Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Oct 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:7295704.5                      23 END     7          53       30                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6861212.5                      77 PI      89          4      912                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012777460 Xl3.1-IMAGE:6633112.5 - 13 ESTs
                                                                       ....-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6633112.5                                                                                                                                                                                                                                                                                                                                                                             GTCTTAAAGACTCTACAACAAAGTCCCAGTAAGAGCCAGAAGAGGAAGAAGTGGGAGGACAGTCCCGAGGCTGATATTTCAGATTTCCCCAAGGCTACACGCATTAAGGAGGAATCCATTATGGATCCAGCAGGAGTTTACCAGAACTGGGTTTCAGATCATGAGGCTAACCAAGGCTTGACACCCCACTCCCCTGAGTCTGAGGGTGTCAATCAGGAGCAGCAGGTCCCCACATCTTCCTCGAACTTCTATATCAAGAGCCAATATCGAAGGAGTTCCCAACATCTTTCCTCACCATATGATTTGGGAGAGCCCTCTAGCAGACGTCTTACCCCTGATGTTGCTACAGTGCCGGATTCTGATCCAGATTCTTTAGCAGTGCTTCATGTCATTCCAACACAGAATTCTGCTCAGGAACGCACATGTTCTATGAACTTTTCCATGGAAACCCCAATGAAACAGCCCCTCCGGGGTGCCATATACAGCCCTTATGGAACAGAGCAGTGGATGGTTCCAGCTCAAGGTCCATATCAGCCTGTCAGCTATACTGCATACCCAACAGACTTAAGTGCACAAGGAGCAGTAGCTCACCCACATAGTGGGATGTCGGACTGGAGCCAATATTCTCTCTTCCCCTACAGCTGCTGGTAAAAGGAAATGCGTATCCACAGTCCTACCCTTCCATTCTAATACATCAGTCCTGATTGCTTGTTGGAGGGAGTTATATGGTATTGCATCTCTGAGGCTTCAGGACCTCATTAAAAACCGTGCGTTGGGAAGATTGCATGATGCAGTTTGGTTACAGTGTTTGTTGGACTAAAAGGTGTCGCATTATAAGCACAAACAGTAGGGTGCCTCCTGTGCGTGTGATCAGGGGAATCTCGACCTGTAATTTAACTAAATGTATTTATT
                                                  Xl3.1-CHK-1012693144                                                                                                                                                                                                                                                                                                                                                                                   AAGACTCTACAACAAAGTCCCAGTAAGAGCCAGAAGAGGAAGAAGTGGGAGGACAGTCCCGAGGCTGATATTTCAGATTTCCCCAAGGCTACACGCATTAAGGAGGAATCCATTATGGATCCAGCAGGAGTTTACCAGAACTGGGTTTCAGATCATGAGGCTAACCAAGGCTTGACACCCCACTCCCCTGAGTCTGAGGGTGTCAATCAGGAGCAGCAGGTCCCCACATCTTCCTCGAACTTCTATATCAAGAGCCAATATCGAAGGAGTTCCCAACATCTTTCCTCACCATATGATTTGGGAGAGCCCTCTAGCAGACGTCTTACCCCTGATGTTGCTACAGTGCCGGATTCTGATCCAGATTCTTTAGCAGTGCTTCATGTCATTCCAACACAGAATTCTGCTCAGGAACGCACATGTTCTATGAACTTTTCCATGGAAACCCCAATGAAACAGCCCCTCCGGGGTGCCATATACAGCCCTTATGGAACAGAGCAGTGGATGGTTCCAGCTCAAGGTCCATATCAGCCTGTCAGCTATACTGCATACCCAACAGACTTAAGTGCACAAGGAGCAGTAGCTCACCCACATAGTGGGATGTCGGACTGGAGCCAATATTCTCTCTTCCCCTACAGCTGCTGGTAAAAGGAAATGCGTATCCACAGTCCTACCCTTCCATTCTAATACATCAGTCCTGATTGCTTGTTGGAGGGAGTTATATGGTATTGCATCTCTGAGGCTTCAGGACCTCATTAAAAACCGTGCGTTGGGAAGATTGCATGATGCAGTTTGGTTACAGTGTTTGTTGGACTAAAAGGTGTCGCATTATAAGCACAAACAGTAGGGTGCCTCCTGTGCGTGTGATCAGGGGAATCTCGACCTGTAATTTAACTAAATGTATTTATTTTAAAG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                  2     3     2     3     2     3     2     3     2     3     3     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     6     6     8     7     8     7     8     8     9     9    10    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11     9    11     8    11     6    11     6    11     6    10     6    10     6    10     5     9     5     9     5     9     5     9     5     9     5     9     5     9     5     9     4     9     4     9     3     8     4     9     4     8     4     8     3     8     4     8     4     8     4     8     2     6
  5   1   2       add Em10                            IMAGE:7982610.5p CAGGCTACACGCATTAAGGAGGAATCCATTATGGATCCAGCAGGAGTTTACCAGAACTGGGTTTCAGATCATGAGGCTAACCAAGGCTTGACACCCCACTCCCCTGAGTCTGAGGGTGTCAATCAGGAGCAGCAGGTCCCCACATCTTCCTCGAACTTCTATATCAAGTGAGGtttttttgtttgttttttttttAAAAAATGAGGTAAAGTAAAGGGCAGATCTTAGTGATAACCAGTCTAAAATGAAAGGGTTGTGGAAATGTTTACCACAGGCTACGTTGTGCTTTCTTTGGTACAGCCTGTATAACCTTTATGGGAAGTGCAAAACTTGAGAGAAGGAAAAAACGAAACTTTCTAGCTACTGCAGAGCTAATATTCCCAAATTCCATTTTTAAGTTGAGTGCTGCTATTCCGCATCAAGGGGGTTGGCAAAATTTGGTTACTCATGGCTGCTGTTAATATATAAATAGATATGTGACACAGGCTTAGATTTTTAGAATGTATCCATAGCAATAACAAAATGTTGAACCCTTAAAATGTGAGACTTTGGTCATTGAGTTTACAAATTTTATGCCTGGTGCTTATTTTTAATCTTTTATATTGAATTTGCATTTCTTAGGAGCCAATATCGAAGGAGTTCCCAACATCTTTCCTCACCATATGATTTGGGAGAGCCCTCTAGCAGACGTCTTACCCCTGATGTTGCTACAGTGCCGGAATCTGATCCAGATTCTTTAGCAGTGCTTCATGTCATACCNACACAAAATTTGCTCAGG
  5   1   2       bld Emb1                            IMAGE:6633112.5p                                                                                                                                                                                                                                                                                                                                                     CCACGCGTCCGCAAGAGGGATGATGTCTTAAAGACTCTACAACAAAGTCCCAGTAAGAGCCAGAAGAGGAAGAAGTGGGAGGACAGTCCCGAGGCTGATATTTCAGATTTCCCCAAGGCTACACGCATTAAGGAGGAATCCATTATGGATCCAGCAGGAGTTTACCAGAACTGGGTTTCAGATCATGAGGCTAACCAAGGCTTGACACCCCACTCCCCTGAGTCTGAGGGTGTCAATCAGGAGCAGCAGGTCCCCACATCTTCCTCGAACTTCTATATCAAGAGCCAATATCGAAGGAGTTCCCAACATCTTTCCTCACCATATGATTTGGGAGAGCCCTCTAGCAGACGTCTTACCCCTGATGTTGCTACAGTGCCGGATTCTGATCCAGATTCTTTAGCAGTGCTTCATGTCATTCCAACACAGAATTCTGCTCAGGAACGCACATGTTCTATGAACTTTTCCATGGAAACCCCAATGAAACAGCCCCTCCGGGGTGCCATATACAGCCCTTATGGAACAGAGCAGTGGATGGTTCCAGCTCAAGGTCCATATCAGCCTGTCAGCTATACTGCATACCCAACAGACTTAAGTGCACAAGGAGCAGTAGCTCACCCACATAGTGGGATGTCGGACTGGAGCCAATATTCTCTCTTCCCCTACAGCTGCTGGTAAAAGGAAATGCGTATCCACAGTCCTACCCCTTCCATTCTAATACATCAGTCCCTGATTGCTTGGTTGGAGGGAGTTATATGGGTATTGCCATCTCCTGAGGGCTTCCGGGACCTTCATTTAAAAACCCGTGGCGTTTGGGGAAAGAATTGGCATGGAATGCAAGTTTTTGGGTTTACT
  5   1   2       bld Gas9                                 BG410111.5p                                                                                                                                                                                                                                                                                                                                                                             GTCTTAAAGACTCTACAACAAAGTCCCAGTAAGAGCCAGAAGAGGAAGAAGTGGGAGGACAGTCCCGAGGCTGATATTTCAGATTTCCCCAAGGCTACACGCATTAAGGAGGAATCCATTATGGATCCAGCAGGAGTTTACCAGAACTGGGTTTCAGATCATGAGGCTAACCAAGGCTTGACACCCCACTCCCCTGAGTCTGAGGGTGTCAATCAGGAGCAGCAGGTCCCCACATCTTCCTCGAACTTCTATATCAAGTGAGGtttttttgtttgttttttttttAAAAAATGAGGTAAAGTAAAGGGCAGATCTTAGTGATAACCAGTCTAAAATGAAAGGGTTGTGGAAATGTTTACCACAGGCTACGTTGTGCTTTCTTTGGTACAGCCTGTATAACCTTTATGGGAAGTGCAAAACTTGAGAGAAGGAAAAAACGAAACTTTCTAGCTACTGCAGAGCTAATATTCCCAAATTCCATTTTTAAGTTGAGTGCTGCTATTCCGCATCAAGGGGGGTTGGCAAAATTTGGGTTACTCATGGCTGCTGTTAATATATNAATAGATATGTGACACANGCTTAGATTTTAGAATGTNTCCATAGCAATACCAAATGTTGACCCTTTAAATGGGAGACTTTGGTCATTGAGTTTACAAATTTTATGCCTGGGGCTTAATTTTAATCTTTTATATT
  5   1   2      skin Emb1                            IMAGE:5156910.5p                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGAGGACAGTCCCGAGGCTGATATTTCAGATTTCCCCAAGGCTACACGCATTAAGGAGGAATCCATTATGGATCCAGCAGGAGTTTACCAGAACTGGGTTTCAGATCATGAGGCTAACCAAGGCTTGACACCCCACTCCCCTGAGTCTGAGGGTGTCAATCAGGAGCAGCAGGTCCCCACATCTTCCTCGAACTTCTATATCAAGAGCCAATATCGAAGGAGTTCCCAACATCTTTCCTCACCATATGATTTGGGAGAGCCCTCTAGCAGACGTCTTACCCCTGATGTTGCTACAGTGCCGGATTCTGATCCAGATTCTTTAGCAGTGCTTCATGTCATTCCAACACAGAATTCTGCTCAGGAACGCACATGTTCTATGAACTTTTCCATGGAAACCCCAATGAAACAGCCCCTCCGGGGTGCCATATACAGCCCTTATGGAACAGAGCAGTGGATGGTTCCAGCTCAAGGTCCATATCAGCCTGTCAGCTATACTGCATACCCAACAGACTTAAGTGCACAAGGAGCAGTAGCTCACCCACATAGTGGGGATGTCGGGATGGAAGCCAATATTCTCTCTTCCCCTACAGCTGGTGGGAAAAAGGAAATGCGTATCCACAGTCCTACCCCTTCCATTCTAATACATCAGNCCCTGATTGCCTTTGTTGGAGGGGAATTATAATGGAATTGCAATCTCTGGAGGCTTCCAGACCTCCATTAAAAACCGTGCCGTTGGGAAGAATTGCTTGGATCCAGTTTGGGTTACAAGGGTTTTGTTGGAACTAAAAGGGGGTCCCCTTTATTAAGCCCCAAACCGTTAGGGTGGCCTCCACGGGGCGCGTGGAATCATGGGGAAATTCTCCACCTGGGAATTTTAACCCAAAGGGGAttttttttttAAAAATAAGCCCCCGAAAAGTGTGGGAAATCACAAAGGG
  5   1   2      seed Ooc1      out                    Ooc1-db27g12.y1                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGTCGACCCACGCGTCCGGATATTTCAGATTTCCCCAAGGCTACACGCATTAAGGAGGAATCCATTATGGATCCAGCAGGAGTTTACCAGAACTGGGTTTCAGATCATGAGGCTAACCAAGGCTTGACACCCCACTCCCCTGAGTCTGAGGGTGTCAATCAGGAGCAGCAGGTCCCCACATCTTCCTCGAACTTCTATATCAAGAGCCAATATCGAAGGAGTTCCCAACATCTTTCCTCACCATATGATTTGGGAGAGCCCTCTAGCAGACGTCTTACCCCTGATGTTGCTACAGTGCCGGATTCTGATCCAAATTCTNTAGCAGTGCTTCATGTCATTCCAACACAGAATTCTGCTCAGGAACGCACATGTTCTATGAACTTTTCCATGGAAACCCCAATGAAACAGCCCCTCCGGGGTGCCATATACAGCCCTTATGGAACAGAGCAGTGGATGGTTCCAGCTCAAGGTCCATATCAGCCTGTCAGCTATACTGCATACGCAACAGACTTAAGTGCACAAGGAGCAGTAGCTCACCCACATAGTGGGATGTCGGACTGGAGCCAATTTCTCTCTTTCCCTACAGCTGCTGGTAAA
  3  -1   2       bld Bla2      out                   IMAGE:7295704.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGCAGCAGGTCCCCACATCTTCCTCGAACTTCTATATCAAGAGCCAATATCGAAGGAGTTCCCAACATCTTTCCTCACCATATGATTTGGGAGAGCCCTCTAGCAGACGTCTTACCCCTGATGTTGCTACAGTGCCGGATTCTGATCCAGATTCTTTAGCAGTGCTTCATGTCATTCCAACACAGAATTCTGCTCAGGAACGCACATGTTCTATGAACTTTTCCATGGAAACCCCAATGAAACAGCCCCTCCGGGGTGCCATATACAGCCCTTATGGAACAGAGCAGTGGATGGTTCCAGCTCAAGGTCCATATCAGCCTGTCAGCTATACTGCATACCCAACAGACTTAAGTGCACAAGGAGCAGTAGCTCACCCACATAGTGGGATGTCGGACTGGAGCCAATATTCTCTCTTCCCTACAGCTGCTGGTAAAGGGAATGCGTATCCACAGTCCTACCTTCCATTTCTATACATCAGTCCTGATTTGCTGTGGNANGGNAGTATATGGTATTGCATCTCTGAGGCTTCANGGACTCATTTAAAACCGTGCGTTTGGAAGATGCATGATGCATTTGGTTACAGTGTTNGTGGACTAAAGGTGTCGCATTATAGCACAACAGTAGGGTGCCTCTGTGCGTGTGATCAGGGATCTCGACTGTAATTACTAATGTATTATTTAAGATAGC
  5   1   2       bld Emb1                            IMAGE:6634573.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCACGCGTCCGCTCGAACTTCTATATCAAGAGCCAATATCGAAGGAGTTCCCAACATCTTTCCTCACCATATGATTTGGGAGAGCCCTCTAGCAGACGTCTTACCCCTGATGTTGCTACAGTGCCGGATTCTGATCCAGATTCTTTAGCAGTGCTTCATGTCATTCCAACACAGAATTCTGCTCAGGAACGCACATGTTCTATGAACTTTTCCATGGAAACCCCAATGAAACAGCCCCTCCGGGGTGCCATATACAGCCCTTATGGAACAGAGCAGTGGATGGTTCCAGCTCAAGGTCCATATCAGCCTGTCAGCTATACTGCATACCCAACAGACTTAAGTGCACAAGGAGCAGTAGCTCACCCACATAGTGGGATGTCGGACTGGAGCCAATATTCTCTCTTCCCCTACAGCTGCTGGTAAAAGGAAATGCGTATCCACAGTCCTACCCTTCCATTCTAATACATCAGTCCTGATTGCTTGTTGGAGGGAGTTATATGGTATTGCATCTCTGAGGCTTCAGGACCTCATTAAAAACCGTGCGTTGGGAAGATTGCATGATGCAGTTTGGTTACAGTGTTTGTTGGACTAAAAGGTGTCGCATTATAAGCACAAACAGTAGGGGGCCTCCTGTGCTTGTGATCAGGNGAATCTCGACCTGTAATTTTACTAATGTATTTATTTTAAAAGATTAGCAAGTAAAGTGTGAGAATCCGAGGGGGTGTGCCATTAAAGGCGATTCTTCAGGAAAGAGGACCCCAGGAAAAGAAAGCTTATGGAATTTCCTAGAAACGCCAAGCAGGGTTTTGTCCTTGGGGCCGGTAGAAGGGTAACagccccctggaaacttcctcccccttcccctttaaagtggccccccAAGGTTTATTTGCGCCTTTTTCCCCTAAAATCCCCTTAAAAGTGGCGCCTTTTATGTGCCTTCTCCGCTTCCCACTGCAAGAACTCCC
  3  -1   2       bld Bla2      out                   IMAGE:7297315.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCACATCTTCCTCGAACTTCTATATCAAGAGCCAATATCGAAGGAGTTCCCAACATCTTTCCTCACCATATGATTTGGGAGAGCCCTCTAGCAGACGTCTTACCCCTGATGTTGCTACAGTGCCGGATTCTGATCCAGATTCTTTAGCAGTGCTTCATGTCATTCCAACACAGAATTCTGCTCAGGAACGCACATGTTCTATGAACTTTTCCATGGAAACCCCAATGAAACAGCCCCTCCGGGGTGCCATATACAGCCCTTATGGAACAGAGCAGTGGATGGTTCCAGCTCAAGGTCCATATCAGCCTGTCAGCTATACTGCATACCCAACAGACTTAAGTGCACAAGGAGCAGTAGCTCACCCACATAGTGGGATGTCGGACTGGAGCCAATATTCTCTCTTCCCCTACAGCTGCTGGTAAAAGGAAATGCGTATCCACAGTCCTACCCTTCCATTCTAATACATCAGTCCTGATTGCTTGTTGGAGGGAGTTATATGGTATTGCATCTCTGAGGCTTCAGGACCTCATTAAAAACCGTGCGTTGGGAAGATGCATGATGCAGTTTGGTTCAGTGTTTGTGGACTAAAGGTGTCGATTATAGCACAACAGTAGGTGCTCCTGTGCGTGTGATCAGGGATCTCGACTGTATTTNACTATGTATTATTTAAGATAGCAGTAATGGAATCAGAGGTGTGCTAACAAT
  3  -1   2       bld Bla2      out                   IMAGE:7295806.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAATATCGAAGGAGTTCCCAACATCTTTCCTCACCATATGATTTGGGAGAGCCCTCTAGCAGACGTCTTACCCCTGATGTTGCTACAGTGCCGGATTCTGATCCAGATTCTTTAGCAGTGCTTCATGTCATTCCAACACAGAATTCTGCTCAGGAACGCACATGTTCTATGAACTTTTCCATGGAAACCCCAATGAAACAGCCCCTCCGGGGTGCCATATACAGCCCTTATGGAACAGAGCAGTGGATGGTTCCAGCTCAAGGTCCATATCAGCCTGTCGGCTATACTGCATACCCAACAGACTTAAGTGCACAAGGAGCAGTAGCTCACCCACATAGTGGGATGTCGGACTGGAGCCAATATTCTCTCTTCCCCTACAGCTGCTGGTAAAAGGAAATGCGTATCCACAGTCCTACCCTTCCATTCTAATACATCAGTCCTGATTGCTTGTTGGGGGGAGGTATATGGTATTGCATCTCTGAGGCTTCAGGACCTCATTAAAAACCGTGCGTTGGGAAGATTGCATGATGCAGTTTGGTTACAGTGTTTGTTGGACTAAAAGGTGTCGCATTATAAGCACAAACAGTAGGGTGCCTCCTGTGCGTGTGATCAGGGGAATCTCGACCTGTAATTTAACTAATGTATTNATTTTAANNGATAGCAGTAATGTGAGATCAGAAGGGTGTGCATTAAGCAATCTCAGAGAGACCNNAGAAGAGCT
  3  -1   2       add Bla2      out                   IMAGE:7297225.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTCCCAACATCTTTCCTCACCATATGATTTGGGAGAGCCCTCTAGCAGACGTCTTACCCCTGATGTTGCTACAGTGCCGGATTCTGATCCAGATTCTTTAGCAGTGCTTCATGTCATTCCAACACAGAATTCTGCTCAGGAACGCACATGTTCTATGAACTTTTCCATGGAAACCCCAATGAAACAGCCCCTCCGGGGTGCCATATACAGCCCTTATGGAACAGAGCAGTGGATGGTTCCAGCTCAAGGTCCATATCAGCCTGTCAGCTATACTGCATACCCAACAGACTTAAGTGCACANGGAGCAGTAGCTCACCCACATAGTGGGATGTCNGACTGGAGCCATATTCTCTCTTCCCTACAGCTGCTGGTAAAGGAAATGCGTATCACAGTCCTACCTTCCATTCTATACATCAGTCCTGATTGCTTNGTNGGAGGAGTATATGGTATGCATCTCTGAGGCTCAGGACTCATTTAAACGTGCGTTGGAAGATGCATGAGCATTGGTTACAGTGTTTGTGACTAAAGTGTCCATATAGCACACAGTAGGTGCTCTGTGCTGGATAGGGATCTCACTGTATTACTATGTATATTTAGATACAGTATGTAATCGAGGTGGCTNAGCA
  5   1   2       bld Gas6      out                   IMAGE:3473848.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTCCTACCATATGATTTGGGAGAGCCCTCTAGCAGACGTCTTACCCCTGATGTTGCTACAGTGCCGGATTCTGATCCAGATTCTTTAGCAGTGCTTCATGTCATTCCAACACAGAATTCTGCTCAGGAACGCACATGTTCTATGAACTTTTCCATGGAAACCCCAATGAAACAGCCCCTCCGGGGTGCCATATACAGCCCTTATGGAACAGAGCAGTGGATGGTTCCAGCTCAAGGTCCATATCAGCCTGTCGGCTATACTGCATACCCAACAGACTTAAGTGCACAAGGAGCAGTAGCTCACCCACATAGTGGGATGTCGGACTGGAGCCAATATTCTCTCTTTCCCTACAGCTGCTGGTAAAAGGAAATGCGTATCCACAGTCCTACCCTTCCATTCTAATACATCAGTCCTGATTGCTTGTTGGAGGGAGTTATATGGTATTGCATCTCTGAGGCTTCAGGACCTCATTAAAAACCGTGCGTTGGGAAGATTGCATGATGCAGTTTGGTTACAGTGGTTG
  5   1   2       bld Emb1                            IMAGE:5161666.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGGATGGTTCCAGCTCAAGGTCCATATCAGCCTGTCAGCTATACTGCATACCCAACAGACTTAAGTGCACAAGGAGCAGTAGCTCACCCACATAGTGGGATGTCGGACTGGAGCCAATATTCTCTCTTCCCCTACAGCTGCTGGTAAAAGGAAATGCGTATCCACAGTCCTACCCTTCCATTCTAATACATCAGTCCTGATTGCTTGTTGGAGGGAGTTATATGGTATTGCATCTCTGAGGCTTCAGGACCTCATTAAAAACCGTGCGTTGGGAAGATTGCATGATGCAGTTTGGTTACAGTGTTTGTTGGACTAAAAGGTGTCGCATTATAAGCACAAACAGTAGGGTGCCTCCTGTGCGTGTGATCAGGGGAATCTCGACCTGTAATTTAACTAAATGTATTTATTTTAAAGATTAGCAAGTAAATGTGAGAATCAGAGGGGTGTGCATTAAAGCAGATCTCCAGAAGAGAACCCAGGAAAGAAGCTATGGATTTCTAGAACACAAGCAGTTTTCTCTTGACAGTAGAGGTACAGCCCTGTAACTCTCCATTCACTTAATGTCCCCAGTTATTGCCTTTCACTAAATCCTANAATGGTCTGTCttttttttttttCTTAACTACATAATTGTGATTGCAGTTTTGCACCTTACATTTTCCAGGGTGGGTGGTTTGCAGCACTAATCTGTGAAAGAGTGTACAGCAGGTGTTTGTGCTTTTCTGCACTACTCGGGAAATGTGTGTGTATTTgggggggaaagggggTTTCCCTAAAGATTGAACTGGCTTACTATGAAACTAATGCTGGGGCCTATTCCCCAGGGATAAGGAAAAATTTGGGTATTTCTTTCTAAGGCAAAGGTAACGCTTCCGGGATTGGGCCCCTAGTGGGAAAAGCAAAA
  5   1   2      skin Ga12      out                        XL168p11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTTGTTGGACTAAAAGGTGTCGCATTATAAGCACAAACAGTAGGGTGCCTNCTGTGCGTGTGATCAGGGGAATCTCGACCTGTAATTTAACTAAATGTATTTATTTTAAAGATTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)