Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL186k22.3                            4 END     2          18       50                (no blast hit)
     2   2.0    0Xl3.1-IMAGE:3475540.3                       2 END     1           9       50                fibroblast growth factor-8b [Xenopus laevis]

 This cluster: approximate FL confidence score = 83%

 1012777220 Xl3.1-XL186k22.5 - 11 ESTs
                                                                       ........-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL186k22.5                                                                                                             CACACACACTCACACTGTGTCTCTCTCAGGAGGTCTCCGAGCCTCTCAGTCAGCTTCTAGTGTTATTGGCCGGTGGGGTCGGCGCTGCTGGTGCAGACAAGGAGCAAGTCTTACTCATCAACACTTTCATCATCAGCTCAGACACACCAAGCGCTGCCGCTGCCTTCAACCCAACACAACGTCATTTTGGAAGCGAGAGAGAGAGAGAAAGTGATCCTCCCAGGTTGGGAAGTAACTCGCCTCCTTGTCGCTACTTCTGTCTGACTTTGCGCTCGCTCCAACCTGACAGCGCCGCTCCTGCACCTCCTGCACATCGGGACCCCGGGCCGGACAGTAGCGCAACACTCGGACAATTGTCACCGGCGCATCTTGCTCTTGAGAGGCGTGAGCTCCGCACCGACTACTGCAGCAGCCACAGCAGCACCGGACGGATTGTTGTATTATTATTATTATTTGTGCGCTGACGACTGGGAGTGCAGCGACTTTCTACTCCTCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCCTCCAGACTCGGCTGCCGGGCCAAGGGAATGGGCGGAGGAATCTGCCGGAGCTCCCGGGACTAGTGAAACGGCACCTTCCCCTATTGCTGCTGCTGCTGCTGGTGCTACTGGGCTAATCACCCGCCGCTTCTCTGCAATCCAACTGGCAACTGAGCAACATGAACTACATCACCTCCATCCTGGGCTATCTGTTACTGCACCTGTTTGTCATCTGCCTACAAGCCCAGGTAACTGTTCAGTCCCCACCTAATTTTACACAGCATGTGAGGGAGCAGAGCCTGGTGACCGACCAACTAAGCCGACGGCTCATCCGAACCTACCAGTTGTACAGCCGGACCAGCGGCAAGCATGTGCAAATCCTGGCGAACAAGAAGATTAACGCCATGGCAGAAGACGGCGACCCACACGCCAAGTTAATCGTGGAAACAGATACGTTTGGAAGCAGAGTTCGCATTAAAGGTGCGGAGACTGGTTACTACATCTGCATGAACAAAAAAGGGAAGCTGATTGGGAAGACTAATGGAAGGGGCAAAGACTGCGTCTTCTCGGAAATTGTCCTTGAAAACAACTACACAGCTCTGCAGAATGTCAAGTACGAA
                                                  Xl3.1-CHK-1012695146                                                                                                                   CACTCACACTGTGTGTCTCTCAGGAGGTCTCCGAGCCTCTCAGTCAGCTTCTAGTGTTATTGGCCGGTGGGGTCGGCGCTGCTGGTGCAGACAAGGAGCAAGTCTTACTCATCAACACTTTCATCATCAGCTCAGACACACCAAGCGCTGCCGCTGCCTTCAACCCAACACAACGTCATTTTGGAAGCGAGAGAGAGAGAGAAAGTGATCCTCCCAGGTTGGGAAGTAACTCGCCTCCTTGTCGCTACTTCTGTCTGACTTTGCGCTCGCTCCAACCTGACAGCGCCGCTCCTGCACCTCCTGCACATCGGGACCCCGGGCCGGACAGTAGCGCAACACTCGGACAATTGTCACCGGCGCATCTTGCTCTTGAGAGGCGTGAGCTCCGCACCGACTACTGCAGCAGCCACAGCAGCACCGGACGGATTGTTGTATTATTATTATTATTTGTGCGCTGACGACTGGGAGTGCAGCGACTTTCTACTCCTCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCCTCCAGACTCGGCTGCCGGGCCAAGGGAATGGGCGGAGGAATCTGCCGGAGCTCCCGGGACTAGTGAAACGGCACCTTCCCCTATTGCTGCTGCTGCTGCTGGTGCTACTGGGCTAATCACCCGCCGCTTCTCTGCAATCCAACTGGCAACTGAGCAACATGAACTACATCACCTCCATCCTGGGCTATCTGTTACTGCACCTGTTTGTCATCTGCCTACAAGCCCAGGTAACTGTTCAGTCCCCACCTAATTTTACACAGCATGTGAGGGAGCAGAGCCTGGTGACCGACCAACTAAGCCGACGGCTCATCCGAACCTACCAGTTGTACAGCCGGACCAGCGGCAAGCATGTGCAAATCCTGGCGAACAAGAAGATTAACGCCATGGCAGAAGACGGCGACCCACACGCCAAGTTAATCGTGGAAACAGATACGTTTGGAAGCAGAGTTCGCATTAAAGGTGCGGAGACTGGTTACTACATCTGCATGAACAAAAAAGGGAAGCTGATTGGGAAGACTAATGGAAGGGGCAAAGACTGCGTCTTCTCGGAAATTGTCCTTGAAAACAACTACACAGCTCTGCAGAATGTCAAGTACGAAGGCTGG
                                                      consensus depths                                                                                                                  4     5     4     5     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     7     6     7     6     7     6     7     7     9     7     8     7     8     7     8     7     8     7     8     6     8     6     8     6     8     6     8     6     8     7     8     5     8     3     8     3     8     3     8     3     8     2     7     3     7     2     7     3     8     3     8     3     7     3     7     3     6     3     6     3     5     3     5     3     4     3     4     3     4     3     4     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG     687      73                                                                                                             
                                               BLH MIN     687      59                                                                                                             
                                               BLH MPR     141      59                                                                                                             
                                               BLH OVR     687     166                                                                                                             
                                               CDS MIN     687      59                                                                                                             
                                               EST CLI      -9       1                                                                                                             
                                               ORF LNG     687       4                                                                                                             
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ci ---- 6e-015     NP_001027648.1 fibroblast growth factor 8/17/18 [Ciona intestinalis] ========================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Cf ---- 8e-055     XP_851783.1 PREDICTED: similar to fibroblast growth factor 8 isoform E precursor [Canis familiaris] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Mm ---- 3e-055     NP_034335.1 fibroblast growth factor 8 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                PREDICTED - Bt ---- 2e-055     XP_612205.2 PREDICTED: similar to fibroblast growth factor 8 isoform E precursor [Bos taurus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Dr ==== 6e-066     NP_571356.2 fibroblast growth factor 8 [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Hs ==== 9e-068     NP_006110.1 fibroblast growth factor 8 isoform B precursor [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Gg ==== 2e-070     NP_001012785.1 fibroblast growth factor 8 [Gallus gallus] ================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Xt ==== 1e-078     NP_001008163.1 fgf8-prov protein [Xenopus tropicalis] ====================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Xl ==== 3e-080     NP_001083904.1 fibroblast growth factor-8b [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-XL186k22.5                                                                                                                                                                      TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                              ...
  5   1   2       bld Emb1                            IMAGE:6631568.5p TTCCGGACAAGAGGAGGGACAAGGGCTGATCGCTGGCAATCACTTCACTTACTGCTCAATGAGACAGCGGCCAacacactcactcactcactcacactctcagagactcacacacactcacactgtgtctctctcaggaggtctccgagcctctcaGTCAGCTTCTAGTGTTATTGGCCGGTGGGGTCGGCGCTGCTGGTGCAGACAAGGAGCAAGTCTTACTCATCAACACTTTCATCATCAGCTCAGACACACCAAGCGCTGCCGCTGCCTTCAACCCAACACAACGTCATTTTGGAAGCgagagagagagagaAAGTGATCCTCCCAGGTTGGGAAGTAACTCGCCTCCTTGTCGCTACTTCTGTCTGACTTTGCGCTCGCTCCAACCTGACAGCGCCGCTCCTGCACCTCCTGCACATCGGGACCCCGGGCCGGACAGTAGCGCAACACTCGGACAATTGTCACCGGCGCATCTTGCTCTTGAGAGGCGTGAGCTCCGCACCGACTACTGCAGCAGCCACAGCAGCACCGGACGGATTGTTGtattattattattattTGTGCGCTGACGACTGGGAGTGCAGCGACTTTCTACTCCTCCCCGTCTCCCTGGCTGTGGCTCGGTCCCCTCTCCTCCAGACTCGGCTGCCGGGCCAAGGGAAATGGGCGGAGGAATCTGCCGGGAAACTCCCCGGGGAACAAATGGAAAAAGGGGCCCTTTCCCCCAAAATTTTGGCTGCCTGCCTccccccccTAGGGGGGCGGGACAAACATAAGGGGGAAAAAAATATAAAACAACCTGGGCCCCACCCCCCTATACTTGTTTTCACTTTCAGTGCCCCAGAATAACAGGAACATAATGAAAAACCCATTGCGCGTATGTCACCCAAACATAAAATAACCACAC
  5   1   2       bld Brn1 5g3  out                   IMAGE:6956348.5p                                                                         GGCTGGTACCGGTCCGGATTCTCCGGATCTCTAGAGACTCACACACACTTCACTGTGTCTCTCAGGAGGTCTCCGAGCCTCTCAGTCAGCTTCTAGTGTTATTGGCCGGTGGGGTCGGCGCTGCTGGTGCAGACAAGGAGCAAGTCTTACTCATCAACACTTTCATCATCAGCTCAGACACACCAAGCGCTGCCGCTGCCTTCAACCCAACACAACGTCATTTTGGAAGCgagagagagagagaAAGTGATCCTCCCAGGTTGGGAAGTAACTCGCCTCCTTGTCGCTACTTCTGTCTGACTTTGCGCTCGCTCCAACCTGACAGCGCCGCTCCTGCACCTCCTGCACATCGGGACCCCGGGCCGGACAGTAGCGCAACACTCGGACAATTGTCACCGGCGCATCTTGCTCTTGAGAGGCGTGAGCTCCGCACCGACTACTGCAGCAGCCACAGCAGCACCGGACGGATTGTTGtattattattattattTGTGCGCTGACGACTGGGAGTGCAGCGACTTTCTACTCCTCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCCTCCAGACTCGGCTGCCGGGCCAAGGGAATGGGCGGAGGAATCTGCCGGAGCTCCCGGGACTAGTGAAACGGCACCTTCCCCTATtgctgctgctgctgctggtgctACTGGGCTAATCACCCGCCGCTTCTCTGCAATCCAACTGGCCACTGAGCAACATGAAACTACATTCCCCTCCATTCTGGGGCCTATCCTGTTACTGGCACCTGGTTTGGCCATTTGGCCCTACAAGCCCCAGCATGTGGAGGGGAGCAAAAAGCCCGGGGTGGACGGAACCAAACTTAAAGCCCGAAGGGGCTNCATTCCCGAAACCTTACCCAAGTTGGTAACAGGCCGGGGACCCAACCGGGGCAAAGCCATGGGTGGCCA
  5   1   2       bld Tbd2                            IMAGE:3201212.5p                                                                                                   CTCTCAGAGACTCACACACACTCACACTGTGTCTCTCAGGAGGTCTCCGAGCCTCTCAGTCAGCTTCTAGTGTTATTGGCCGGTGGGGTCGGCGCTGCTGGTGCAGACAAGGAGCAAGTCTTACTCATCAACACTTTCATCATCAGCTCAGACACACCAAGCGCTGCCGCTGCCTTCAACCCAACACAACGTCATTTTGGAAGCgagagagagagagagaAAGTGATCCTCCCAGGTTGGGAAGTAACTCGCCTCCTTGTCGCTACTTCTGTCTGACTTTGCGCTCGCTCCAACCTGACAGCGCCGCTCCTGCACCTCCTGCACATCGGGACCCGGGCCGGACAGTAGCGCAACACTCGGACAATTGTCACCGGCGCATCTTGCTCTTGAGAGGCGTGAGCTCCGCACCGACTACTGCAGCAGCCACAGCAGCACCGGACGGATTGTTGtattattattattattTGTGCGCTGACGACTGNGAGTGCAGCGACTTTCTACTCCTCCCCGTCT
  5   1   2       bld Neu4      out                   IMAGE:3475540.5p                                                                                                    TCTCAGAGACTCACACACACTCACACTGTGTCTCTCAGGAGGTCTCCGAGCCTCTCAGTCAGCTTCTAGTGTTATTGGCCGGTGGGGTCGGCGCTGCTGGTGCAGACAAGGAGCAAGTCTTACTCATCAACACTTTCATCATCAGCTCAGACACACCAAGCGCTGCCGCTGCCTTCAACCCAACACAACGTCATTTTGGAAGCgagagagagagagagaAAGTGATCCTCCCAGGTTGGGAAGTAACTCGCCTCCTTGTCGCTACTTCTGTCTGACTTTGCGCTCGCTCCAACCTGACAGCGCCGCTCCTGCACCTCCTGCACATCGGGACCCGGGCCGGACAGTAGCGCAACACTCGGACAATTGTCACCGGCGCATCTTGCTCTTGAGAGGCGTGAGCTCCGCACCGACTACTGCAGCAGCCACAGCAGCACCGGACGGAT
  5   1   2       bld Em10 5g                         IMAGE:7979693.5p                                                                                                     CAGAGACTCACACACACTCACACTGTGTCTCTCTCAGGAGGTCTCCGAGCCTCTCAGTCAGCTTCTAGTGTTATTGGCCGGTGGGGTCGGCGCTGCTGGTGCAGACAAGGAGCAAGTCTTACTCATCAACACTTTCATCATCAGCTCAGACACACCAAGCGCTGCCGCTGCCTTCAACCCAACACAACGTCATTTTGGAAGCgagagagagagagaAAGTGATCCTCCCAGGTTGGGAAGTAACTCGCCTCCTTGTCGCTACTTCTGTCTGACTTTGCGCTCGCTCCAACCTGACAGCGCCGCTCCTGCACCTCCTGCACATCGGGACCCCGGGCCGGACAGTAGCGCAACACTCGGACAATTGTCACCGGCGCATCTTGCTCTTGAGAGGCGTGAGCTCCGCACCGACTACTGCAGCAGCCACAGCAGCACCGGACGGATTGTTGtattattattattattTGTGCGCTGACGACTGGGAGTGCAGCGACTTTCTACTCCTCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCCTCCAGACTCGGCTGCCGGGCCAAGGGAATGGGCGGAGGAATCTGCCGGAGCTCCCGGGACTAGTGAAACGGCACCTTCCCCTATtgctgctgctgctgctgctgGTGCTACTGGGCTAATCACCCGCCGCTTCTCTGCATCCAACTGGCAACTGAGCACATGACTACATCACCTCCATCTGGCTATTGTTATGCACTGTTGTCTCTGCTACAGCCAGCTGTGAGGAGCGAGCTGTGACGACATTACCGACGTATCGACCTCAGTGTACGCGACACGAAGTGTCATCTGCAAAAA
  5   1   2       bld Em10 5g                         IMAGE:7978957.5p                                                                                                                           CACTGTGTCTCTCAGGAGGTCTCCGAGCCTCTCAGTCAGCTTCTAGTGTTATTGGCCGGTGGTGTCGGCGCTGCTGGTGCAGACAAGGAGCAAGTCTTACTCATCAACACTTTCATCATCAGCTCAGACACACCAAGCGCTGCCGCTGCCTTCAACCCAACACAACGTCATTTTGGAAGCgagagagagagagaAAGTGATCCTCCCAGGTTGGGAAGTAACTCGCCTCCTTGTCGCTACTTCTGTCTGACTTTGCGCTCGCTCCAACCTGACAGCGCCGCTCCTGCACCTCCTGCACATCGGGACCCCGGGCCGGACAGTAGCGCAACACTCGGACAATTGTCACCGGCGCATCTTGCTCTTGAGAGGCGTGAGCTCCGCACCGACTACTGCAGCAGCCACAGCAGCACCGGACGGATTGTTGtattattattattattTGTGCGCTGACGACTGGGAGTGCAGCGACTTTCTACTCCTCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCCTCCAGACTCGGCTGCCGGGCCAAGGGAATGGGCGGAGGAATCTGCCGGAGCTCCCGGGACTAGTGAAACGGCACCTTCCCCTATTGCTGCTGCTGGGGCTACTGGGCTAATCACCCGCCGCTTCTCTGCAATCCAACTGGCAACTGAGCAACATGAACTACATCACCTTCATCCTGAGCTATCTGTTAATGCACCTTGTTGTCATCTGCCTACAAGCCCAGAA
  5   1   2       bld Em10                            IMAGE:7982710.5p                                                                                                                           CACTGTGTCTCTCAGGAGGTCTCCGAGCCTCTCAGTCAGCTTCTAGTGTTATTGGCCGGTGGTGTCGGCGCTGCTGGTGCAGACAAGGAGCAAGTCTTACTCATCAACACTTTCATCATCAGCTCAGACACACCAAGCGCTGCCGCTGCCTTCAACCCAACACAACGTCATTTTGGAAGCgagagagagagagaAAGTGATCCTCCCAGGTTGGGAAGTAACTCGCCTCCTTGTCGCTACTTCTGTCTGACTTTGCGCTCGCTCCAACCTGACAGCGCCGCTCCTGCACCTCCTGCACATCGGGACCCCGGGCCGGACAGTAGCGCAACACTCGGACAATTGTCACCGGCGCATCTTGCTCTTGAGAGGCGTGAGCTCCGCACCGACTACTGCAGCAGCCACAGCAGCACCGGACGGATTGTTGtattattattattattTGTGCGCTGACGACTGGGAGTGCAGCGACTTTCTACTCCTCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCCTCCAGACTCGGCTGCCGGGCCAAGGGAATGGGCGGAGGAATCTGCCGGAGCTCCCGGGACTAGTGAAACGGCACCTTCCCCTATTGCTGCTGCTGGTGCTACTGGGCTATCACCCGCCGCTCTCTGAATCCACTGGCACTGAGCAACATGACTACATCACTCATCCTGGCTATCTGTATGCACTGTTGTCTCTGCTACAGCCACATGGAGGAGCAACTGTGACGACAATAGCGACGTCA
  5   1   2      seed Ga12      out                        XL186k22.5p                                                                                                                            ACTGTGTCTCTCAGGAGGTCTCCGAGCCTCTCAGTCAGCTTCTAGTGTTATTGGCCGGTGGGGTCGGCGCTGCTGGTGCAGACAAGGAGCAAGTCTTACTCATCAACACTTTCATCATCAGCTCAGACACACCAAGCGCTGCCGCTGCCTTCAACCCAACACAACGTCATTTTGGAAGCgagagagagagagaAAGTGATCCTCCCAGGTTGGGAAGTAACTCGCCTCCTTGTCGCTACTTCTGTCTGACTTTGCGCTCGCTCCAACCTGACAGCGCCGCTCCTGCACCTCCTGCACATCGGGACCCCGGGCCGGACAGTAGCGCAACACTCGGACAATTGTCACCGGCGCATCTTGCTCTTGAGAGGCGTGAGCTCCGCACCGACTACTGCAGCAGCCACAGCAGCACCGGACGGATTGTTGtattattattattattTGTGCGCTGACGACTGGGAGTGCAGCGACTTTCTACTCCTCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCCTCCAGACTCGGCTGCCGGGCCAAGGGAATGGGCGGAGGAATCTGCCGGAGCTCCCGGGACTAGTGAAACGGCACCTTCCCCTATtgctgctgctgctgctgctgGTGCTACTGGGCTAATCACCCGCCGCTTCTCTGCAATCCAACTGGCAACTGAGC
  5   1   2       bld Tbd3 5g                         IMAGE:3548860.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGAGTGCAGCGACTTTCTACTCCTCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCCTCCAGACTCGGCTGCCGGGCCAAGGGAATGGGCGGAGGAATCTGCCGGAGCTCCCGGGACTAGTGAAACGGCACCTTCCCCTATtgctgctgctgctgctggtgctACTGGGCTAATCACCCGCCGCTTCTCTGCAATCCAACTGGCAACTGAGCAACATGAACTACATCACCTCCATCCTGGGCTATCTGTTACTGCACCTGTTTGTCATCTGCCTACAAGCCCAGGTAACTGTTCAGTCCCCACCTAATTTTACACAGCATGTGAGGGAGCAGAGCCTGGTGACCGACCAACTAAGCCGACGGCTCATCCGAACCTACCAGTTGTACAGCCGGACCAGCGGCAAGCATGTGCAAATCCTGGCGAACAAGAAGATTAACGCCATGGCAGAAGACGGCGACCCACACGCCAAGTTAATCGTGGAAACAGATACGTTTGGAAGCAGAGTTCGCATTAAAGGTGCGGAGACTGGTTACTACATCTGCATGAACAAAAAAGGGAAGCTGATTGNGAAGACTAATGGAAGGCGCAAAGACTGCGTCTTCTCGGAAATTGTCCTTGAAAACAACTACACAGCTCTGCAGAATGTCAAGTACGAAGGGCTGGTTATGGCTNTCACAAGAAGGTNGTCGCCC
  5   1   2       bld Neu4 5g                         IMAGE:4084172.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTTCTACTCCTCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCCTCCAGACTCGGCTGCCGGGCCAAGGGAATGGGCGGAGGAATCTGCCGGAGCTCCCGGGACTAGTGAAACGGCACCTTCCCCTATtgctgctgctgctgctgctgGTGCTACTGGGCTAATCACCCGCCGCTTCTCTGCAATCCAACTGGCAACTGAGCAACATGAACTACATCACCTCCATCCTGGGCTATCTGTTACTGCACCTGTTTGTCATCTGCCTACAAGCCCAGGTAACTGTTCAGTCCCCACCTAATTTTACACAGCATGTGAGGGAGCAGAGCCTGGTGACCGACCAACTAAGCCGACGGCTCATCCGAACCTACCAGTTGTACAGCCGGACCAGCGGCAAGCATGTGCAAATCCTGGCGAACAAGAAGATTAACGCCATGGCAGAAGACGGCGACCCACACGCCAAGTTAATCGTGGAAACAGATACGTTTGGAAGCAGAGTTCGCATTAAAAGT
  5   1   2      skin Emb1                            IMAGE:5156144.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTTCCACAGGTTACTGCACCTGTTTGTCATCTGCCTACAAGCCCAGGTAACTGTTCAGTCCCCACCTAATTTTACACAGCATGTGAGGGAGCAGAGCCTGGTGACCGACCAACTAAGCCGACGGCTCATCCGAACCTACCAGTTGTACAGCCGGACCAGCGGCAAGCATGTGCAAATCCTGGCGAACAAGAAGATTAACGCCATGGCAGAAGACGGCGACCCACACGCCAAGTTAATCGTGGAAACAGATACGTTTGGAAGCAGAGTTCGCATTAAAGGTGCGGAGACTGGTTACTACATCTGCATGAACAAAAAAGGGAAGCTGATTGGGAAGACTAATGGAAGGGGCAAAGACTGCGTCTTCTCGGAAATTGTCCTTGAAAACAACTACACAGCTCTGCAGAATGTCAAGTACGAAGGCTGGTTTATGGCTTTCACAAGAAGGGGTCGCCCAAGGAAAGGGTCGAAGACAAGGCAACATCAAAGAGAAGTCCACTTCATGAAGAGGTTGCCAAAGGGACACCACACCACAGAACCTCATAAACGTTTTGAGTTTATTAATTACCCTTTCCATAGAAAAAGTAAAAGGAACTCGATATTCAAGTTCCTCGGTAGGGACACGGGTTTCTCCCTTACGTTCCACAGAACTTCATAAAAAACAAAACAGAACTACTTCTATGTCTAGTATAAAGATAAGGCATTAAAAACAAAAACTCCGGAACCCACCGTGGTTTTTATCCACTGAAATATCACCCTACAAGATTACCAACATTTTTCTTTGGGTTCTTCAACCATACGAGATGGAACCCAATTCTCTTTTCACCTCCCCTAAAGGAAACCCCTTTTCTCCTTTACTCACAACACACAAACGTGCGCTCGCGCAAAATGGACACCGCAGCGCCTCGTAACCGACACCAAGATTTCTCTCATCCTCTCGCCATGTTCGGGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)