Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL172l03.5                            3 END     1           5       33                nucleoporin 155kDa [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xlk127k09ex.3                         9 PI      80       1442     1627                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012777117 Xl3.1-XL404i15ex.5 - 20 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL404i15ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATGGCTGGCCTGCAGGCATTTCAGGAGAGGTTAAATAGCTACAAGTGTATCACAGATACACTCCAGGAGCTGGTAAACCAAAGTAAAGCTGCACCACAATCACCCAGTGTTCCCAAAAAACCAGGCCCACCTGTCCTGTCGTCAGACCCCAACATGCTCAGCAACGAAGAGGCTGGAATACATTTTGAGCAAATGCTTAAGCTGGCTCAGCGTTCTGCAGATGAGCTCTTCAACATAGCGCTTTTCAACTGGCTCATACAGGCGGACCTCACTGACAAACTGCTGGAGCTGAATTCACCATTTCTGGAGCCACATTTGGTGCGTATGGCAAAGCTGGATCAGAACAAAGTGCGATACATGGATTTGCTTTGGCGATACTATGAGAAAAACAGAAATTTCAGCAATGCTGCTCGTGTTGTGGCCAAACTTGCAGACATGCACAGCCCAGAGATTTCACTGAAGCAACGACTTGAATACATCTCCAGAGCCATTCTTAGTGCCAAGAGCTCCACTACTATGTCCACCCTTGCTGCTGACGGCGAGTTCTTGCATGAGTTGGAAGAAAAGTTGGAGGTAGCAAGAATTCAGCTGCAAATACAAGAGACCTTAACAAGACAATATTCCCACCATTCAACTGTGGGGGATGCAGTGTCACAGCTTGATTCTCAGCTAATGGACATAACTAAGATGTTTGGACAATATGCAGATCCTTTCAGGCTTTCAGAATGCAAACTGGCAATCATACACTGCGCTGGACATTCAGATCCTATATTGGTACAGACGCTCTGGCAAGATATAATTGACAAAGAACTGAGTGACAGCATGGGCAATAGCTCAGTAGATCGAATGCAGTCGCTTCATCTAAAAATTACCTCTCTTGGGAAAATCTATGCCAGTACACCTCGCTATTTTCCTTTAGAATTTTTGGTGAAATACCTGGAACAGCAGGTGTGTAACTTCAGCTGGGACGCCGGGTTTGTAACGTACACAATGCAAGAGATCAACGTGCCTGTTCCCAAGTTACTCGAAGTGTACGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAACCTCTGCACTTGCTTGAAAGTATTTATATCTTGCTCTCAGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACTCTGTGCCTGGATGCAATTTCCTGCTACCTAGTGGAACTCCAATCAATGGATCCGGCTCCGGCGTTGTTAAATACTGTATCAAACTTCAAGTCTTTGCAAGCCAAATTGGAGAGGTTGAGCTAGTCCAATCACTGATCCTTAACGCGATGGAGCTAAAGTAATGGACAGTTGTACATGCACTTGGACGGGCTTTGGAGACCATTCCATTGCTCTCAACTTGTTTCCAGTCATTTCTCTGTGTGTCCTGATTGAAACTCGCAATTAGGGATGCACCGAATTTGAGATTCTGACTTTTTCAGCAGGATTTGGATTTGGCTGAATCCTTGTGCCTGGCCAAACTGAATCCTAATTTGCATATGTAAAATAGGGGCAGGTAGGGAAATCACGTGGCTTTTCGTCACGAGATTTTTTTCCTTTCCTGTCCCTAATTTGCATATGTAAATAAGGGTGGGTAGGGAAATCGCGTTACTTCATCACAACAGAAGAATCTTTTCCATTTTTTCCTTTCCTGACCCGATTCAGTTCAGTATTCTGCCAAATCTTTCACCAAGGATTCGGCATAATCCCAAAGAGTGGATTCGGTGCATCCCTACCTGCAATACAAATGTTTTATTCCTCAACAATCGCCAATGACACATAGCAATGTTGCATTTTGGTCTGTTTCGAACACACACAGACATTTTCATCTCCTGCATTAAATTTGTAGACTTGGTTATAATGCATATTTTCTTCCTTACATATTCCGACTGCCAAACGGGGTTTTGCAAAAAAAAAGATTATAAATTAATTTTACAAAACAATTCTAATGGCTGCATGCAGTTTTTTTTTTTAATTTTGATATTTTTAGCAGTTTATTAATATCCAATATCTTTGTATACTGCCTTAAACAAAAACTTTACACTGCACTTGTTTACTTATTTCCATGATTTTTCCTGAATGTTGAAGGGGAATGCTAGTGATCATTTTAAATCTGCCCTTTGCAGTGTATGAGTGTATGCTACCAA
                                                  Xl3.1-CHK-1012689965                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGCCTGCAGGCATTTCAGGAGAGGTTAAATAGCTACAAGTGTATCACAGATACACTCCAGGAGCTGGTAAACCAAAGTAAAGCTGCACCACAATCACCCAGTGTTCCCAAAAAACCAGGCCCACCTGTCCTGTCGTCAGACCCCAACATGCTCAGCAACGAAGAGGCTGGAATACATTTTGAGCAAATGCTTAAGCTGGCTCAGCGTTCTGCAGATGAGCTCTTCAACATAGCGCTTTTCAACTGGCTCATACAGGCGGACCTCACTGACAAACTGCTGGAGCTGAATTCACCATTTCTGGAGCCACATTTGGTGCGTATGGCAAAGCTGGATCAGAACAAAGTGCGATACATGGATTTGCTTTGGCGATACTATGAGAAAAACAGAAATTTCAGCAATGCTGCTCGTGTTGTGGCCAAACTTGCAGACATGCACAGCCCAGAGATTTCACTGAAGCAACGACTTGAATACATCTCCAGAGCCATTCTTAGTGCCAAGAGCTCCACTACTATGTCCACCCTTGCTGCTGACGGCGAGTTCTTGCATGAGTTGGAAGAAAAGTTGGAGGTAGCAAGAATTCAGCTGCAAATACAAGAGACCTTAACAAGACAATATTCCCACCATTCAACTGTGGGGGATGCAGTGTCACAGCTTGATTCTCAGCTAATGGACATAACTAAGATGTTTGGACAATATGCAGATCCTTTCAGGCTTTCAGAATGCAAACTGGCAATCATACACTGCGCTGGACATTCAGATCCTATATTGGTACAGACGCTCTGGCAAGATATAATTGACAAAGAACTGAGTGACAGCATGGGCAATAGCTCAGTAGATCGAATGCAGTCGCTTCATCTAAAAATTACCTCTCTTGGGAAAATCTATGCCAGTACACCTCGCTATTTTCCTTTAGAATTTTTGGTGAAATACCTGGAACAGCAGGTGTGTAACTTCAGCTGGGACGCCGGGTTTGTAACGTACACAATGCAAGAGATCAACGTGCCTGTTCCCAAGTTACTCGAAGTGTACGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAACCTCTGCACTTGCTTGAAAGTATTTATATCTTGCTCTCAGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACTCTGTGCCTGGATGCAATTTCCTGCTACCTAGTGGAACTCCAATCAATGGATCCGGCTCCGGCGTTGTTAAATACTGTATCAAACTTCAAGTCTTTGCAAGCCAAATTGGAGAGGTTGAGCTAGTCCAATCACTGATCCTTAACGCGATGGAGCTAAAGTAATGGACAGTTGTACATGCACTTGGACGGGCTTTGGAGACCATTCCATTGCTCTCAACTTGTTTCCAGTCATTTCTCTGTGTGTCCTGATTGAAACTCGCAATTAGGGATGCACCGAATTTGAGATTCTGACTTTTTCAGCAGGATTTGGATTTGGCTGAATCCTTGTGCCTGGCCAAACTGAATCCTAATTTGCATATGTAAAATAGGGGCAGGTAGGGAAATCACGTGGCTTTTCGTCACGAGATTTTTTTCCTTTCCTGTCCCTAATTTGCATATGTAAATAAGGGTGGGTAGGGAAATCGCGTTACTTCATCACAACAGAAGAATCTTTTCCATTTTTTCCTTTCCTGACCCGATTCAGTTCAGTATTCTGCCAAATCTTTCACCAAGGATTCGGCATAATCCCAAAGAGTGGATTCGGTGCATCCCTACCTGCAATACAAATGTTTTATTCCTCAACAATCGCCAATGACACATAGCAATGTTGCATTTTGGTCTGTTTCGAACACACACAGACATTTTCATCTCCTGCATTAAATTTGTAGACTTGGTTATAATGCATATTTTCTTCCTTACATATTCCGACTGCCAAACGGGGTTTTGCAAAAAAAAAGATTATAAATTAATTTTACAAAACAATTCTAATGGCTGCATGCAGTTTTTTTTTTTAATTTTGATATTTTTAGCAGTTTATTAATATCCAATATCTTTGTATACTGCCTTAAACAAAAACTTTACACTGCACTTGTTTACTTATTTCCATGATTTTTCCTGAATGTTGAAGGGGAATGCTAGTGATCATTTTAAATCTGCCCTTTGCAGTGTATGAGTGTATGCTACCAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     5     3     5     2     4     2     4     3     4     3     5     3     5     3     5     3     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     6     5     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     7     6     7     5     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     8     6     8     6     8     6     8     6     8     7     9     7     9     7     9     7     9     8    11     8    11     7    11     7    11     7    12     7    12     8    12     8    12     8    11     8    11     7    11     7    10     7    10     7    10     6    10     8    11     8    11     8    11     7    11     6    11     6    11     5    10     4     9     5     9     5     9     5     9     5     9     6     9     8     9     6     9     6     9     8    10     8    10     8    10     8    10     8    10     8    10     9    10     9    10     9    10     9    10     9     9     9     9     8     9     8     9     9     9     9     9     9     9     9     9     8     9     9     9     9     9     9     9     9     9     9     9     8     9     7     7     5     6     4     6     3     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     5     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     4     2     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------C-
                                                                       ...PROTEIN --- Ce ---- 2e-015     NP_500102.3 Nuclear Pore complex Protein family member (npp-8) [Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 7e-020     XP_635370.1 hypothetical protein DDB0189286 [Dictyostelium discoideum] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Sp ---- 7e-045     XP_001185873.1 PREDICTED: similar to Nucleoporin 155 [Strongylocentrotus purpuratus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 3e-050     NP_477288.2 CG4579-PB [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ag ---- 4e-056     XP_317470.4 AGAP007999-PA [Anopheles gambiae str. PEST] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 0          NP_956450.1 nucleoporin 155 [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 0          NP_573490.3 nucleoporin 155 [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_705618.1 nucleoporin 155kDa isoform 1; nuclear pore complex protein Nup155 [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Bt ---- 0          XP_583225.3 PREDICTED: similar to nucleoporin 155 [Bos taurus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 0          XP_536500.2 PREDICTED: similar to nucleoporin 155kDa isoform 1 [Canis familiaris] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 0          XP_425016.2 PREDICTED: similar to nucleoporin 155 [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 0          NP_001080800.1 nucleoporin 155kDa [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xl3.1-XL404i15ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG---------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------TAG---------TGA------------------TAA------------------ATG------------------------------------------------------------------------TGA---------------ATG---------TGA---------------------------------------------------------TGA---------------------------------------------------------------------------------------------ATGTAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------ATG------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG---------------------------------------TAA---------------------------------------------------------------------------TGAATG------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
  5   1   2       bld Thy       in                    IMAGE:8546684.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGAAGTGTGTCCTCTTCTGTACAGCACAGATGATGCCGTGTGCTCAAAGGCAAATGAACTTTTGCAAAGATCACGGCATGTTCCAAACAAACAGGAAAAGGAAAGAATGCTACGAGAGTCATTAAAGGAGTACCAAAAAATAAGCCAACAGGTTGACCTTCCAAATGTGTGTGCTCAGTACAGACAAGTACGCTTCTATGAGGGAGTGGTGGAGCTTTGCCTTTCCGCTGCAGAGAAAAAAGATCCACAGGGTCTAGGCCTCCACTTCCACAAGAACGGAGAACCTGAAGAGGACATGGCTGGCCTGCAGGCATTTCAGGAGAGGTTAAATAGCTACAAGTGTATCACAGATACACTCCAGGAGCTGGTAAACCAAAGTAAAGCTGCACCACAATCACCCAGTGTTCCCAAAAAACCAGGCCCACCTGTCCTGTCGTCAGACCCCAACATGCTCAGCAACGAAGAGGCTGGAATACATTTTGAGCAAATGCTTAAGCTGGCTCAGCGTTCTGCAGATGAGCTCTTCAACATAGCGCTTTTCAACTGGCTCATACAGGCGGACCTCACTGACAAACTGCTGGAGCTGAATTCACCATTTCTGGAGCCACATTTGGTGCGTATGGCAAAGCTGGATCAGAACAAAGTGCGATACATGGATTTGCTTTGGCGATACTATGAGAAAAACAGAAATTTCAGCAATGCTGCTCGTGTTGTGGCCAAACTTGCAGACATGCACAGCCCAGAGATTTCACTGAAGCAACGACTTGAATACATCTCCAGAGCCATTCTTAGTGCCAGAGCTCACTACTATGTCCACCCTTGCTGCTGACGGCGAGTTCTTGCATGAGTTGGAAGAAAAAAGTGAGTTAGCCAGGATCCAGCTGCCAAATAACAAGAAGAATCTTAAACAAGGAACAATTATTGCA
  5   1   2       bld Neu7      in                         XL017a08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCTGAAGNAGGACATGGCTGGCCTGCAGGCATTTCAGGAGAGGTTAAATAGCTACAAGTGTATCACAGATACACTCCAGGAGCTGGTAAACCAAAGTAAAGCTGCACCACAATCACCCAGTGTTCCCAAAAAACCAGGCCCACCTGTCCTGTCGTCAGACCCCAACATGCTCAGCAACGAAGAGGCTGGAATACATTTTGAGCAAATGCTTAAGCTGGCTCAGCGTTCTGCAGATGAGCTCTTCAACATAGCGCTTTTCAACTGGCTCATACAGGCGGACCTCACTGACAAACTGCTGGAGCTGAATTCACCATTTCTGGAGCCACATTTGGTGCGTATGGCAAAGCTGGATCAGAACAAAGTGCGATACATGGATTTGCTTTGGCGATACTATGAGAAAAACAGAAATTTCAGCAATGCTGCTCGTGTTGTGGCCAAACTTGCAGACATGCACAGCCCAGAGATTTCACTGAAGCAACGACTTGAATACATCTCCAGAGCCATTCTTAGTGCCAAGAGCTCCACTACTATGTCCACCCTTGCTGCTGACGGCGAGTTCTTGCATGAGTTGGAAG
  5   1   2       bld Egg3                            IMAGE:6326795.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGAGGCATTTCAGGTAGAGGTTAAATAGCTACAAGTGTATCACAGATACACTCCAGGAGCTGGTAAACCAAAGTAAAGCTGCACCACAATCACCCAGTGTTCCCAAAAAACCAGGCCCACCTGTCCTGTCGTCAGACCCCAACATGCTCAGCAACGAAGAGGCTGGAATACATTTTGAGCAAATGCTTAAGCTGGCTCAGCGTTCTGCAGATGAGCTCTTCAACATAGCGCTTTTCAACTGGCTCATACAGGCGGACCTCACTGACAAACTGCTGGAGCTGAATTCACCATTTCTGGAGCCACATTTGGTGCGTATGGCAAAGCTGGATCAGAACAAAGTGCGATACATGGATTTGCTTTGGCGATACTATGAGAAAAACAGAAATTTCAGCAATGCTGCTCGTGTTGTGGCCAAACTTGCAGACATGCACAGCCCAGAGATTTCACTGAAGCAACGACTTGAATACATCTCCAGAGCCATTCTTAGTGCCAAGAGCTCCACTACTATGTCCATCCTTGCTGCTGACGGCGAGTTCTTGCATGAGTTGGAAGAAAAGTTGGAGGTAGCAAGAATTCAGCTGCAAATACAAGAGACCTTAACAAGACAATATTCCCACCATTCAACTGTGGGGGATGCAGTGTCACAGCTTGATTCTCAGCTAATGGACATAACTAAGATGTTTGGACAATATGCAGATCCTTTCAAGCTTTCAGAATGCAAACTGGCAATCATACACTGCGCTGGACATTCAGATCCTATATTGGTACAGACGCTCTGGCAAGATATAATTGACAAAGAACTGAGTGACAGCATGGGCAATAGCTCAGTAGATCGAATGCAGTCGCTTCATCTAAAAATACCTCTCTTGGGGAAATCTATGCCAGTACACCTCGCTATTTTCCTTTAA
  5   1   2       bld Ga15                               XL512a04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAAAAACCAGGCCCACCTGTCCTGTCGTCAGACCCCAACATGCTCAGCAACGAAGAGGCTGGAATACATTTTGAGCAAATGCTTAAGCTGGCTCAGCGTTCTGCAGATGAGCTCTTCAACATAGCGCTTTTCAACTGGCTCATACAGGCGGACCTCACTGACAAACTGCTGGAGCTGAATTCACCATTTCTGGAGCCACATTTGGTGCGTATGGCAAAGCTGGATCAGAACAAAGTGCGATACATGGATTTGCTTTGGCGATACTATGAGAAAAACAGAAATTTCAGCAATGCTGCTCGTGTTGTGGCCAAACTTGCAGACATGCACAGCCCAGAGATTTCACTGAAGCAACGACTTGAATACATCTCCAGAGCCATTCTTAGTGCCAAGAGCTCCACTACTATGTCCACCCTTGCTGCTGACGGCGAGTTCTTGCATGAGTTGGAAGAAAAGTTGGAGGTAGCAAGAATTCAGCTGCAAATACAAGAGACCTTAACAAGACAATATTCCCACCATTCAACTGTGGGGGATGCAGTGTCACAGCTTGATTCTCAGCTAATGGACATAACTAAGATGTTTGGACAATATGCAGATCCTTTCAGGCTTTCAGAATGCAAACTGGCAATCATACACTGCGCTGGACATTCAGATCCTATATTGGTACAGACGCTCTGGCAAGATATAATTGACAAAGAACTGAGTGACAGCATGGGCAATAGCTCAGTAGATCGAATGCAGTCGCTTCATCTAAAAATTACCTCTCTTGGGAAAATCTATGCCAGTACACCTC
  5   1   2       bld Thy       in                    IMAGE:8550781.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCTAGACTAATACAAGCGCGCATCGCTTCGAATTCGTCCCCTTTCAGGTAGCAAGAATTCAGCTGCAAATACAAGAGACCTTAACAAGACAATATTCCCACCATTCAACTGTGGGGGATGCAGTGTCACAGCTTGATTCTCAGCTAATGGACATAACTAAGATGTTTGGACAATATGCAGATCCTTTCAGGCTTTCAGAATGCAAACTGGCAATCATACACTGCGCTGGACATTCAGATCCTATATTGGTACAGACGCTCTGGCAAGATATAATTGACAAAGAACTGAGTGACAGCATGGGCAATAGCTCAGTAGATCGAATGCAGTCGCTTCATCTAAAAATTACCTCTCTTGGGAAAATCTATGCCAGTACACCTCGCTATTTTCCTTTAGAATTTTTGGTGAAATACCTGGAACAGCAGGTGTGTAACTTCAGCTGGGACGCCGGGTTTGTAACGTACACAATGCAAGAGATCAACGTGCCTGTTCCCAAGTTACTCGAAGTGTACGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAACCTCTGCACTTGCTTGAAAGTATTTATATCTTGCTCTCAGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACTCTGTGCCTGGATGCAATTTCCTGCTACCTAGTGGAACTCCAATCAATGGATCCGGCTCCGGCGTTGTTAAATACTGTATCAAACTTCAAGTCTTTGCAAGCCAAATTGGAGAGGTTGAGCTAGTCCAATCACTGATCCTTAACGCGATGGAGCTAAAGTAATGGACAGTTGTACATGCACTTGGACGGCTTTGGAGACATTCCATTGCTCTCACTGTTCAGTCATTTCTCTGTGTGTCCTGATGAACTCCCATAGGATGCACCGATTTGAGATCTGATTTCAGCAGATCGATAGCTGATCTGTGCTGCACCGATCTATGCATGTAATGGCAGTAGATCGGTGCCTCTACAGATTCCTCTCTATGCATATGTATAGGTGGAGGA
  5   1   2       bld Tail                            IMAGE:8543663.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAAANNNCTCCATACCAGTGNGNNGANGAGACATATAATNNATTCGTCCCCTGTGGGGGATGCAGTGTCACAGCTTGATTCTCAGCTAATGGACATAACAAAGATGTTTGGACAATATGCAGATCCTTTCAGGCTTTCAGAATGCAAACTGGCAATCATACACTGCGCTGGACATTCAGATCCTATATTGGTACAGACGCTCTGGCAAGATATAATTGACAAAGAACTGAGTGACAGCATGGGCAATAGCTCAGTAGATCGAATGCAGTCGCTTCATCTAAAAATTACCTCTCTTGGGAAAATCTATGCCAGTACACCTCGCTATTTTCCTTTAGAATTTTTGGTGAAATACCTGGAACAGCAGGTGTGTAACTTCAGCTGGGACGCCGGGTTTGTAACGTACACAATGCAAGAGATCAACGTGCCTGTTCCCAAGTTACTCGAAGTGTACGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAACCCCTGCACTTGCTTGAAAGTATTTATATCTTGCTCTCAGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACTCTGTGCCTGGATGCAATTTCCTGCTACCTAGTGGAACTCCAATCAATGGATCCGGCTCCGGCGTTGTTAAAAACTGTATCAAACTTCAAGTCTTTGCAAGCCAAATTGGAGAGGGTGAGCTAGTCGAATCACTGATCCTTAACGCGATGGAGCTAAATAATGGA
  5   1   2       bld Tad1                            IMAGE:6940649.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGATTCTCAGCTAATGGACATAACAAAGATGTTTGGACAATATGCAGATCCTTTCAGGCTTTCAGAATGTAAACTGGCAATCATACACTGCGCTGGACATTCAGATCCTATATTGGTACAGACGCTCTGGCAAGATATAATTGACAAAGAACTGAGTGACAGCATGGGCAATAGCTCAGTAGATCGAATGCAGTCGCTTCATCTAAAAATTACCTCTCTTGGGAAAATTTATGCCAGTACACCTCGCTATTTTCCTTTAGAATTTTTGGTGAAATACCTGGAACAGCAGGTGTGTAACTTCAGCTGGGACGCCGGGTTTGTAACGTACACAATGCAAGAGATCAACGTGCCTGTTCCCAAGTTACTCGAAGTGTACGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAACCTCTGCACTTGCTTGAAAGTATTTATATCTTACTCTCAGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACTCTGTGCCTGGATGCAATTTCCTGCTACCTAGTGGAACTCCAATCAATGGATCCGGCTCCGGCGTTGTTAAATACTGTATCAAACTTCAAGTTCTTTGCAAGCCCAAATTGGAGAGGTTTGAGCCTAGTCCCAATCCACTGGATCCCTTTAACCGCGATGGAAGCCTAAAAGTAAATGGGACAGGTTTGTACCATGGCCCCTTTGG
  5   1   2       bld Thy       in                    IMAGE:8550640.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAATTCCAATGGAAAACAATACGCATCGATTCGTCCCCTGCGCTGGACATTCAGATCCTATATTGGTACAGACGCTCTGGCAAGATATAATTGACAAAGAACTGAGTGACAGCATGGGCAATAGCTCAGTAGATCGAATGCAGTCGCTTCATCTAAAAATTACCTCTCTTGGGAAAATCTATGCCAGTACACCTCGCTATTTTCCTTTAGAATTTTTGGTGAAATACCTGGAACAGCAGGTGTGTAACTTCAGCTGGGACACTGGGTTTGTAACGTACACAATGCAAGAGATCAACGTGCCTGTTCCCAAGTTACTCGAAGTGTACGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAACCTCTGCACTTGCTTGAAAGTATTTATATCTTGCTCTCAGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACTCTGTGCCTGGATGCAATTTCCTGCTACCTAGTGGAACTCCAATCAATGGATCCGGCTCCGGCGTTGTTAAATACTGTATCAAACTTCAAGTCTTTGCAAGCCAAATTGGAGAGGTTGAGCTAGTCCAATCACTGATCCTTAACGCGATGGAGCTAAAGTAATGGACAGTTGTACATGCACTTGGACGGGCTTTGGAGACCATTCCATTGCTCTCAACTTGTTTCCAGTCATTTCTCTGTGTGTCCTGATTGAAACTCGCAATTAGGGATGCACCGAATTTGAGATTGACTTTTTCAGCACGATTTGGATTTGGCTGATCCTTGTGCCTGGCCAAACCGAATCCTAATTTGCATATGTAAAATAGGGCAGTAGGGAAATCGCGTGCTTTCGTCACAGATTTTTTCTTTCTGTCCCTATTGATATGTAATAGGTGGGTAGGGAATCGCGGTACTCATCCAACAGAGAATCTTTCATTTTCTTCTGACGATCAGTCAGTATCGCACCTCCAGGATCGCATATCCAGATGGATCCGGTCATCCTACTGCAACACATTTATTCCTA
  5   1   2       bld FaBN                            IMAGE:8078506.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATACACTGCGCTGGACATTCAGATCCTATATTGGTACAGACGCTCTGGCAAGATATAATTGACAAAGAACTGAGTGACAGCATGGGCAATAGCTCAGTAGATCGAATGCAGTCGCTTCATCTAAAAATTACCTCTCTTGGGAAAATTTATGCCAGTACACCTCGCTATTTTCCTTTAGAATTTTTGGTGAAATACCTGGAACAGCAGGTGTGTAACTTCAGCTGGGACGCCGGGTTTGTAACGTACACAATGCAAGAGATCAACGTGCCTGTTCCCAAGTTACTCGAAGTGTACGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAACCTCTGCACTTGCTTGAAAGTATTTATATCTTGCTCTCAGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACTCTGTGCCTGGATGCAATTTCCTGCTACCTAGTGGAACTCCAATCAATGGATCCGGCTCCGGCGTTGTTAAATACTGTATCAAACTTCAAGTCTTTGCAAGCCAAATTGGAGAGGTTGAGCTAGTCCAATCACTGATCCTTAACGCGATGGAGCTAAAGTAATGGACAGTTGTACATGCACTTGGACGGGCTTTGGAGACCATTCCATTGCTCTCAACTTGTTTCCAGTCATTTCTCTGTGTGTCCTGATTGAAACTCGCAATTANGGATGCACCGAATTTGAGATTCTGACTTTTTCAGCAGGATTCGGATTGGGCTGANTC
  5   1   2       bld Egg1                               PBX0048B04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAGTATTTATATCTTGCTCTCAGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACTCTGTGCCTGGATGCAATTTCCTGCTACCTAGTGGAACTCCAATCAATGGATCCGGCTCCGGCGTTGTTAAATACTGTATCAAACTTCAAGTCTTTGCAAGCCAAATTGGAGAGGTTGAGCTAGTCCAATCACTGATCCTTAACGCGATGGAGCTAAAGTAATGGACAGTTGTACATGCACTTGGACGGGCTTTGGAGACCATTCCATTGCTCTCAACTTGTTTCCAGTCATTTCTCTGTGTGTCCTGATTGAAACTCGCAATTAGGGATGCACCGAATTTGAGATTCTGACTTTTTTCAGCAGGATTCGGATTTGGCTGAATCCTTGTGCCT
  3   1   2       add Thy       in                    IMAGE:8550781.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGACTGGAATGAGAGACTCCATCTAATATATTCTCTTCAGTATCAGACAACAATCTTCTAAAAGCCCGTTACATCGTGCTGATCAATTCTGCTACTAGTGACTCCATCAATGATCCGCTCGGCGTGTTAATACGTATCAACTCAAGTCTTTCAAGCCAATTGAGAGGTGAGCTATCCAATCACTGATCCTAACGCGATGAAGCTAAAGTAATGGACAGTTGTACATGCACTTGGACGGGCTTTGGAGACCATTCCATTGCTCTCAACTTGTTTCCAGTCATTTCTCTAAAAAACAAGATTGAAACTCACAATTAGGGATGCACCGAATTTGAGATTCTGAATTTTTCAGCAGGATTCGGATTTGGCTGAATCCTTGTGCCTCCCCAAAAAAAATCCTAATTTGCATATGTAAAATAGGGGCAGGTAGGGAAATCGCGTGGCTTTTCGTCACGAGATTTTTTTCCTTTCCTGTCCCTAATTTGCATATGTAAATAAGGGTGGGTAGGGAAATCGCGTTACTTCATCACAACAGAAGAATCTTTTCCATTTTTTCCTTTCCTGACCCGATTCAGTTCAGTATTCTGCCAAATCTTTCACCAAGGATTCGGCATAATCCCAAAGAGTGGATTATGTGCATCCCTACCTCCTTTGAAAATGTTTTATTCCTCAACAATCGCCAATGACACATAGCAATGTTGCATTTTGGTCTGTTTCGAACACACACAGACATTTTCATCTCCTGCATTAAATTTGTAGACTTGGTTATAATGCATATTTCTTCCTTACATATCCGACTCC
  3   1   2       bld Thy       in                    IMAGE:8546684.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGACTTCATGCTGAGATTATCTGTTCAGTAGTCAGAGCAGCAGTGCTCTATGAAGCGCGGTTACATTTGGCTGGAGCAATTCTGCTACTAGTGACTCAATCATGGATCGGCTCCGCGTTGTTAATACTGATCAACTCAAAGTCTTGCAAGCAAATTGGAGAGGTGAGCTAGTCGAATCACTGATCCTAACGCGATGGAGCTAAAGTAATGGACAGTTGTACATGCACTTGGACGGGCTTTGGAGACCATTCCATTGCTCTCAACTTGTTTCCAGTCATTTCTCTGTGTGTCCTGATTGAAACTCGCAATTAGGGATGCACCGAATTTGAGATTGACTTTTTCAGCAGGATTTGGATTTGGCTGAATCCTTGTGCCTGGCCAAACCGAATCCTAATTTGCATATGTAAAATAGGGGCAGGTAGGGAAATCGCGTGGCTTTTCGTCACAAGATTTTTTTCCTTTCCTGTCCCTAATTTGCATATGTAAATTAAGGGTGGGTAGGGAAATCGCGTTACTTCATCACAACAGAAGAATCTTTTCCATTTTTTCCTTTCCTGACCCGATTCAGTTCAGTATTCTGCCAAATCTTTCACCAAGGATTCGGCATAATCCCAAAGAGTGGATTCGGTGCATCCCTACCTGCAATACAAATGTTTTATTCCTCAACAATCGCCAATGACACATAGCAATGTTGCATTTTGGTCTGTTTCGAACACACACAGACATTTTCATCTCCTGCATTAAATTTGTAGACTTGGTTATAATGCATATTTTCTTCCTTACATATCCGACTCC
  5   1   2      seed Ga15                               XL404i15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAATTTCCTGCTACCTAGTGGAACTCCAATCAATGGATCCGGCTCCGGCGTTGTTAAATACTGTATCAAACTTCAAGTCTTTGCAAGCCAAATTGGAGAGGTTGAGCTAGTCGAATCACTGATCCTTAACGCGATGGAGCTAAAGTAATGGACAGTTGTACATGCACTTGGACGGGCTTTGGAGACCATTCCATTGCTCTCAACTTGTTTCCAGTCATTTCTCTGTGTGTCCTGATTGAAACTCGCAATTAGGGATGCACCGAATTTGAGATTCTGACTTTTTCAGCAGGATTTggatttggctgaatccttgtgcctggccaaactgaatcctaatttgcatatgtaaaataggggcaggtagggaaatcacgtggcttttcgtcacGAGATTTTTTTCCTTTCCTGTCCCTAATTTGCATATGTAAATAAGGGTGGGTAGGGAAATCGCGTTACTTCATCACAACAGAAGAATCTTTTCCATTTTTTCCTTTCCTGACCCGATTCAGTTCAGTATTCTGCCAAATCTTTCACCAAGGATTCGGCATAATCCCAAAGAGTGGATTCGGTGCATCCCTACCTGCAATACAAATGTTTTATTCCTCAACAATCGCCAATGACACATAGCAATGTTGCATTTTGGTCTGTTTCGAACACACACAGACATTTTCATCTCCTGCATTAAATTTGTAGACTTGGTTATAATGCATATTTTCTTCCTTACATATTCCGACTGCCAAACGGGG
  3   1   2       bld Ga12      out                        XL211f02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGGCGTTGTTAAATACTGTATCAAACTTCAAGTCTTTGCAAGCCAAATTGGAGAGGTTGAGCTAGTCGAATCACTGATCCTTAACGCGATGGAGCTAAAGTAATGGACAGTTGTACATGCACTTGGACGGGCTTTGGAGACCATTCCATTGCTCTCAACTTGTTTCCAGTCATTTCTCTGTGTGTCCTGATTGAAACTCGCAATTAGGGATGCACCGAATTTGAGATTCTGACTTTTTCAGCAGGATTTGGATTTGGCTGAATCCTTGTGCCTGGCCAAACTGAATCCTAATTTGCATATGTAAAATAGGGGCAGGTAGGGAAATCACGTGGCTTTTCGTCACGAGATTTTTTTCCTTTCCTGTCCCTAATTTGCATATGTAAATAAGGGTGGGTAGGGAAATCGCGTTACTTCATCACAACAGAAGAATCTTTTCCATTTTTTCCTTTCCTGACCCGATTCAGTTCAGTATTCTGCCAAATCTTTCACCAAGGATTCGGCATAATCCCAAAGAGTGGATTCGGTGCATCCCTACCTGCAATACAAATGTTTTATTCCTCAACAATCGCCAATGACACATAGCAATGTTGCATTTTGGTCTGTTTCGAACACACACAGACATTTTCATCTCCTGCATTAAATTTGTAGACTTGGTTATAATGCATATTTTCTTCCTTACATATTCCGACTGCCAAACGGGGTTTGCAAAAAAAAAGATT
  3   1   2       add Thy       in                    IMAGE:8550640.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TACTATGACTCATCATGATCGNTCGCGTGTNAATACGATCAACTCAGTCTTGCAGCAAATGAGAGGGTGAGTAGTCAATCATGATCTTAACGCGATGAGCTAAGTATGGACAGTTTACATGCACTTGACGGGCTTGGAGACCATCCATTGCTCTCAACTGTTTCCAGTCATTTCTCTGTGTGTCNTGATGAAAACTCGCAATTAGGGATGCACCGAATTTGAGATTGACTTTTTCAGCAGGATTTGGATTTGGCTGAATCCTTGTGCCTGGCCAAACCGAATCCTAATTTGCATATGTAAAATAGGGGCAGGTAGGGAAATCGCGTGGCTTTTCGTCACAAGATTTTTTTCCTTTCCTGTCCCTAATTTGCATATGTAAATTAAGGGTGGGTAGGGAAATCGCGTTACTTCATCACAACAGAAGAATCTTTTCCATTTTTTCCTTTCCTGACCCGATTCAGTTCAGTATTCTGCCAAATCTTTCACCAAGGATTCGGCATAATCCCAAAGAGTGGATTCGGTGCATCCCTACCTGCAATACAAATGTTTTATTCCTCAACAATCGCCAATGACACATAGCAATGTTGCATTTTGGTCTGTTTCGAACACACACAGACATTTTCATCTCCTGCATTAAATTTGTAGACTTGGTTATAATGCATATTTTCTTCCTTAAATATTCCGACTGCCAAACGGGGTTTTGCAAAAAAAAAGATTATAAATTAATTTTACAAAACAATTCTAATGGCTGCATGCAGTTTTTTTTTTTAATTTTGATATTTTTAGCAGTTTATTAATATCCAATATCCAGATACACATAACACACTATT
  3   1   2       bld Neu7      in                         XL017a08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCTAGTCGAATCACTGATCCCTTAACGCGAATGGAGCTAAAGTAATGGACAGTTGTACATGCACTTGGACGGGCTTTGGAGACCATTCCATTGCTCTCAACTTGTTTCCAGTCATTTCTCTGTGTGTCCTGATTGAAACTCGCAATTAGGGATGCACCGAATTTGAGATTCTGACTTTTTCAGCAGGATTTGGATTTGGCTGAATCCTTGTGCCTGGCCAAACTGAATCCTAATTTGCATATGTAAAATAGGGGCAGGTAGGGAAATCACGTGGCTTTTCGTCACGAGATTTTTTTCCTTTCCTGTCCCTAATTTGCATATGTAAATAAGGGTGGGTAGGGAAATCGCGTTACTTCATCACAACAGAAGAATCTTTTCCATTTTTTCCTTTCCTGACCCGATTCAGTTCAGTATTCTGCCAAATCTTTCACCAAGGATTCGGCATAATCCCAAAGAGTGGATTCGGTGCATCCCTACCTGCAATACAAATGTTTTATTCCTCAACAATCGCCAATGACACATAGCAATGTTGCATTTTGGTCTGTTTCGAACACACACAGACATTTTCATCTCCTGCATTAAATTTGTAGACTTGGTTATAATGCATATTTTCTTCCTTACATATTCCGACTGCCAAACGGGGTTTTGCAAAAAAAAAGNATTATAAATTAATTTTACAAA
  5   1   2       bld Emb4                            IMAGE:5571035.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTCCTGATTGAAACTCACAATTAGGGATGCACCGAATTTGAGATTCTGAATTTTTCAGCAGGATTCggatttggctgaatccttgtgcctggccaaaccgaatcctaatttgcatatgtaaaataggggcaggtagggaaatcgcgtggcttttcgtcacGAGATTTTTTTCCTTTCCTGTCCCTAATTTGCATATGTAAATAAGGGTGGGTAGGGAAATCGCGTTACTTCATCACAACAGAAGAATCTTTTCCATTTTTTCCTTTCCTGACCCGATTCAGTTCAGTATTCTGCCAAATCTTTCACCAAGGATTCGGCATAATCCCAAAGAGTGGATTCGGTGCATCCCTACCTGCAATACAAATGTTTTATTCCTCAACAATCGCCAATGACACATAGCAATGTTGCATTTTGGTCTGTTTCGAACACACCCAGACATTTTCATCTCCTGCGTTAAATTTGTAGACTTGGGTATAATGCATATTTTCTTCCTTACATATTCCGACTGCCAAACGGGGGTTTTTGCGAAAAAAAGATTATACATTCCTTTTTACAAAAGAACTTCCAATGGGTTGCAATGCAGCTTTTCTTTTGTGGGCCTTGAAAGTCCTTAGCCGGCTCCATTAAAAATCCAATTCTCTTGAGTATCCTGGCATTAAGACACAAACTTATACACAAGCCATATCGCAGTAACCTAATTTACAATGCCCCTTTCCCCGGATGGTCTCAAAGGCAGCACAGCCTAGCCGAAACATCCCGCACCATCCCTCCCCTTCTATAGACCCGAAGAGGCCGCTATGCGCTGAACTATCAAGCAGCCCCGACTCCCTCGGACTCGCCCGTGATGGGATGAAATAAAGACTCGAGCCACACACAAAATAAACTGCACCATCGTACCCATAGCTATAACGACGATAACCGCCCCCTCTCTCCATCCCCGCTATAAACCGGCACCGTCACCCCCCGCGCCACTAAGTCTACCC
  5   1   2       bld Ga18      in                      xlk117j24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAAANCGCGTGCTTTTCGTCACGAGATTTTTTTCCTTTCCTGTCCCTAATTTGCATATGTAAATAAGGGTGGGTAGGGAAATCGCGTTACTTCATCACAACAGAAGAATCTTTTCCATTTTTTCCTTTCCTGACCCGATTCAGTTCAGTATTCTGCCAAATCTTTCACCAAGGATTCGGCATAATCCCAAAGAGTGGATTCGGTGCATCCCTACCTGCAATACAAATGTTTTATTCCTCAACAATCGCCAATGACACATAGCAATGTTGCATTTTGGTCTGTTTCGAACACACACAGACATTTTCATCTCCTGCATTAAATTTGTAGACTTGGTTATAATGCATATTTTCTTCCTTACATATTCCGACTGCCAAACGGGGTTTTGCaaaaaaaaaGATTATAAATTAATTTTACAAAACAATTCTAATGGCTGCATGCNGtttttttttttAATTTTGATATTTTTAGCAGTTTATTAATATCCAATATCTTTGTATACTGCCTTAAACAAAAACTTTACACTGCACTTGTTTACTTATTTCCATGATTTTTCCTGAATGTTGAAGGGGAATGCTAGTGATCATTTTAAATCTGCCCTTTGCAGNGTATGAGTNTA
  3   1   2       add Ga18      in                      xlk117j24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TANNTAANTNNGGNTNNGTAGGNAAATCGCNNTACTTCNTCNNANNNNAAGAATCNTTTNCNNTTTTNNCNTTNCNTGNCCCGATTCAGTTCAGTATTCTGCCAAATCTTTCNCCAAGGATTCGGCATAATCCCAAAGAGTGGATTCGGTGNNNCCCNNNCTGNAATACAAATGTTTTATTCCTCAACAATCNCCAATGACACATAGNAATGTTGCATTTTGNTCTGTTTNGNANACACACAGACATTTTCATCTCCTGCATTAAATTTGTAGACTTGGTTATAATGCATATTTTCTTCCTTACATATTCCGACTGCCAAACGGGGTTTTGCAAAAAAAAAGATTATAAATTAATTTTACAAAACAATTCTAATGGCTGCATGCAGTTTTTTTTTTTAATTTTGATATTTTTAGCAGTTTATTAATATCCAATATCTTTGTATACTGCCTTAAACAAAAACTTTACACTGCACTTGTTTACTTATTTCCATGATTTTTCCTGAATGTTGAAGGGGAATGCTAGTGATCATTTTAAATCTGCCCTTTGCAGTGTATGAGTGTATGCTACCAAAAAAAAAAATTCAGTGTTTTTTTTTGTTTTACTTGAATGCATTTAATATAGTGATATGTATTTAATATACTGAACGTACTGTTCCAGCCCAGAAAGGTTTGTAGTTTCAGAATAGTAATGATCCAGTTTATCAGTGTAGGGATGATGCAAATCCACTTTTTCCAGATTTGGACAATTACTGAATCCGGAATCAAAATTATAATTTGCAAATGCAAATTAGCTTAATCTGGCGGCAATGACATTTGCTATTTCCATAATCACATGATCTAAAGTCACATAATTGCAAGGGTTTGGATTTGGTTTGAACAGCCACTTGGATTTTGGCAAATCCTGGTTCTGATACAGCTAAATCCCAAAGTCAGCGCATCCCTACTTTCAAAGATTCCCACAACAGCTCCCCCATTTTGGATCTTATTAGGCCATAACATTGGGAGGCACATTTATCAAAGGTCGATTTTGAATTCATGTGA
  5   1   1       add Ga15      ?                        XL495k02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AATTTTACAAAACAATTCTAATGGCTGCATGCAGtttttttttttAATTTTGATATTTTTANCAGTTTATTAATATCCAATATCTTTGTATACNGCCTTAAACAAAAACTTTACNCTGCACTTGTTTACTTATTTCCATGATTTTTCCTGAANGTTGAAGGGGAATGCTAGNGATCATTTTAAATCTGCCCTTTGCAGGGTATGAGNGTATGCTACCaaaaaaaaaaaTNCAGGGTTTTTTTNGTTTNACTNGAAGGCNTTTAANA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)