAGAGTGAAAAGCCTGGACTTTGTTGTTATTGTTGTCTCAGCACCGCTTCTCCCTGGCCGGGAAGCAAGGGACAAGTCTGCGCGGCCAGAATGTATGTGCAAAATGCGACAGATCAACTGCAGCTTAGTTGACACCTGAATAGGAAATCTGAAAATGGATAAATGTAAACATGTTGGCCGCTTGCGTCTTGCCCAAGATCATTCAATTTTGAACCCTCAGAAGTGGCACTGTGTGGATTGCAACACTACAGAATCAGTGTGGGCTTGCCTAAGCTGTTCACATGTTGCGTGTGGTCGATACATTGAAGAGCATGCACTGCGTCACTTTCAGGACAGTAAGCATCCTTTGGCTTTGGAGGTTAATGAACTTTATGTTTTTTGTTACCTCTGTGATGATTATGTTCTCAATGACAACACCACTGGTGACCTTAAACTTTTACGAAGCACATTAAGTGCCATCAAAAGTCAGAATTATGACTGTACAACACGTAGTGGTCGGACTTTGCGTTCTATGGTAACTGCAGATGATTCATTCATTTCACATGAAGGTGCACAAGCCTTTCTTCAGAATGAAGACCGTGCATTCACTGCATTGTGGCATCGGAGGCATGCTCTCTTAGGGAAGGTTTTTAGGTCGTGGTTTGCGTTGACTCCAAAAGGCAAGCAAAGGTTAGAAGAGGAACGCTTGAGGGAAGAGGTAGAGCAGAAGAGGGGAGGAAGCGAGAAAAAAGCGGCAGCAGTTGAAGCGCAAATTAAAGGAAGAAATGGAAAGCACTTCCCCTAGAAAAAGTTCACGTTTGCAACATCAAAATACAGCCTTCACCCAAAACTGAATTGCCCTCTGTGCAAA
  5   1   2      seed Ga15 5g                            XL454g08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TACTGGGAGAGAGAACTGAGCGGCGGGCAGAGTGAAAAGCCTGGACTTTGTTGTTATTGTTGTCTCAGCACCGCTTCTCCCTGGCCGGGAAGCAAGGGACAAGTCTGCGCGGCCAGAATGTATGTGCAAAATGCGACAGATCAACTGCAGCTTAGTTGACACCTGAATAGGAAATCTGAAAATGGATAAATGTAAACATGTTGGCCGCTTGCGTCTTGCCCAAGATCATTCAATTTTGAACCCTCAGAAGTGGCACTGTGTGGATTGCAACACTACAGAATCAGTGTGGGCTTGCCTAAGCTGTTCACATGTTGCATGTGGTCGATACATTGAAGAGCATGCACTGCGTCACTTTCAGGACAGTAAGCATCCTTTGGCTTTGGAGGTTAATGAACTTTATGTTTTTTGTTACCTCTGTGATGATTATGTTCTCAATGACAACACCACTGGTGACCTTAAACTTTTACGAAGCACATTAAGTGCCATCAAAAGTCAGAATTATGACTGTACAACACGTAGTGGTCGGACTTTGCGTTCTATGGTAACTGCAGATGATTCATTCATTTCACATGAAGGTGCACAAGCCTTTCTTCAGAATGAAGACCGTGCATTCACTGCATTGTGGCATCGGAGGCATGCTCTCTTAGGGAAGGTTTTTAGGTCGTGGTTTGCGTTGACTCCAAAAGGCAAGCAAAGGTTAGAAGAGGAACGCTTGAGGGAAGAGGCAGAGCA
  5   1   2       add Tbd3 5g3  out                   IMAGE:3548435.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCTGAGCGGCGGGCAGAGTGAAAAGCCTGGACTTTGTTGTTATTGTTGTCTCAGCACCGCTTCTCCCTGGCCGGGAAGCAAGGGACAAGTCTGCGCGGCCAGAATGTATGTGCAAAATGCGACAGATCAACTGCAGCTTAGTTGACACCTGAATAGGAAATCTGAAAATGGATAAATGTAAACATGTTGGCCGCTTGCGTCTTGCCCAAGATCATTCAATTTTGAACCATCAGAAGTGGCACTGNGTGGATTGCAACACTACAGAATCAGTGTGGGCTTGCCTAAGCTGTACACATGTTGCATGTGGTCGATACATCTAAGAGCATGCACTGCGTGACTTTCAGGACAGTCTGCATCCTCTGGATTTGATGGTAAATGAACTTTATGTTTTTTGTTACCTTATGGATGATTATGTT
  5   1   2       bld Te2N 5g3  out                   IMAGE:7203550.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGCGGCGGGCAGAGTGAAAAGCCTGGACTTTGTTGTTATTGTTGTCTCAGCACCGCTTCTCCCTGGCCGGGAAGCAAGGGACAAGTCTGCGCGGCCAGAATGTATGTGCAAAATGCGACAGATCAACTGCAGCTTAGTTGACACCTGAATAGGAAATCTGAAAATGGATAAATGTAAACATGTTGGCCGCTTGCGTCTTGCCCAAGATCATTCAATTTTGAACCCTCAGAAGTGGCACTGTGTGGATTGCAACACTACAGAATCAGTGTGGGCTTGCCTAAGCTGTTCACATGTTGCGTGTGGTCGATACATTGAAGAGCATGCACTGCGTCACTTTCAGGACAGTAAGCATCCTTTGGCTTTGGAGGTTAATGAACTTTATGTTTTTTGTTACCTCTGTGATGATTATGTTCTCAATGACAACACCACTGGTGACCTTAAACTTTTACGAAGCACATTAAGTGCCATCAAAAGTCAGAATTATGACTGTACAACACGTAGTGGTCGGACTTTGCGTTCTATGGTAACTGCAGATGATTCATTCATTTCACATGAAGGTGCACAAGCCTTTCTTCAGAATGAAGACCGTGCATTCACTGCATTGTGGCATCGGAGGCATGCTCTCTTAGGGAAGGTTTTTAGGTCGTGGTTTGCGTTGACTCCAAAAGGCAAGCAAAGGTTAGAAGAGGAACGCTTGANGGAAGAGGTAGAGCAGAAGAGGGAGGAAGCGAGAAAAAAGCGGCAGCAGTTGAAGCGCAATTAAAGGAAGAAATGGNAAGCACTCCCCTAGAAAAAGTTCACGTTTGCAACATCAANTACAGCCTTCACCCAAAACTGAAATTGCCCTCTTGTGCaaaaatgaaacaaaaaaaactctcctaccaaaaaacaaaaaaaaaC
  5   1   2       bld Te2N 5g                         IMAGE:7206428.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCAAAATGCGACAGATCAACTGCAGCTTAGTTGACACCTGAATAGGAAATCTGAAAATGGATAAATGTAAACATGTTGGCCGCTTGCGTCTTGCCCAAGATCATTCAATTTTGAACCCTCAGAAGTGGCACTGTGTGGATTGCAACACTACAGAATCAGTGTGGGCTTGCCTAAGCTGTTCACATGTTGCGTGTGGTCGATACATTGAAGAGCATGCACTGCGTCACTTTCAGGACAGTAAGCATCCTTTGGCTTTGGAGGTTAATGAACTTTATGTTTTTTGTTACCTCTGTGATGATTATGTTCTCAATGACAACACCACTGGTGACCTTAAACTTTTACGAAGCACATTAAGTGCCATCAAAAGTCAGAATTATGACTGTACAACACGTAGTGGTCGGACTTTGCGTTCTATGGTAACTGCAGATGATTCATTCATTTCACATGAAGGTGCACAAGCCTTTCTTCAGAATGAAGACCGTGCATTCACTGCATTGTGGCATCGGAGGCATGCTCTCTTAGGGAAGGTTTTTAGGTCGTGGTTTGCGTTGACTCCAAAAGGCAAGCAAAGGTTAGAAGAGGAACGCTTGAGGGAAGAGGTAGAGCAGAAGAGGGAGGAAGCGAGAAAAAAGCGGCAGCAGTTGAAGCGCAAATTAAAGGAAGAAATGGAAAGCACTTCCCCTAGAAAAAGTTCACGTTTGCAACATCAAATACAGCCTTCACCCCAAACTGAATTGCCCTCTGTGCaaaaaatgaaccaaaaaaactctcctaccacaaaacaaaaaCACAGCACCTACCTCTGAATAAGCATGCTTCAAGAAAATCGGGTATTTCTCCAATAAAAAGGGAACCCCACGGTGACCCCCCGGGAGTTACAGGAACTGAAGGAATC
  5   1   2       bld Em10                            IMAGE:7980167.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTTGCGTTCTATGGTAACTGCAGATGATTCATTCATTTCACATGAAGGTGCACAAGCCTTTCTTCAGAATGAAGACCGTGCATTCACTGCATTGTGGCATCGGAGGCATGCTCTCTTGGGGAAGGTTTTTAGGTCGTGGTTTGCGTTGACTCCAAAAGGCAAGCAAAGGTTAGAAGAGGAACGCTTGAGGGAAGAGGCAGAGCAGAAGAGGGAGGAAGCGAGAAAAAAGCGGCAGCAGTTGAAGCGCAAATTAAAGGAAGAAATGGAAAGCACTTCCCCTAGAAAAAGTTCACGTTTGCAACATCAAATACAGCCTTCACCCAAAACTGAATTGCCCTCTGTGcaaaaaatgaaccaaaaaaactctcctaccacaaaacaaaaaacACCAGCACCTACCTCTGATAAAGCATGCTTCAAGAAAATCGGTAATTCTCCAATAAAAAGGAAGCCCACTGTGACCCCCGGAGTAACAGGACTGAGGAATCTGGGGAACACCTGCTATATGAACTCAATACTTCAGATACTGAGTCATTTGCACGTTTTCCGGGAGTGTTTTTTACAACTTGATCTCAATCAAACTCAGGAGTTGTTGGCAGCTGCTGGCAGTGGAAAAAAAGGTTGTCCAGCAAATACCCACCTGGTGCTGAGCTACAAGAGTACACAAAGCACACTAAGTTCAAGATCACTGCAAGCGTCAGACTCTCTTGGACTAGTGTGGGCTCAATATAGAACATGACTATCAGCTAGAGCAGTCAACACTTCCTAGCAGATGCTACTCTCAGTCGTGCGTATGCCTGTTCCTTG
  5   1   2       bld Ga12      out                        XL155d08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTGAAGACCGTGCATTCACTGCATTGTGGCATCGGAGGCATGCTCTCTTAGGGAAGGTTTTTAGGTCGTGGTTTGCGTTGACTCCAAAAGGCAAGCAAAGGTTAGAAGAGGAACGCTTGAGGGAAGAGGTAGAGCAGAAGAGGGAGGAAGCGAGAAAAAAGCGGCAGCAGTTGAAGCGCAAATTAAAGGAAGAAATGGAAAGCACTTCCCCTAGAAAAAGTTCACGTTTGCAACATCAAATACAGCCTTCACCCAAAACTGAATTGCCCTCTGTGcaaaaaatgaaccaaaaaaactctcctaccacaaaacaaaaaaCACCAGCACCTACCTCTGATAAAGCATGCTTCAAGAAAATCGGTAATTCTCCAATAAAAAGGAAGCCCACTGTGACCCCCGGAGTAACAGGACTGAGGAATCTGGGGAACACCTGCTATATGAACTCAATACTTCAGATACTGAGTCATTTGCACGTTTTCCGGGAGTGTTTTTTACAACTTGATCTCAATCAAACTCAGGAGTTGTTGGCAGCTGCTGGCAGTGGAAAAACAAGGTTGTCCAGCAAATACCCACCTGGTGCTGAGC
  5   1   2       bld DMZ       out                        xl269h15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAAAGCACTTCCCCTAGAAAAAGTTCACGTTTGCAACATCAAATACAGCCTTCACCCAAAACTGAATTGCCCTCTGTGcaaaaaatgaaccaaaaaaactctcctaccacaaaacaaaaaaCACCAGCACCTACCTCTGATAAAGCATGCTTCAAGAAAATCGGTAATTCTCCAATAAAAAGGAAGCCCACTGTGACCCCCGGAGTAACAGGACTGAGGAATCTGGGGAACACCTGCTATATGAACTCAATACTTCAGATACTGAGTCATTTGCACGTTTTCCGGGAGTGTTTTTTACAACTTGATCTCAATCAAACTCAGGAGTTGTTGGCAGCTGCTGGCAGTGGAAAAACAAGGTTGTCCAGCAAATACCCACCTGGTGCTGAGCTACCAAGAGTAACACAAAAGCACACTAAAGTTCAAAGATCACTGGCAAGGCGTCAGAGCTTCTCCTTGGGACTTAGTGGTGGGGCTTCAAATAGTAGAAACATGGAACTTATTCAGCCTAAGGAGCCAAGTTCAAAGCACATATCTCTATGCCATGAATTGCATACCCTCTTCCAAGTCATGTGGTCAGGTAAATGGGCACTGGTTTCTCCTTTTGCAATGCTACATTCAGTGTGGAGGCTTATACCAGCCTTCCGCGGGTATGCACAGCAAGATGCTCAGGAATTCCTCTGTGAACTATTAGATAAAGTACAACA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)