Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 05 Jun 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:7295704.5                      23 END     7          53       30                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6861212.5                      77 PI      89          4      912                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012777460 Xl3.1-IMAGE:6633112.5 - 13 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                  2     3     2     3     2     3     2     3     2     3     3     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     6     6     8     7     8     7     8     8     9     9    10    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11     9    11     8    11     6    11     6    11     6    10     6    10     6    10     5     9     5     9     5     9     5     9     5     9     5     9     5     9     5     9     4     9     4     9     3     8     4     9     4     8     4     8     3     8     4     8     4     8     4     8     2     6
  3  -1   2       add Bla2      out                   IMAGE:7297225.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTCCCAACATCTTTCCTCACCATATGATTTGGGAGAGCCCTCTAGCAGACGTCTTACCCCTGATGTTGCTACAGTGCCGGATTCTGATCCAGATTCTTTAGCAGTGCTTCATGTCATTCCAACACAGAATTCTGCTCAGGAACGCACATGTTCTATGAACTTTTCCATGGAAACCCCAATGAAACAGCCCCTCCGGGGTGCCATATACAGCCCTTATGGAACAGAGCAGTGGATGGTTCCAGCTCAAGGTCCATATCAGCCTGTCAGCTATACTGCATACCCAACAGACTTAAGTGCACANGGAGCAGTAGCTCACCCACATAGTGGGATGTCNGACTGGAGCCATATTCTCTCTTCCCTACAGCTGCTGGTAAAGGAAATGCGTATCACAGTCCTACCTTCCATTCTATACATCAGTCCTGATTGCTTNGTNGGAGGAGTATATGGTATGCATCTCTGAGGCTCAGGACTCATTTAAACGTGCGTTGGAAGATGCATGAGCATTGGTTACAGTGTTTGTGACTAAAGTGTCCATATAGCACACAGTAGGTGCTCTGTGCTGGATAGGGATCTCACTGTATTACTATGTATATTTAGATACAGTATGTAATCGAGGTGGCTNAGCA
  5   1   2       bld Gas6      out                   IMAGE:3473848.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTCCTACCATATGATTTGGGAGAGCCCTCTAGCAGACGTCTTACCCCTGATGTTGCTACAGTGCCGGATTCTGATCCAGATTCTTTAGCAGTGCTTCATGTCATTCCAACACAGAATTCTGCTCAGGAACGCACATGTTCTATGAACTTTTCCATGGAAACCCCAATGAAACAGCCCCTCCGGGGTGCCATATACAGCCCTTATGGAACAGAGCAGTGGATGGTTCCAGCTCAAGGTCCATATCAGCCTGTCGGCTATACTGCATACCCAACAGACTTAAGTGCACAAGGAGCAGTAGCTCACCCACATAGTGGGATGTCGGACTGGAGCCAATATTCTCTCTTTCCCTACAGCTGCTGGTAAAAGGAAATGCGTATCCACAGTCCTACCCTTCCATTCTAATACATCAGTCCTGATTGCTTGTTGGAGGGAGTTATATGGTATTGCATCTCTGAGGCTTCAGGACCTCATTAAAAACCGTGCGTTGGGAAGATTGCATGATGCAGTTTGGTTACAGTGGTTG
  5   1   2       bld Emb1                            IMAGE:5161666.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGGATGGTTCCAGCTCAAGGTCCATATCAGCCTGTCAGCTATACTGCATACCCAACAGACTTAAGTGCACAAGGAGCAGTAGCTCACCCACATAGTGGGATGTCGGACTGGAGCCAATATTCTCTCTTCCCCTACAGCTGCTGGTAAAAGGAAATGCGTATCCACAGTCCTACCCTTCCATTCTAATACATCAGTCCTGATTGCTTGTTGGAGGGAGTTATATGGTATTGCATCTCTGAGGCTTCAGGACCTCATTAAAAACCGTGCGTTGGGAAGATTGCATGATGCAGTTTGGTTACAGTGTTTGTTGGACTAAAAGGTGTCGCATTATAAGCACAAACAGTAGGGTGCCTCCTGTGCGTGTGATCAGGGGAATCTCGACCTGTAATTTAACTAAATGTATTTATTTTAAAGATTAGCAAGTAAATGTGAGAATCAGAGGGGTGTGCATTAAAGCAGATCTCCAGAAGAGAACCCAGGAAAGAAGCTATGGATTTCTAGAACACAAGCAGTTTTCTCTTGACAGTAGAGGTACAGCCCTGTAACTCTCCATTCACTTAATGTCCCCAGTTATTGCCTTTCACTAAATCCTANAATGGTCTGTCttttttttttttCTTAACTACATAATTGTGATTGCAGTTTTGCACCTTACATTTTCCAGGGTGGGTGGTTTGCAGCACTAATCTGTGAAAGAGTGTACAGCAGGTGTTTGTGCTTTTCTGCACTACTCGGGAAATGTGTGTGTATTTgggggggaaagggggTTTCCCTAAAGATTGAACTGGCTTACTATGAAACTAATGCTGGGGCCTATTCCCCAGGGATAAGGAAAAATTTGGGTATTTCTTTCTAAGGCAAAGGTAACGCTTCCGGGATTGGGCCCCTAGTGGGAAAAGCAAAA
  5   1   2      skin Ga12      out                        XL168p11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTTGTTGGACTAAAAGGTGTCGCATTATAAGCACAAACAGTAGGGTGCCTNCTGTGCGTGTGATCAGGGGAATCTCGACCTGTAATTTAACTAAATGTATTTATTTTAAAGATTA

In case of problems mail me! (