Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 30 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   0.0    0Xl3.1-xlk8p15ex.5.5                        35 END     1          14        2                (no blast hit)
     2   2.0    0Xl3.1-rxl262g18.3                           6 END     1          14       16                forkhead box D3 [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-IMAGE:7980965.5                       9 PI      90        428      681                (no blast hit)
     4   0.0    0Xl3.1-IMAGE:7979206.5                       5 PI      92         29      684                (no blast hit)

 This cluster: approximate FL confidence score = 89%

 1012777320 Xl3.1-IMAGE:8318096.5 - 7 ESTs
                                                                       .......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8318096.5                                                                                                                                                                        TTAAAAGTGTCTGTGCGTCCCCTTGTCAAGCAGCGGGCAACACCGAGGAGGAGGGAGGGGGCAATGCACAGGATTTGAAGGCACTCGCAGCAAGTTCACTACTACTTGCCCTACCGAGCCTCTCTCTATTTCTCTTCTCTGCCCATCGCTGTGGAGCGTAACTGGAATGACCCTGTCAGGCAGCGGCAGTGCCAGCGACATGTCCGGCCAGACCGTACTGAGCGCAGACGACGCGGACATCGATGTGGTGGGCGAGGGGGACGAGGCGCTGGACAAGGACAGTGAGTGCGAGAGCACGGCCGGGCATACCGACGAAGTAGGCGAGCTCGGGGGCAAGGAGATCCCCAGGAGTCCCTCGGGCAGTGGCACTGAGGCAGAGGGTAAGGGTGAGAGCCAGCAGCAGCAGCAGGAGGGCATCCAGAACAAGCCCAAGAACAGCCTGGTGAAGCCCCCCTACTCGTACATCGCTCTCATCACCATGTCCATCCTACAGAGCCCCCAGAAGAAGCTCACCCTGAGCGGTATCTGCGAGTTCATCAGCAACCGCTTCCCCTACTATCGGGAGAAGTTCCCGGCCTGGCAGAACTCCATCCGCCACAACCTGTCGCTGAATGACTGCTTCGTCAAGATCCCCCGGGAGCCCGGCAACCCAGGCAAGGGCAACTACTGGACCCTCGACCCCCA
                                                  Xl3.1-CHK-1012700355                                                                                                                                                                              GTGTCTGTGCGTCCCCTTGTCAAGCAGCGGGCAACACCGAGGAGGAGGGAGGGGGCAATGCACAGGATTTGAAGGCACTCGCAGCAAGTTCACTACTACTTGCCCTACCGAGCCTCTCTCTATTTCTCTTCTCTGCCCATCGCTGTGGAGCGTAACTGGAATGACCCTGTCAGGCAGCGGCAGTGCCAGCGACATGTCCGGCCAGACCGTACTGAGCGCAGACGACGCGGACATCGATGTGGTGGGCGAGGGGGACGAGGCGCTGGACAAGGACAGTGAGTGCGAGAGCACGGCCGGGCATACCGACGAAGTAGGCGAGCTCGGGGGCAAGGAGATCCCCAGGAGTCCCTCGGGCAGTGGCACTGAGGCAGAGGGTAAGGGTGAGAGCCAGCAGCAGCAGCAGGAGGGCATCCAGAACAAGCCCAAGAACAGCCTGGTGAAGCCCCCCTACTCGTACATCGCTCTCATCACCATGTCCATCCTACAGAGCCCCCAGAAGAAGCTCACCCTGAGCGGTATCTGCGAGTTCATCAGCAACCGCTTCCCCTACTATCGGGAGAAGTTCCCGGCCTGGCAGAACTCCATCCGCCACAACCTGTCGCTGAATGACTGCTTCGTCAAGATCCCCCGGGAGCCCGGCAACCCAGGCAAGGGCAACTACTGGACCCTCGACCCCCAGTCCGA
                                                      consensus depths                                                                                                                                                                             3     3     4     5     4     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     6     6     6     6     5     6     4     6     4     6     5     7     3     4
                                               BLH ATG     166     416                                                                                                                                                                        
                                               BLH MIN      97      86                                                                                                                                                                        
                                               BLH OVR     166      84                                                                                                                                                                        
                                               EST CLI      -1      60                                                                                                                                                                        
                                               ORF LNG     166       1                                                                                                                                                                        
                                                                                                                                                                                                                                                                                                                 PROTEIN --- Ce ---- 7e-038     NP_496411.1 UNCoordinated locomotion UNC-130, forkhead box D1 (37.3 kD) (unc-130)[Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PROTEIN === Dm ==== 3e-042     NP_523814.1 forkhead domain 59A CG3668-PA [Drosophila melanogaster] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Ci ---- 5e-044     NP_001071709.1 transcription factor protein [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ag ---- 4e-044     XP_317309.4 AGAP008155-PA [Anopheles gambiae str. PEST] ------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Sp ---- 1e-044     XP_001200747.1 PREDICTED: similar to forkhead transcription factor D [Strongylocentrotus purpuratus] ---------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Gg ==== 2e-060     NP_990282.1 forkhead box D3 [Gallus gallus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Cf ==== 9e-062     XP_852452.1 PREDICTED: similar to forkhead box D3 [Canis familiaris] ================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Hs ==== 1e-062     NP_036315.1 forkhead box D3 [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Mm ==== 3e-063     XP_001478449.1 PREDICTED: similar to forkhead box D3 [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Bt ==== 8e-064     XP_610898.3 PREDICTED: similar to winged helix/forkhead transcriptional regulator Genesis/HFH2/FoxD3 [Bos taurus] ===================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Dr ==== 3e-072     NP_571365.1 forkhead box D3; fork head domain protein 6 [Danio rerio] ===============================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Xt ==== 2e-087     CAJ82837.1 forkhead box D3 [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Xl ==== 4e-098     NP_001079026.1 forkhead box D3 [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:8318096.5                                                                                                                                                                         TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                              [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ...
  5   1   2      seed Em10 5g                         IMAGE:8318096.5p                                                                                                                                                                       TTTAAAAGTGTCTGTGCGTCCCCTTGTCAAGCAGCGGGCAACACCGAGGAGGAGGGAGGGGGCAATGCACAGGATTTGAAGGCACTCGCAGCAAGTTCACTACTACTTGCCCTACCGAGCCTCTCTCTATTTCTCTTCTCTGCCCATCGCTGTGGAGCGTAACTGGAATGACCCTGTCAGGCAGCGGCAGTGCCAGCGACATGTCCGGCCAGACCGTACTGAGCGCAGACGACGCGGACATCGATGTGGTGGGCGAGGGGGACGAGGCGCTGGACAAGGACAGTGAGTGCGAGAGCACGGCCGGGCATACCGACGAAGTAGGCGAGCTCGGGGGCAAGGAGATCCCCAGGAGTCCCTCGGGCAGTGGCACTGAGGCAGAGGGTAAGGGTGAGAGCCAGCAGCAGCAGCAGGAGGGCATCCAGAACAAGCCCAAGAACAGCCTGGTGAAGCCCCCCTACTCGTACATCGCTCTCATCACCATGTCCATCCTACAGAGCCCCCAGAAGAAGCTCACCCTGAGCGGTATCTGCGAGTTCATCAGCAACCGCTTCCCCTACTATCGGGAGAAGTTCCCGGCCTGGCAGAACTCCATCCGCCACAACCTGTCGCTGAATGACTGCTTCGTCAAGATCCCCCGGGAGCCCGGCAACCCAGGCAAGGGCAACTACTGGACCCTCGACCCCCAGTCCGAGGACA
  5   1   2       bld Emb9 5g3  out                   IMAGE:7975733.5p                                                                                                                                                                        TTTAAAGTGTCTGTGCGTCCCCTTGTCAAGCAGCGGGCAACACCGAGGAGGAGGGAGGGGGCAATGCACAGGATTTGAAGGCACTCGCAGCAAGTTCACTACTACTTGCCCTACCGAGCCTCTCTCTATTTCTCTTCTCTGCCCATCGCTGTGGAGCGTAACTGGAATGACCCTGTCAGGCAGCGGCAGTGCCAGCGACATGTCCGGCCAGACCGTACTGAGCGCAGACGACGCGGACATCGATGTGGTGGGCGAGGGGGACGAGGCGCTGGACAAGGACAGTGAGTGCGAGAGCACGGCCGGGCATACCGACGAAGTAGGCGAGCTCGGGGGCAAGGAGATCCCCAGGAGTCCCTCGGGCAGTGGCACTGAGGCAGAGGGTAAGGGTGAGAGCCAGCAGCAGCAGCAGGAGGGCATCCAGAACAAGCCCAAGAACAGCCTGGTGAAGCCCCCCTACTCGTACATCGCTCTCATCACCATGTCCATCCTACAGAGCCCCCAGAAGAAGCTCACCCTGAGCGGTATCTGCGAGTTCATCAGCAACCGCTTCCCCTACTATCGGGAGAAGTTCCCGGCCTGGCAGAACTCCATCCGCCACAACCTGTCGCTGAATGACTGCTTTCGTCAGATCCCCCGGGAGCCCGGCAACCCAGGCAAGGGCAACTACTGGACCCTCGACCCCCAGTCCGA
  5   1   2       bld Em10 5g                         IMAGE:7982800.5p                                                                                                                                                                        TTAAAAGTGTCTGTGCGTCCCCTTGTCAAGAAGCGGGCAACACCGAGGAGGAGGGAGGGGGCAATGCACAGGATTTGAAGGCACTCGCAGCAAGTTCACTACTACTTGCCCTACCGAGCCTCTCTCTATTTCTCTTCTCTGCCCATCGCTGTGGAGCGTAACTGGAATGACCCTGTCAGGCAGCGGCAGTGCCAGCGACATGTCCGGCCAGACCGTACTGAGCGCAGACGACGCGGACATCGATGTGGTGGGCGAGGGGGACGAGGCGCTGGACAAGGACAGTGAGTGCGAGAGCACGGCCGGGCATACCGACGAAGTAGGCGAGCTCGGGGGCAAGGAGATCCCCAGGAGTCCCTCGGGCAGTGGCACTGAGGCAGAGGGTAAGGGTGAGAGCCAGCAGCAGCAGCAGGAGGGCATCCAGAACAAGCCCAAGAACAGCCTGGTGAAGCCCCCCTACTCGTACATCGCTCTCATCACCATGTCCATCCTACAGAGCCCCCAGAAGAAGCTCACCCTGAGCGGTATCTGCGAGTTCATCAGCAACCGCTTCCCCTACTATCGGGAGAAGTTCCCGGCCTGGCAGAACTCCATCCGCCACAACCTGTCGCTGAATGACTGCTTCGTCAAGATCCCCCGGGAGCCCGGGCACCCAGGCAAGGGCAACTACTGGACCCTCGACCCCCAGTCCGAGGACATGTTCGACAATGGCAGTTTCCTCGGAGGAGGAGCGGNTTAGAGACACAGCAGGACTCGTGAGGAGCAGATGCTCTCTGAGCAAGCTTGGG
  5   1   2       bld Em10 5g                         IMAGE:8322118.5p                                                                                                                                                                         TAAAAGTGTCTGTGCGTCCCCTTGTCAAGCAGCGGGCAACACCGAGGAGGAGGGAGGGGGCAATGCACAGGATTTGAAGGCACTCGCAGCAAGTTCACTACTACTTGCCCTACCGAGCCTCTCTCTATTTCTCTTCTCTGCCCATCGCTGTGGAGCGTAACTGGAATGACCCTGTCAGGCAGCGGCAGTGCCAGCGACATGTCCGGCCAGACCGTACTGAGCGCAGACGACGCGGACATCGATGTGGTGGGCGAGGGGGACGAGGCGCTGGACAAGGACAGTGAGTGCGAGAGCACGGCCGGGCATACCGACGAAGTAGGCGAGCTCGGGGGCAAGGAGATCCCCAGGAGTCCCTCGGGCAGTGGCACTGAGGCAGAGGGTAAGGGTGAGAGCCAGCAGCAGCAGCAGGAGGGCATCCAGAACAAGCCCAAGAACAGCCTGGTGAAGCCCCCCTACTCGTACATCGCTCTCATCACCATGTCCATCCTACAGAGCCCCCAGAAGAATCTCACCCTGAGCGGTATCTGCGAGTTCATCAGCAACCGCTTCCCCTACTATCGGGAGAAGTTCCCGGCCTGGCAGAACTCCATCCGCCACAACCTGTCGCTGAATGACTGCTTCGTCAAGATCCCCCGGGAGCCCGGCAACCCATGCAAGGGCAACTTCTGGACCCT
  5   1   2       bld Em10 5g                         IMAGE:7980757.5p                                                                                                                                                                              AGTGTCTGTGCGTCCCCTTGTCAGCAGCGGGCAACACCGAGGAGGAGGGAGGGGGCAATGCACAGGATTTGAAGGCACTCGCAGCAAGTTCACTACTACTTGCCCTACCGAGCCTCTCTCTATTTCTCTTCTCTGCCCATCGCTGTGGAGCGTAACTGGAATGACCCTGTCAGGCAGCGGCAGTGCCAGCGACATGTCCGGCCAGACCGTACTGAGCGCAGACGACGCGGACATCGATGTGGTGGGCGAGGGGGACGAGGCGCTGGACAAGGACAGTGAGTGCGAGAGCACGGCCGGGCATACCGACGAAGTAGGCGAGCTCGGGGGCAAGGAGATCCCCAGGAGTCCCTCGGGCAGTGGCACTGAGGCAGAGGGTAAGGGTGAGAGCCAGCAGCAGCAGCAGGAGGGCATCCAGAACAAGCCCAAGAACAGCCTGGTGAAGCCCCCCTACTCGTACATCGCTCTCATCACCATGTCCATCCTACAGAGCCCCCAGAAGAAGCTCACCCTGAGCGGTATCTGCGAGTTCATCAGCAACCGCTTCCCCTACTATCGGGAGAAGTTCCCGGCCTGGCAGAACTCCATCCGCCACAACCTGTCGCTGAATGACTGCTTCGTCAGATCCCCCGGGAGCCGGGCACCCAGGCAAGGCACTACTGGACCTCGACCCCAGTCCGAGACAGTTCGACATGCAGTTCCTCGGAGAGGAGCGGTTTAGAACACAGCAGATCTTGAGGACAACTGCC
  5   1   2       bld Em10 5g                         IMAGE:8321039.5p                                                                                                                                                                                                                  CCGAGGAGGAGGGAGGGGGCAATGCACAGGATTTGAAGGCACTCGCAGCAAGTTCACTACTACTTGCCCTACCGAGCCTCTCTCTATTTCTCTTCTCTGCCCATCGCTGTGGAGCGTAACTGGAATGACCCTGTCAGGCAGCGGCAGTGCCAGCGACATGTCCGGCCAGACCGTACTGAGCGCAGACGACGCGGACATCGATGTGGTGGGCGAGGGGGACGAGGCGCTGGACAAGGACAGTGAGTGCGAGAGCACGGCCGGGCATACCGACGAAGTAGGCGAGCTCGGGGGCAAGGAGATCCCCAGGAGTCCCTCGGGCAGTGGCACTGAGGCAGAGGGTAAGGGTGAGAGCCAGCAGCAGCAGCAGGAGGGCATCCAGAACAAGCCCAAGAACAGCCTGGTGAAGCCCCCCTACTCGTACATCGCTCTCATCACCATGTCCATCCTACAGAGCCCCCAGAAGAAGCTCACCCTGAGCGGTATCTGCGAGTTCATCAGCAACCGCTTCCCCTACTATCGGGAGAAGTTCCCGGCCTGGCAGAACTCCATCCGCCACAACCTGTCGCTGAATGACTGCTTCGTCAAGATCCCCCGGGGAGCCCGGCAACCCAGGCAAGGGCAACTACTGGAACCTCGACCC
  5   1   0       add DMZ       out                        xl262b14.5p                                                                                                                                                                                                                                                                                                                               GGGATACCAGATGATTTTTGCAGTGTTGGGACTGAGAGGGTTTTGTTTATGAATTTGGCAAGTTTCTCTTATTATTCAGGCATGTGCACCATGACTGCAGATTCCCAGCAATCACCCACTGAAGCTACTGGCCCCATACCAAGCTCCCCCAGTATGGACTCCACTGGCTCCATCAGAGTCAAATGTGAACCCAAGGGGAGCTGCAGCCCAGAGGAGGGTATGAATAATGGAATGCCAGAAGAACACTGCCAGGCCTCTGGGGGCAGGAGGAGAAAACGTCCAGTTCAGCGGGGAAAGCCACCCTACAGCTATATTGCCCTCATTGCAATGGCCATAGCCAATTCCCCTGAAAGTAAGCTGACACTAGGGGGCATTTACAAATTTATCATGGAAAGGTTCCCCTTCTATAGGGAGAACTCCAAGAAATGGCAGAACTCCATCCGCCACAACCTAACGCTTAATGACTGCTTTGTAAAGATCCCCAGGGAACCTGGGCACCCGGGCAAAGGCAACTACTGGACTCTGGATCCTGCAGCTGAGGATATGTTTGATAATGGCAGTTTCCTCAGAAGAAGAAAGAGATTTAAGAGGACAGATATCAGTACCTACCCTGGGTATATGCAGAATAGCAGTGCCTTCACCCCCACCCCAGCTGGAAGGGCATCATACCCCAGCAGCATATACTCTAGCGTTGGCTCTGGATATAACCCTCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)