Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:4434804.3                      11 END     1           7        9                (no blast hit)
     2   2.0    0Xl3.1-xl325o19.5                            4 END     1           7       25                nuclear cap binding protein subunit 1, 80kDa [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-xlk101f14ex.5                         4 PI      91        362     1153                MGC80159 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012777221 Xl3.1-IMAGE:4030612.5 - 13 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:4030612.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAAATTCCCTTGAATTATCACATAGTTGAGGTGATCTTTGGAGAGCTGTTTCAGTTACCAACTCCTCCACATATCGATGTCATGTACACTACACTTCTAATTGAACTTTGCAAACTGCAACCTGGATCGTTACCACAAGTTCTTGCACAAGCCTCTGAAATGTTGTATACACGCCTGGATACGATGAACACAATTTGTATTGACAGGTTTATAAACTGGTTTTCACACCATCTTTCAAACTTTCAATTTAGATGGAACTGGGAGGACTGGGCAGACTGTCTTTCTCAAGACTTGAATAAACCAAAACCACAATTTGTTCGTGAAGTGCTAGAAAAATGTATGAGGCTTTCCTATCACCAGAGAATATTGGACATTGTACCTGCAACATTTTCTGCATTATATCCAGCCAGTCCCTCCTGTGTATTTAAATATGGTGATGAGAGTAACAGTGCTTTGCCTGGATATTCTGTTGCTGTCACTTTGACAAATGAAATTAAAAATAAAGCAAGCGACAAAGAGATTTTTAACATTTTAAAAGATATCCCTAATCCTAATCAAGATGACGACGATGATGAAGGAATCAGCTTTAATCCACTTAAAATTGAGGTTTTTGTACAAAGCCTGCTTAATCTGGCATCAAAGTCCTTCAGTCATGCCTTTAGTGCTCTTGCAAAGTTTCATGACATCTTTAAAGCATTATCTGAGAGTGATGAAGGGAAACTTCATATTCTAAGAGTCGCTTATGACGTCTGGAAAAATCACCCACAGATGATTGCTGTGTTAGTGGATAAGATGATCCGAACACAAATTGTTGACTGTGCAGCAGTGGCAAATTGGATCTTCTCCCCAGAGTTATCACATGACTTCACCAGGTTTTATATTTGGGAAATATTGCACTCTACAATTCGGAAAATGAATAAACATGTCCAGAAAATCCAAAAAGAGCTGGAAGAAACTAAGCAAAGGCTAGCTAAACAGCATAAACATAGAGACAGTGATGACAACGATGAAGACAGTGGAAGAAAAGATGGTCCTTTAGAAGAACAAATTGAGCGATTGCAAGAGAAAGTGGAGTCCGCTCAGAGTGAACAAAAGAACTTGTTCCTTGTCATTTTCCAGAGGTTTATCATGATACTTACGGAACACTTAGTACCTCGGCCGCGCGGAGGTATTGATGTGAATACTGCTTGGTATAAGAACTGCAGAGAGAGACTTCAGCAGATATTTCTACAGCATCATCAGACAATCCAGCAGTATATGGTGACCCTGGAAAACCTCTTGTTCACAGCAGAACTGGACCATCACATTCTGACTGTCTTCCAGCAGTTTTGTGCATTACAGTCTTAATGAACCCTGCTCTGGAGTTTGTTTTTACACCCACAGCTGCCTTCTAGGGCTGGAATGTTATTAGGAAAAGACATTTTTGG
                                                  Xl3.1-CHK-1012693470                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCCTTGAATTATCACATAGTTGAGGTGATCTTTGGAGAGCTGTTTCAGTTACCAACTCCTCCACATATCGATGTCATGTACACTACACTTCTAATTGAACTTTGCAAACTGCAACCTGGATCGTTACCACAAGTTCTTGCACAAGCCTCTGAAATGTTGTATACACGCCTGGATACGATGAACACAATTTGTATTGACAGGTTTATAAACTGGTTTTCACACCATCTTTCAAACTTTCAATTTAGATGGAACTGGGAGGACTGGGCAGACTGTCTTTCTCAAGACTTGAATAAACCAAAACCACAATTTGTTCGTGAAGTGCTAGAAAAATGTATGAGGCTTTCCTATCACCAGAGAATATTGGACATTGTACCTGCAACATTTTCTGCATTATATCCAGCCAGTCCCTCCTGTGTATTTAAATATGGTGATGAGAGTAACAGTGCTTTGCCTGGATATTCTGTTGCTGTCACTTTGACAAATGAAATTAAAAATAAAGCAAGCGACAAAGAGATTTTTAACATTTTAAAAGATATCCCTAATCCTAATCAAGATGACGACGATGATGAAGGAATCAGCTTTAATCCACTTAAAATTGAGGTTTTTGTACAAAGCCTGCTTAATCTGGCATCAAAGTCCTTCAGTCATGCCTTTAGTGCTCTTGCAAAGTTTCATGACATCTTTAAAGCATTATCTGAGAGTGATGAAGGGAAACTTCATATTCTAAGAGTCGCTTATGACGTCTGGAAAAATCACCCACAGATGATTGCTGTGTTAGTGGATAAGATGATCCGAACACAAATTGTTGACTGTGCAGCAGTGGCAAATTGGATCTTCTCCCCAGAGTTATCACATGACTTCACCAGGTTTTATATTTGGGAAATATTGCACTCTACAATTCGGAAAATGAATAAACATGTCCAGAAAATCCAAAAAGAGCTGGAAGAAACTAAGCAAAGGCTAGCTAAACAGCATAAACATAGAGACAGTGATGACAACGATGAAGACAGTGGAAGAAAAGATGGTCCTTTAGAAGAACAAATTGAGCGATTGCAAGAGAAAGTGGAGTCCGCTCAGAGTGAACAAAAGAACTTGTTCCTTGTCATTTTCCAGAGGTTTATCATGATACTTACGGAACACTTAGTACCTCGxxxxxxCGGAGGTATTGATGTGAATACTGCTTGGTATAAGAACTGCAGAGAGAGACTTCAGCAGATATTTCTACAGCATCATCAGACAATCCAGCAGTATATGGTGACCCTGGAAAACCTCTTGTTCACAGCAGAACTGGACCATCACATTCTGACTGTCTTCCAGCAGTTTTGTGCATTACAGTCTTAATGAACCCTGCTCTGGAGTTTGTTTTTACACCCACAGCTGCCTTCTAGGGCTGGAATGTTATTAGGAAAAGACATTTTTGGTCAGTA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     4     5     4     5     5     5     6     6     5     6     5     6     5     6     5     6     5     6     6     6     6     6     7     7     7     7     7     7     6     7     6     7     7     7     6     7     7     7     7     7     7     7     7     7     6     7     7     7     7     7     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7    10     7    10     9    10     9    10     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     7     9     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     6     7     6     8     6     7     7     7     5     6     5     6     5     6     5     6     5     6     5     6     6     7     6     7     6     7     6     7     6     7     6     7     6     7     4     6     4     5     4     5     4     5     2     5     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------C-----
                                                                       ...PROTEIN --- At ---- 1e-045     NP_565356.1 mRNA cap-binding protein (ABH1) [Arabidopsis thaliana] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Os ---- 2e-049     NP_001050097.1 Os03g0347200 [Oryza sativa (japonica cultivar-group)] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 9e-069     NP_491850.2 MIF4G domain containing protein (92.5 kD) [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ag ---- 3e-140     XP_321964.4 AGAP001195-PA [Anopheles gambiae str. PEST] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 1e-143     XP_001187494.1 PREDICTED: similar to Nuclear cap-binding protein subunit 1 (80 kDa nuclear cap-binding protein) (NCBP 80 kDa subunit) (CBP80), partial [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 2e-147     NP_524750.2 cap binding protein 80 CG7035-PB [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 0          NP_001028373.2 nuclear cap binding protein subunit 1, 80kDa [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Cf ---- 0          XP_867088.1 PREDICTED: similar to 80 kDa nuclear cap binding protein (NCBP 80 kDa subunit) (CBP80) isoform 2 [Canis familiaris] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_002477.1 nuclear cap binding protein subunit 1, 80kDa; nuclear cap binding protein, 80kD;nuclear cap binding protein 1, 80kD; nuclear cap binding protein subunit 1, 80kD[Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 0          NP_001026611.1 nuclear cap binding protein subunit 1, 80kDa [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 0          CAJ83816.1 nuclear cap binding protein subunit 1, 80kDa [Xenopus tropicalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 0          NP_001085510.1 MGC80276 protein [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:4030612.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATG---------------------------------------------------------------------------ATG---------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG---------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------TAATGA---------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
  5   1   2       add Oo1                             IMAGE:6857547.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTGTTATAGAAGAAAATCTGCACTGTATACTTAAATCACATTGGCGTGAAAGGAAAACATGTGCTGCTCAGCTGTTAAGCTACCCAGAGAAGAACAAAATTCCCTTGAACTATCACATAGTTGAGGTGATCTTTGGAGAGCTGTTTCAGTTACCTTCTCCACCACAGATTGACGTCATGTATACTACACTTCTAATCGAACTTTGCAAACTGCAACCTGGATCTTTGCCACAAGTGCTTGCACAAGCCTCTGAAATGTTGTATACACGCTTGGATACGATGAACACAACTTGTATTGACAGGTTTATAAACTGGTTTTCACACCATCTAAGCAACTTTCAATTCAGGTGGAACTGGGAGGACTGGGCAGACTGTCTTTCTCAAGACTTAGATAAACCAAAACCACAATTTGTTCGTGAAGTACTCGAGAAATGCATGAGGCTTTCATACCACCAGAGAATATTGGACATTGTACCTGCAACATTTTCTGCATTATATCCAGCTAATCCCTCCAATGTGATCAAATATGGTGATGAGAGCAACAGTGCTTTGCCTGGATACTCTGTTGCTGTTATTTTGACAAATGCAATTAAAAATAAAGCAAGCGATAAAGAGATTTTTAACATTTTAAAAGATATCCCCTAATCCTAATCAAGATGACGATGATGATGAAAGGAATCGGGTTTTAATCCACTTAAAGAATGGAGGGTTTTTGTACCAGAACCCTGCCTTAATCTAGCCATCCAAGGTCCTTTAAGTCAACTCCTTTTAATGGCTCCTTGGCAAAGGTTCCTTGGACATTCTTTTAAAGCCTTTAATCCGGAAAAGTGGATGGAAAGGGAAACCTTCCATAATTCCCAAAGAACCCGGTTTATGGACGGTTTGGGGAAAAAATCACCCCGCCA
  5   1   2       bld Int2                            IMAGE:8822875.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAACCGGCAGGGCGCTATCGGGGCGCCTCGTATTCGTCCCAGAAGAACAAAATTCCCTTGAATTATCACATAGTTGAGGTGATCTTTGGAGAGCTGTTTCAGTTACCAACTCCTCCACATATCGATGTCATGTACACTACACTTCTAATTGAACTTTGCAAACTGCAACCTGGATCGTTACCACAAGTTCTTGCACAAGCCTCTGAAATGTTGTATACACGCCTGGATACGATGAACACAATTTGTATTGACAGGTTTATAAACTGGTTTTCACACCATCTTTCAAACTTTCAATTTAGATGGAACTGGGAGGACTGGGCAGACTGTCTTTCTCAAGACTTGAATAAACCAAAACCACAATTTGTTCGTGAAGTGCTAGAAAAATGTATGAGGCTTTCCTATCACCAGAGAATATTGGACATTGTACCTGCAACATTTTCTGCATTATATCCAGCCAGTCCCTCCTGTGTATTTAAATATGGTGATGAGAGTAACAGTGCTTTGCCTGGATATTCTGTTGCTGTCACTTTGACAAATGAAATTAAAAATAAAGCAAGCGACAAAGAGATTTTTAACATTTTAAAAGATATCCCTAATCCTAATCAAGATGACGACGATGATGAAGGAATCAGCTTTAATCCACTTAAAATTGAGGTTTTTGTACAAAGCCTGCTTAATCTGGCATCAAAGTCCTTCAGTCATGCCTTTAGTGCTCTTGCAAAGTTTCATGACATCTTTAAAGCATTATCTGAGAGTGATGAAGGGAAACTTCATATTCTAAGAGTCGCTTATGACGTCTGGAAAAATCACCCACAGATGATTGCTGTGTTAGTGGATAGATGATCCGAACACAATGTGACTGTGCAGCAGTGGCAAATTGATCTTCTCCCAGAGTTATTCCACATGACTCACAAGTTTATATGGGAATATGCACTCCTACATCGGAAAATGAATTAACATGTTCCAGAAAAATC
  5   1   2       bld Neu7      out                        XL020c02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAACTGTTAAGCTACCCAGNNNAAGAACAAAATTCCCTTGAATTATCACATAGTTGAGGTGATCTTTGGAGAGCTGTTTCAGTTACCAACTCCTCCACATATCGATGTCATGTACACTACACTTCTAATTGAACTTTGCAAACTGCAACCTGGATCGTTACCACAAGTTCTTGCACAAGCCTCTGAAATGTTGTATACACGCCTGGATACGATGAACACAATTTGTATTGACAGGTTTATAAACTGGTTTTCACACCATCTTTCAAACTTTCAATTTAGATGGAACTGGGAGGACTGGGCAGACTGTCTTTCTCAAGACTTGAATAAACCAAAACCACAATTTGTTCGTGAAGTGCTAGAAAAATGTATGAGGCTTTCCTATCACCAGAGAATATTGGACATTGTACCTGCAACATTTTCTGCATTATATCCAGCCAGTCCCTCCTGTGTATTTAAATATGGTGATGAGAGTAACAGTGCTTTGCCTGGATATTCTGTTGCTGTCACTTTGACAAATGAAATTAAAAATAAAGCAAGCGACAAAGAGATTTTTAACATTTTAAAAGATATCCCTAATCCTAATCAAGATGACGACGATGATGAAGGAATCAGCTT
  5   1   2       bld DMZ                                  xl249p02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTTGAATTATCACATAGTTGAGGTGATCTTTGGAGAGCTGTTTCAGTTACCAACTCCTCCACATATCGATGTCATGTACACTACACTTCTAATTGAACTTTGCAAACTGCAACCTGGATCGTTACCACAAGTTCTTGCACAAGCCTCTGAAATGTTGTATACACGCCTGGATACGATGAACACAATTTGTATTGACAGGTTTATAAACTGGTTTTCACACCATCTTTCAAACTTTCAATTTAGATGGAACTGGGAGGACTGGGCAGACTGTCTTTCTCAAGACTTGAATAAACCAAAACCACAATTTGTTCGTGAAGTGCTAGAAAAATGTATGAGGCTTTCCTATCACCAGAGAATATTGGACATTGTACCTGCAACATTTTCTGCATTATATCCAGCCAGTCCCTCCTGTGTATTTAAATATGGTGATGAGAGTAACAGTGCTTTGCCTGGATATTCTGTTGCTGTCACTTTGACAAATGAAATTAAAAATAAAGCAAGCGACAAAGAGATTTTTAACATTTTAAAAGATATCCCTAATCCTAATCAAGATGACGACGATGATGAAGGAATCAGCTTTAATCCACTTAAAATTGAGGTTTTTGTACAAAGCCTGCTTAATCTGGCATCAAAGTCCTTCAGTCATGCCTTTAGTGCTCTTGCAAAGTTTCATGACATCTTTAAAGCATTATCTGAG
  5   1   2       bld Kid                             IMAGE:4030612.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CACGCGTCCGCGGACGCGTGGGAACTGGGAGGACTGGGCAGACTGTCTTTCTCAAGACTTGATAAACCAAAACCACAATTTGTTCGTGAAGGGCTAAAAAAATGGTATGAGGCTTTCCTATCACCAAAGAATATTGGACATTGTACCTGCAACATTTTCTGCATTATATCCAGCCAGTCCCTCCTGGGTATTTAAATATGGTGATGAGAGTAACAGGGCTTTGCCTGGATATTCTGTTGCTGTCACTTTGACAAATGAAATTAAAAATAAAGCAAGCGACAAAGAGATTTTTAACATTTTAAAAGATATCCCTAATCCTAATCAAGATGACGACGATGATGAAGGAATCAGCTTTAATCCACTTAAAATTGAGGTTTTTGTACAAAGCCTGCTTAATCTGGCATCAAAGTCCTTCAGTCATGCCTTTAGTGCTCTTGCAAAGTTTCATGACATCTTTAAAGCATTATCTGAGAGTGATGAAGGGAAACTTCATATTCTAAGAGTCGCTTATGACGTCTGGAAAAATCACCCACAGATGATTGCTGTGTTAGTGGATAAGATGATCCGAACACAAATTGTTGACTGTGCAGCAGTGGCAAATTGGATCTTCTCCCCAGAGTTATCACATGACTTCACCAGGTTTTATATTTGGGAAATATTGCACTCTACAATTCGGAAAATGAATAAACATGTCCAGAAAATCCAAAAAGAGCTGGGAAGAAACTAAGCAAAGGCTAGCTAAACAGCATAAACATAGAGACAGTGATGACAACGATGAAGACAGTGGGAAGAAAAGATGGCCCTTTAAGAAAAACAAATTGACCGATTGCAAGAGAAAGTGGAGTCCCGCTCAGAGTGGACCAAAAGAACTTGGTCCTTGCCAATTTCCCAGAGGTTTATCCTGATACTTACGGAAACCCTTATTACGCTGGG
  5   1   2       bld DMZ       out                        xl299l03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGTCTTTCTCAAGACTTGAATAAACCAAAACCACAATTTGTTCGTGAAGTGCTAGAAAAATGTATGAGGCTTTCCTATCACCAGAGAATATTGGACATTGTACCTGCAACATTTTCTGCATTATATCCNGCCAGTCCCTCCTGTGTATTTAAATATGGTGATGAGAGTAACAGTGCTTTGCCTGGATATTCTGTTGCTGTCACTTTGACAAATGAAATTAANAATAAAGCAAGCGACNAAGAGATTTTTAACATTTTAAAAGATATCCCTAATCCTAATCAAGATGACGACGATGATGAAGGAATCAGCTTTAATCCACTTAAAATTGAGGTTTTTGTACAAAGCCTGCTTAATCTGGCATCANAGTCCTTCAGTCATGCCTTTAGTGCTCTTGCAAAGTTTCATGACATCTTTAAAGCATTATCTGAGAGTGATGAAGGGAAACTTCATATTCTAAGAGTCGCTTATGACGTCTGGAAAAATCACCCACAGATGATTGCTGTGTTAGTGGATAAGATGATCCGAACACAAATTGTTGACTGTGCAGCAGTGGCAAATTGGATCTTCTCCCCAGAGTTATCACATGACTTCACCAGGNTTTATATTTGGGAAATATTGCACTCTACNA
  5   1   2      seed Neu7                                 XL042i15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCACGAGGGGACATTGTACCTGCAACATTTTCTGCATTATATCCAGCCAGTCCCTCCTGTGTATTTAAATATGGTGATGAGAGTAACAGTGCTTTGCCTGGATATTCTGTTGCTGTCACTTTGACAAATGAAATTAAAAATAAAGCAAGCGACAAAGAGATTTTTAACATTTTAAAAGATATCCCTAATCCTAATCAAGATGACGACGATGATGAAGGAATCAGCTTTAATCCACTTAAAATTGAGGTTTTTGTACAAAGCCTGCTTAATCTGGCATCAAAGTCCTTCAGTCATGCCTTTAGTGCTCTTGCAAAGTTTCATGACATCTTTAAAGCATTATCTGAGAGTGATGAAGGGAAACTTCATATTCTAAGAGTCGCTTATGACGTCTGGAAAAATCACCCACAGATGATTGCTGTGTTAGTGGATAAGATGATCCGAACACAAATTGTTGACTGTGCAGCAGTGGCAAATTGGATCTTCTCCCCAGAGTTATCACATGACTTCACCAGGTTTTATATTTGGGAAATATTGCACTCTACAATTCGGAAAATGAATAAACATGTCCAGAAAATCCAAAAAGAGCTGGAAGAAAC
  5   1   2       bld Emb4                            IMAGE:4680824.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTAAAAGATATCCCTAATCCTAATCAAGATGACGACGATGATGAAGGAATCAGCTTTAATCCACTTAAAATTGAGGTTTTTGTACAAAGCCTGCTTAATCTGGCATCAAAGTCCTTCAGTCATGCCTTTAGTGCTCTTGCAAAGTTTCATGACATCTTTAAAGCATTATCTGAGAGTGATGAAGGGAAACTTCATATTCTAAGAGTCGCTTATGACGTCTGGAAAAATCACCCACAGATGATTGCTGTGTTAGTGGATAAGATGATCCGAACACAAATTGTTGACTGTGCAGCAGTGGCAAATTGGATCTTCTCCCCAGAGTTATCACATGACTTCACCAGGTTTTATATTTGGGAAATATTGCACTCTACAATTCGGAAAATGAATAAACATGTCCAGAAAATCCAAAAAGAGCTGGAAGAAACTAAGCAAAGGCTAGCTAAACAGCATAAACATAGAGACAGTGATGACAACGATGAAGACAGTGGAAGAAAAGATGGTCCTTTAGAAAGACAAATTGAGCGATTGCAAGAGAAAGTGGAGTCCGCTCAGAGTGAACAAAAGAACTTGTTTCTTGTCATTTTT
  5   1   2       bld Egg1                               PBX0121E08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGCTTTAATCCACTTAAAATTGAGGTTTTTGTACAAAGCCTGCTTAATCTGGCATCAAAGTCCTTCAGTCATGCCTTTAGTGCTCTTGCAAAGTTTCATGACATCTTTAAAGCATTATCTGAGAGTGATGAAGGGAAACTTCATATTCTAAGAGTCGCTTATGACGTCTGGAAAAATCACCCACAGATGATTGCTGTGTTAGTGGATAAGATGATCCGAACACAAATTGTTGACTGTGCAGCAGTGGCAAACTGGATCTTCTCCCCAGAGTTATCACATGACTTCACCAGGTTTTATATTTGGGAAATATTGCACTCTACAATTCGGAAAATGAATAAACATGTCCAGAAAATCCAAAAAGAGCTGGAAGAAACTAAGCAAAGGCTAGCTAAACAGCATAAACATAGAGACAGTGATGACAACGATGAAGACAGTGGAAGAAAAGATGGTCCTTTAGAAGAACAAATTGAGCGATTGCAAGAGAAAGTGGAGTCCGCTCAGAGTGAACAAAAGAACTTGTTCCTTGTCAT
  5   1   2       bld Ooc6                                Ooc6-3270.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAGTCCTTCAGTCATGCCTTTAGTGCTCTTGCAAGTTTCATGACATCTTTAAAGCATTATCTGAGAGTGATGAAGGGAAACTTCATATTCTAAGAGTCGCTTATGACGTCTGGAAAAATCACCCACAGATGATTGCTGTGTTAGTGGATAAGATGATCCGAACACAAATTGTTGACTGTGCAGCAGTGGCAAACTGGATCTTCTCCCCAGAGTTATCACATGACTTCACCAGGTTTTATATTTGGGAAATATTGCACTCTACAATTCGGAAAATGAATAAACATGTCCAGAAAATCCAAAAAGAGCTGGAAGAAACTAAGCAAAGGCTAGCTAAACAGCATAAACATAGAGACAGTGATGACAACGATGAAGACAGTGGAAGAAAAGATGGTCCTTTAGAAGAACAAATTGAGCGATTGCAAGAGAAAGTGGAGTCCGCTCAGAGTGAACAAAAGAACTTGTTCCTTGTCATTTTCCAGAGGTTTATCATGATACTTACGGAACACTTAGTACCTCGGCCGCGACCAC
  5   1   2       bld Ooc6                                Ooc6-3542.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGTCCTTCAGTCATGCCTTTAGTGCTCTTGCAAGTTTCATGACATCTTTAACGCATTATCTGAGAGTGATGAAGGGAAACTTCATATTCTAAGAGTCGCTTATGACGTCTGGAAAAATCACCCACAGATGATTGCTGTGTTAGTGGATAAGATGATCCGAACACAAATTGTTGACTGTGCAGCAGTGGCAAACTGGATCTTCTCCCCAGAGTTATCACATGACTTCACCAGGTTTTATATTTGGGAAATATTGCACTCTACAATTCGGAAAATGAATAAACATGTCCAGAAAATCCAAAAAGAGCTGGAAGAAACTAAGCAAAGGCTAGCTAAACAGCATAAACATAGAGACAGTGATGACAACGATGAAGACAGTGGAAGAAAAGATGGTCCTTTAGAAGAACAAATTGAGCGATTGCAAGAGAAAGTGGAGTCCGCTCAGAGTGAACAAAAGAACTTGTTCCTTGTCATTTTCCAGAGGTTTATCATGATACTTACGGAACACTTAGTACCTCGGCCGCGACCAC
  3   1   2       add DMZ  5g3  out                        xl325o19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTCGGAAAATGAATNAACATGTTCAGAAAATCCAAAAAAGAGCTGGAAGACACTAAGCAAAGGCTAGCTAAACAGCATAAACATAGAGACAGTGATGACAATGATGAAGACAGTGGAAGAAAAGATGGTCCTTTAGAAGAACAAATTGAGCGATTGCAAGAGAAAGTAGAGTCTGCTCAGAGTGAGCAAAAGAATTTGTTCCTTGTAATTTTCCAGAGGTTTATCATGATACTTACAGAACACTTAGTACGATGTGAAACCGGAGGTATTGATGTGAATACTGCTTGGTATAAGAACTGCAGAGAGAGACTTCAGCAGATATTTCTACAGCATCATCAGACAATCCAGCAGTATATGGTGACCCTGGAAAACCTCTTGTTCACAGCAGAACTGGACCATCACATTCTGACTGTCTTCCAGCAGTTTTGTGCATTACAGTCTTAATGAACCCTGCTCTGGAGTTTGTTTTTACACCCACAGCTGCCTTCTAGGGCTGGAATGTTATTAGGAAAAGACATTTTTGGTCAGTAACACTGAGAATGTGATTGCTAGTAGAGGAAAAGCCATCATTTGCAGTGTTACGCATATTGGTTAAACAATTTGCTTCTTTTTGGACATTATAGCTATTTTATGAGAGAATATTTGTTTGGGTTTGTCCTGTATTGCTTATTGTATTACCCCTCCTATAATTGTATTGCTACTCTTGGTAGACCTACTTTGCATTGTTTGGTTTTTTCTTTTTnTCTTTTTTTTA
  5   1   2       bld Ga12                                 XL172o04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGACAGTGGAAGAAAAGATGGTCCTTTAGAAGAACAAATTGAGCGATTGCAAGAGAAAGTGGAGTCCGCTCAGAGTGAACAAAAGAACTTGTTCCTTGTCATTTTCCAGAGGTTTATCATGATACTTACGGAACACTTAGTACGCTGTGAAACTGGAGCCATTGATGTGAATACTGCTTGGTATAAGAACTGCAGAGAGAGACTTCAGCAGATATTCCTACAGCATCATCAGACAATCCAGCAGTATATGGTGACTCTGGAAAACCTCTTGTTCACAGCAGAACTGGACCATCACATCTTGACCGTCTTTCAGCAGTTTTGTGCATTACAGTCTTAATGAAACCTGCGCCGGAGTTCCTTTGTACACCCGCAGCTGCATTCTAGGGCTGGAATGTTATTAGGAAAAGACATTTTTGGTCAATTAACACTGAAAATGTGATTGCTAGTAGAGGCAAAGCCATCATTTGCAGTGTTATGGTTATTGGTTAAACTATTTGCTTCTTTTTGGACAGTATAGCTATTTTATGAGGGAATATGTTTGTTTTGGCTTTGTCCTGTATTGCTTACTGTATTACCCCTCCTATAATGGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)