Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-IMAGE:6637776.5                       4 END     1           5       25                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012777533 Xl3.1-IMAGE:3557373-IMAGp.5 - 20 ESTs
                                                                       .......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:3557373-IMAGp.5                                                                                                            ACAAGGGCTGGGGGATCCGGGGTTTGGATGATATAGCGAAAGGCTCCTTTGTCTGCATCTATGCAGGTAAGATCCTCACTGATGACTTTGCGGACAAAGAAGGCCTGGAGATGGGCGACGAGTACTTTGCTAACCTGGACCACATAGAAAGTGTTGAGAACTTTAAGGAGGGCTATGAGAGCGACGCCAAGTCTTCCTCCGATAGCAGCGGCGTAGACCTCAAAGAGGACCATGAGGAAAACAGTGGCAGTGAAGATCAGGAAGAGTCCAATGACAGCTCAGATGACAATTTTGGCAAGAACGAGGACATCACGACCAGCTCAGTGTGGCGCAGTTATGCCACCCGCAGAACCACAAGAGGCCAGAAGGAGAACGGAACGTCCGAGACTGCTTCCAAGGATTCAAGGACTCGGGATGAGACCACCGACTGCAAACTGCCAGAGGAGACCTCCAAGAACAAAGTGGCCTCCTGGTTGAGTTCAAACACCATGGCGGACTCTGTTATGGACTCTGACAGCAGGTCCTCCCTAAAGATGGGAGAGGCATTAGAGACCGATAAACCTAAGGAATCAGAAGAGGCAAGCAAATACCCAAGATTCGCAGAAGGAAACCGAGCGTACGGTTACAACCCCACCCCGACCAAAAAAGATGGTGTGCGGCGACCTGTCACCAAAACCGCATTACACCAGATCAAGCGGCAGTCAAGCTCAGCACAACCTACTGAAGAAGTCCTGACTTTATCCAGCAGCTCAGACAGTGAGGTGGGAAGTGGGACCAATGGTAGCAAAAAACCTGCAGCTCAGGCCACAGCCAACGATAGTGACGACATTCAGACAATTTCATCTGGATCCGATGAGGAAGAGGAGAAGAAGAATGTAGCTGCTTCTGCTGGTCCTGTAAAAAGACAAGTGGCCGTAAAATCCACCCGAGGATTTGCCTTAAAATCCACACACGGCATCACTGTGAAAAGCAACATGGCGTCGGGTGAGGGCGGTCCCGGGCGCAGGAACACGCGGCAGTTCTTTGATGGGGAGGAGTCCTGTTACATTATTGATGCAAAACTTGAAGGCAACTTGGGTCGATACTTGAATCATAGCTGCAGCCCCAACCTCTTTGTACAGAACGTGTTTGTGGATACACATGATCTACGCTTCCCGTGGGTGGCCTTCTTTGCCAGCAAGAGGATTCGGGCTGGTACTGAGCTCACGTGGGATTATAATTATGAGGTGGGCAGTGTAGAAGGAAAGAAACTCCTGTGCTGCTGCGGATCCACAGAATGTCGGGGTCGTCTCCTATAAACTCACTGTAAAGGTTATATCAGGCCTTTCATTTTATCCCTACATTTCTCTTGCTTTTGTTTCCCTGTGAAATGATCATGTGACAGTGAATTAATCCCCAGTAAGTCAGCGCACTATCCGTATGTCTTGTATAGATACTTTATAAGTCTGCCACACTCCCACCCAGCACCCCCCAGATTTTTTTTTTTTTTGTAGATTTAGCCGTTTGTTTCCCATGTATAAATAAAACGTAATAAAAGGGTTATGCTCC
                                                  Xl3.1-CHK-1012690010                                                                                                                  GCTGGGGGATCCGGGGTTTGGATGATATAGCGAAAGGCTCCTTTGTCTGCATCTATGCAGGTAAGATCCTCACTGATGACTTTGCGGACAAAGAAGGCCTGGAGATGGGCGACGAGTACTTTGCTAACCTGGACCACATAGAAAGTGTTGAGAACTTTAAGGAGGGCTATGAGAGCGACGCCAAGTCTTCCTCCGATAGCAGCGGCGTAGACCTCAAAGAGGACCATGAGGAAAACAGTGGCAGTGAAGATCAGGAAGAGTCCAATGACAGCTCAGATGACAATTTTGGCAAGAACGAGGACATCACGACCAGCTCAGTGTGGCGCAGTTATGCCACCCGCAGAACCACAAGAGGCCAGAAGGAGAACGGAACGTCCGAGACTGCTTCCAAGGATTCAAGGACTCGGGATGAGACCACCGACTGCAAACTGCCAGAGGAGACCTCCAAGAACAAAGTGGCCTCCTGGTTGAGTTCAAACACCATGGCGGACTCTGTTATGGACTCTGACAGCAGGTCCTCCCTAAAGATGGGAGAGGCATTAGAGACCGATAAACCTAAGGAATCAGAAGAGGCAAGCAAATACCCAAGATTCGCAGAAGGAAACCGAGCGTACGGTTACAACCCCACCCCGACCAAAAAAGATGGTGTGCGGCGACCTGTCACCAAAACCGCATTACACCAGATCAAGCGGCAGTCAAGCTCAGCACAACCTACTGAAGAAGTCCTGACTTTATCCAGCAGCTCAGACAGTGAGGTGGGAAGTGGGACCAATGGTAGCAAAAAACCTGCAGCTCAGGCCACAGCCAACGATAGTGACGACATTCAGACAATTTCATCTGGATCCGATGAGGAAGAGGAGAAGAAGAATGTAGCTGCTTCTGCTGGTCCTGTAAAAAGACAAGTGGCCGTAAAATCCACCCGAGGATTTGCCTTAAAATCCACACACGGCATCACTGTGAAAAGCAACATGGCGTCGGGTGAGGGCGGTCCCGGGCGCAGGAACACGCGGCAGTTCTTTGATGGGGAGGAGTCCTGTTACATTATTGATGCAAAACTTGAAGGCAACTTGGGTCGATACTTGAATCATAGCTGCAGCCCCAACCTCTTTGTACAGAACGTGTTTGTGGATACACATGATCTACGCTTCCCGTGGGTGGCCTTCTTTGCCAGCAAGAGGATTCGGGCTGGTACTGAGCTCACGTGGGATTATAATTATGAGGTGGGCAGTGTAGAAGGAAAGAAACTCCTGTGCTGCTGCGGATCCACAGAATGTCGGGGTCGTCTCCTATAAACTCACTGTAAAGGTTATATCAGGCCTTTCATTTTATCCCTACATTTCTCTTGCTTTTGTTTCCCTGTGAAATGATCATGTGACAGTGAATTAATCCCCAGTAAGTCAGCGCACTATCCGTATGTCTTGTATAGATACTTTATAAGTCTGCCACACTCCCxxCxxxCACCCCxxxxxxxxxxxxTTTTTTTGTAGATTTAGCCGTTTGTTTCCCATGTATAAATAAAACGTAATAAAAGGGTTATGCTCCTTACTG
                                                      consensus depths                                                                                                                 2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     6     7     6     7     5     7     6     7     6     7     6     7     6     7     5     6     5     6     7     9     7     9     6     9     7     9     7     9     7     9     6    10     8    10     7    10     6     9     6     9     6     9     7     9     7     9     7     9     7     9     7    10     8    10     7    10     8    10     8    10     8    10     8    10     8    10     9    10     9    10     9    11     9    10     9    10     8    10     7    10     8    10     7     9     7     9     7     9     7     9     7     9     8    10     9    11     8    10     6    11     6    11     8    11     9    10     8    10     8    10    10    12    10    12     8    11     9    11     9    11    10    12     7    12     9    11     9    11    10    10     9    10    10    10    10    10    10    10    10    10     9     9     9     9     9     9     8     9     9     9     6     9     6     9     6     9     6     9     5     9     5     9     5     9     5     9     3     9     3     9     3     9     3     9     3     9     2     8     3     7     2     7     2     7     2     6     2     6     2     5
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGATGGCAGCTAAAGGTCATGACACTTCACCCATA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCTTTTAACCTTACATCTCTCAT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ----------T-
  5   1   2       bld Egg1      in                    IMAGE:4783781.5p GCACGAGGACGAGTGCAACAAGAGATGCAAATGCAGTGCTAATATGTGCAACAACCGCCTTGTACAACATGGGCTTCAGGTGCGACTCCAACTCTTCAAAACCCAGAACAAGGGCTGGGGGATCCGGGGTTTGGATGATATAGCGAAAGGCTCCTTTGTCTGCATCTATGCAGGTAAGATCCTCACTGATGACTTTGCGGACAAAGAAGGCCTGGAGATGGGCGACGAGTACTTTGCTAACCTGGACCACATAGAAAGTGTTGAGAACTTTAAGGAGGGCTATGAGAGCGACGCCAAGTCTTCCTCCGATAGCAGCGGCGTAGACCTCAAAGAGGACCATGAGGAAAACAGTGGCAGTGAAGATCAGGAAGAGTCCAATGACAGCTCAGATGACAATTTTGGCAAGAACGAGGACATCACGACCAGCTCAGTGTGGCGCAGTTATGCCACCCGCAGAACCACAAGAGGCCAGAAGGAGAACGGAACGTCCGAGACTGCTTCCAAGGATTCAAGGACTCGGGATGAGACCACCGACTGCAAACTGCCAGAAGAGACCTCCAAGAACAAAGTGGCCTCCTGGTTGAGTTCAAACACCATGGCGGACTCT
  3  -1   2       add Egg5                            IMAGE:3430504.3p                        GCTGGAGCTCCACCGCGGTGGCCCCGGGGAATTCCCCGGGACAACATGGGCTCCAGGTGCGCCTCCAACTCTTCAAAACCCAAAACAAGGGCTGGGGGATCCGGTGTTTGGATGATATAGCAAAAGGCTCCTTTGTCTGCATCTATGCAGGTAAGATCCTCACAGATGACTTTGCAGACAAAGAAGGTCTGGAGATGGGTGACGAGTACTTTGCTAACTTGGACCACATAGAAAGTGTTGAGAACTATAAGGAAGGCTATGAGAGCGACGCCAAGTCTTCCTCTGATAGCAGCGGCGTCGACCTCAAAGAGGACAACGAGGAAAACAGCGGCAGCGATGATCAGGACGAGTCCAACGACAGTTCAGATGACAATTTTGGCAAGAACGAGGACATCACAACCAGCTCAGTGTGGCGCAGTTATGCCACCCGCAGAACAACAAGAGGCCAGAAGGAGAACGGAACGTCGGAGACTGCTTCCAAGGACTCTGCTCTGGCCCGACAAACCAGTCNGGATGAGACCAATGACTGCAAACTGCCCGAGGAGACCTCCAAGAACAAAGTGGGTTCCTGGCTAAGTTCAAACACCATGGCAGACTCTATTATGGACTCTGACAGTAAGTCTTTCCTAAAGATGGGAGATGCACCAGAGCAGATAAACCTAGGGATCGGAGGAGGGAGCAAATACCAAGGCATGGAGAAGGAAACCGATGTCGGC
  5   1   2       bld Em10                            IMAGE:8320375.5p                                                                                                                                                       CTCCTTTGTCTGCATCTATGCAGGTAAGATCCTCACTGATGACTTTGCGGACAAAGAAGGCCTGGAGATGGGCGACGAGTACTTTGCTAACCTGGACCACATAGAAAGTGTTGAGAACTTTAAGGAGGGCTATGAGAGCGACGCCAAGTCTTCCTCCGATAGCAGCGGCGTAGACCTCAAAGAGGACCATGAGGAAAACAGTGGCAGTGAAGATCAGGAAGAGTCCAATGACAGCTCAGATGACAATTTTGGCAAGAACGAGGACATCACGACCAGCTCAGTGTGGCGCAGTTATGCCACCCGCAGAACCACAAGAGGCCAGAAGGAGAACGGAACGTCCGAGACTGCTTCCAAGGATTCAAGGACTCGGGATGAGACCACCGACTGCAAACTGCCAGAGGAGACCTCCAAGAACAAAGTGGCCTCCTGGTTGAGTTCAAACACCATGGCGGACTCTGTTATGGACTCTGACAGCAGGTCCTCCCTAAAGATGGGAGAGGCATTAGAGACCGATAAACCTAAGGAATCAGAAGAGGCAAGCAAATACCCAAGATTCGCAGAAGGAAACCGAGCGTACGGTTACACCCCACCCCGACCAAAAAGATGGTGTGCGGCGACTGTCACAAAACGCATACACAGATCAAGCGCAGCAGCTCAGCCACCTACTGAGAGTCTGACTTTTCAGCGCTCAACGTGAGTGGAGTGGACATGTAGCAAAACTGACTCAGCACGCAAGTATGCGACTCGACATTCTCGATCATAGAAGAAAAATGTCTCTTCTGTCGAAGAATGCGTAC
  5   1   2       bld Ga15                               XL422f06ex.5p                                                                                                                                                                                                                                                                              TTAAGGAGGGCTATGAGAGCGACGCCAAGTCTTCCTCCGATAGCAGCGGCGTAGACCTCAAAGAGGACCATGAGGAAAACAGTGGCAGTGAAGATCAGGAAGAGTCCAATGACAGCTCAGATGACAATTTTGGCAAGAACGAGGACATCACGACCAGCTCAGTGTGGCGCAGTTATGCCACCCGCAGAACCACAAGAGGCCAGAAGGAGAACGGAACGTCCGAGACTGCTTCCAAGGATTCAAGGACTCGGGATGAGACCACCGACTGCAAACTGCCAGAGGAGACCTCCAAGAACAAAGTGGCCTCCTGGTTGAGTTCAAACACCATGGCGGACTCTGTTATGGACTCTGACAGCAGGTCCTCCCTAAAGATGGGAGAGGCATTAGAGACCGATAAACCTAAGGAATCAGAAGAGGCAAGCAAATACCCAAGATTCGCAGAAGGAAACCGAGCGTACGGTTACAACCCCACCCCGACCAAAAAAGATGGTGTGCGGCGACCTGTCACCAAAACCGCATTACACCAGATCAAGCGGCAGTCAAGCTCAGCACAACCTACTGAAGAAGTCCTGACTTTATCCAGCAGCTCAGACAGTGAGGTGGGAAGTGGGACCAATGGTAGCAAAAAACCTGCAGCTCAGGCCACAGCCAACGATAGTGACGACATTCAGACAATTTCATCTGGATCCGATGAGGAAGAGGAGAAGAAGAATGTANCTGCTTCTGCTGGTCCTGTAAAA
  5   1   2       bld Ga15                               XL478c09ex.5p                                                                                                                                                                                                                                                                                                                                      CTCAAAGAGGACCATGAGGAAAACAGTGGCAGTGAAGATCAGGAAGAGTCCAATGACAGCTCAGATGACAATTTTGGCAAGAACGAGGACATCACGACCAGCTCAGTGTGGCGCAGTTATGCCACCCGCAGAACCACAAGAGGCCAGAAGGAGAACGGAACGTCCGAGACTGCTTCCAAGGATTCAAGGACTCGGGATGAGACCACCGACTGCAAACTGCCAGAGGAGACCTCCAAGAACAAAGTGGCCTCCTGGTTGAGTTCAAACACCATGGCGGACTCTGTTATGGACTCTGACAGCAGGTCCTCCCTAAAGATGGGAGAGGCATTAGAGACCGATAAACCTAAGGAATCAGAAGAGGCAAGCAAATACCCAAGATTCGCAGAAGGAAACCGAGCGTACGGTTACAACCCCACCCCGACCAAAAAAGATGGTGTGCGGCGACCTGTCACCAAAACCGCATTACACCAGATCAAGCGGCAGTCAAGCTCAGCACAACCTACTGAAGAAGTCCTGACTTTATCCAGCAGCTCAGACAGTGAGGTGGGAAGTGGGACCAACGGTAGCAAAAAACCTGCAGCTCAGGCCACAGCCAACGATAGTGACGACATTCAGACAATTTCATCTGGATCCGATGAGGAAGAGGAGAAGAAGAATGTAGCTGCTTCTGCTGGTCCTGTAAAAAGACAAGTGGCCGTAAAATCCACCCGAGGATTTGCCTTAAAATCCACACACGGCATCACTGTGAAAAGCAACATGGCGTCGG
  5   1   2       bld Spl                             IMAGE:8460787.5p                                                                                                                                                                                                                                                                                                                                      CTCAAAGAGGACCATGAGGAAAACAGTGGCAGTGAAGATCAGGAAGAGTCCAATGACAGCTCAGATGACAATTTTGGCAAGAACGAGGACATCACGACCAGCTCAGTGTGGCGCAGTTATGCCACCCGCAGAACCACAAGAGGCCAGAAGGAGAACGGAACGTCCGAGACTGCTTCCAAGGATTCAAGGACTCGGGATGAGACCACCGACTGCAAACTGCCAGAGGAGACCTCCAAGAACAAAGTGGCCTCCTGGTTGAGTTCAAACACCATGGCGGACTCTGTTATGGACTCTGACAGCAGGTCCTCCCTAAAGATGGGAGAGGCATTAGAGACCGATAAACCTAAGGAATCAGAAGAGGCAAGCAAATACCCAAGATTCGCAGAAGGAAACCGAGCGTACGGTTACAACCCCACCCCGACCAAAAAAGATGGTGTGCGGCGACCTGTCACCAAAACCGCATTACACCAGATCAAGCGGCAGTCAAGCTCAGCACAACCTACTGAAGAAGTCCTGACTTTATCCAGCAGCTCAGACAGTGAGGTGGGAAGTGGGACCAATGGTAGCAAAAAACCTGCAGCTCAGGCCACAGCCAACGATAGTGACGACATTCAGACAATTTCATCTGGATCCGATGAGGAAGAGGAGAAGAAGATGTAGCTGCTTCTGCTGGTCCTGTAAAGACAGTGGCCGTAAATCCACCGAGGATTGCCNTAAATCACACACGCATCACTGTGAAAGCACATGCGTCTGTGAGGCGTCCNGGCGCAGACCACGCAGTCTTGATGGGAGATCTGTACTATGAGCAACTGAGGACT
  5   1   2       add Em10                            IMAGE:7982412.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGACAACCAGTCGGGATGAGACCAATGACTGCAAACTACCCGAGGAGACCTCCAAGAACAAAGTGGCTTCCTGGCTAAGTTCAAACACCATGGCAGACTCTATTATGGACTCTGACAGTAGGTCTTCCCTAAAGATGGGAGATGCACCAGAAGCAGATAAACCTAAGGAATCGGAAGAGGCGAGCAAATACCCAGGGCATGGAGAAGGAAACCGGATGTACGGCTACAATCCCGCTCCAGCCAAAAAAGATGGCGTGCGACGACCCGTTAGCAAAACCGCATTGCACCAGATCAGGCGGCAGTCGAGCTCAGCGCAACCTACCGATGAAGTTCTGACCCTCTCCAGCAGCTCAGAGAGTGAGGTGGGAAGTGGGACCAACGGCAGCAAAAAACCTGCTGCTCAGGCCACAGCAAATGACAGTGACGATATCCAGACAATCTCATCTGGATCTGACGAGGAAGAGGAGAAGAAGCACGTAGCTACTAATGCAGGACCTGTAAAAAGACAAGTGGCTGTAAAATCCACCCGAGGCTTTGCCTTAAAATCCACCCACGGGATCACTGTGAAAACCAACATGGCGTCGGGTGAGGGAGGAGTAGGACGCCGGACCACGCGACAGTTCTTCGATGGGGAGGAGTCCTGTTACTTATTGATGCAAAACTTGAAGGCAACTTGGGTCGATACTTGAATCATAGCTGCAGCCCCAACCCTCTTGTACGGATGTGTTTGTGGAACACATGATCTGCGCTTCCCTTGGGTGGCCTTCCTCTGCAGCAA
  5   1   2      seed Neu4                   IMAGE:3557373-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGCGGGACAGCAGGTCCTCCCTAAAGATGGGAGAGGCATTAGAGACCGATAAACCTAAGGAATCAGAAGAGGCAAGCAAATACCCAAGATTCGCAGAAGGAAACCGAGCGTACGGTTACAACCCCACCCCGACCAAAAAAGATGGTGTGCGGCGACCTGTCACCAAAACCGCATTACACCAGATCAAGCGGCAGTCAAGCTCAGCACAACCTACTGAAGAAGTCCTAACTTTATCCAGCAGCTCAGACAGTGAGGTGGGAAGTGGGACCAATGGTAGCAAAAAACCTGCAGCTCAGGCCACAGCCAACGATAGTGACGACATTCAGACAATTTCATCTGGATCCGATGAGGAAGAGGAGAAGAAGAATGTAGCTGCTTCTGCTGGTCCTGTAAAAAGACAAGTGGCCGTAAAATCCACCCGAGGATTTGCCTTAAAATCCACACACGGCATCACTGTGAAAAGCAACATGGCGTCTGGTGAGGGCGGTCCCGGGCGCAGGAACACACGGCAGTTCTTTGATGGGGAGGAGTCCTGTTACATTATTGATGCAAAACTTGAAGGCAACTTGGGTCGATACTTGAATCATAGCTGCAGCCCCAACCTCTTTGTACAGAACGTGTTTGTGGATACACATGATCTACGCTTCCCGTGGGTGGCCTTCTTTGCCAGCAAGAGGATTCGGGCTGGTACTGAGCTCACGTGGGATTATAATTATGAGGTGGGCAGTGTAGAAGGAAAGAA
  5   1   2       bld Neu4                            IMAGE:3557373.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGTGGTCCTCCCTAAAGATGGGAGAGGCATTAGAGACCGATAAACCTAAGGAATCAGAAGAGGCAAGCAAATACCCAAGATTCGCAGAAGGAAACCGAGCGTACGGTTACAACCCCACCCCGACCAAAAAAGATGGTGTGCGGCGATCCTGTCACTCAAAACCTGCATTACATCCAGATCAAGNCGGCAGTCAATGCTCAGCACAANCCTACTGAAGAAGTCCTAACTTTATCCAGCAGCTCAGACAGTGAGGTGGGAAGTGGGACCAATGGTAGCAAAAAACCTGCAGCTCAGGCCACAGCCAACGATAGTGACGACATTCAGACAATTTCATCTGGATCCGATGAGGAAGAGGAGAAGAAGAATGTAGCTGCTTCTGCTGGTCCTGTAAAAAGACAAGTGGCCGTAAAATCCACCCGAGGATTTGCCTTAAAATCCACACACGGCATCACTGTGAAAAGCAACATGGCGTCTGGTGAGGGCGGTCCCGGGCGCAGGAACACACGGCAGTTCTTTGATGGGGAGGAGTCCTGTTACATTATTGATGCAAAACTTGAAGGCAACTTGNGTCGATACTTGAATCATAGCTGCAGC
  5   1   2       bld Neu4      in                    IMAGE:3475796.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGCAGGTCCTCCCTAAAGATGGGAGAGGCATTAGAGACCGATAAACCTAAGGAATCAGAAGAGGCAAGCAAATACCCAAGATTCGCAGAAGGAAACCGAGCGTACGGTTACAACCCCACTCTTTCCAAAAAAGATGGTGTGCGGNGACCTGTCACCAAAACCGCATTACACCAGATCAAGCGGCAGTCAAGCTCAGCACAACCTACTGAAGAAGTCCTAACTTTATCCAGCAGCTCAGACAGTGAGGTGGGAAGTGGGACCAATGGTAGCAAAAAACCTGCAGCTCAGGCCACAGCCAACGATAGTGACGACATTCAGACAATTTCATCTGGATCCGATGAGGAAGAGGAGAAGAAGAATGTAGCTGCTTCTGCTGGTCCTGTAAAAAGACAAGTGGCCGTAAAATCCACCCGAGGATTTGCCTTAAAATCCACACACGGCATCACTGTGAAAAGCAACATGGCGTCTGGTGAGGGCGGTCCCGGGCGCATGAACACACCGCAGTTCTTTGATGGGGAG
  5   1   2       bld Neu7                                 XL048c21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAGCAAATACCCAAGNATTCGCAGAAGGAAACCGAGCGTACGGTTACAACCCCACCCCGACCAAAAAAGATGGTGTGCGGCGACCTGTCACCAAAACCGCATTACACCAGATCAAGCGGCAGTCAAGCTCAGCACAACCTACTGAAGAAGTCCTGACTTTATCCAGCAGCTCAGACAGTGAGGTGGGAAGTGGGACCAACGGTAGCAAAAAACCTGCAGCTCAGGCCACAGCCAACGATAGTGACGACATTCAGACAATTTCATCTGGATCCGATGAGGAAGAGGAGAAGAAGAATGTAGCTGCTTCTGCTGGTCCTGTAAAAAGACAAGTGGCCGTAAAATCCACCCGAGGATTTGCCTTAAAATCCACACACGGCATCACTGTGAAAAGCAACATGGCGTCGGGTGAGGGCGGTCCCGGACGCAGGAACACGCGGCAGTTCTTTGATGGGGAGGAGTCCTGTTACATTATTGATGCAAAACTTGAAGGCAACTTGGGTCGATACTTGAATCATAGCTGCAGCCCCAACCTCTTTGTACAGAACGTGTTTGTGGATACACATGATCTACGCTT
  5  -1   2       bld Sp1                             IMAGE:5507056.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCAGCGCGTCAAGTCAGCACACNTATGAGAAGTCTGACTTATCAGCAGTCAGACAGGAGTGGGAGTGGGACCACGGTAGCAAAAACTTGCAGCTCAGGCCACAGCCAACGATAGTGACGACATTCAGACAATTTCATCTGGATCCGATGAGGAAGAGGAGAAGAAGAATGTAGCTGCTTCTGCTGGTCCTGTAAAAAGACAAGTGGCCGTAAAATCCACCCGAGGATTTGCCTTAAAATCCACACACGGCATCACTGTGAAAAGCAACATGGCGTCGGGTGAGGGCGGTCCCGGGCGCAGGAACACGCGGCAGTTCTTTGATGGGGAGGAGTCCTGTTACATTATTGATGCAAAACTTGAAGGCAACTTGGGTCGATACTTGAATCATAGCTGCAGCCCCAACCTCTTTGTACAGAACGTGTTTGTGGATACACATGATTTACGCTTCCCGTGGGTGGCCTTCTTTGCCAGCAAGAGGATTCGGGCTGGTACTGAGCTCACGTGGGATTATAATTATGAGGTGGGCAGTGTAGAAGGAAAGAAACTCCTGTGCTGCTGCGGATCCACAGAATGTCGGGGTCGTCTCCTATAAACTCACTGTAAAGGTTATATCAGGCCTTTCATTTTATCCCTACATTTCTCTTGCTTTTGTTTTCTCTGTGAAATGATCATGTGACAGTGAATTAATCCTCCAGTAAGTAGTAAGTCAGCGCACTATCCGTATGTCTTGTATAGATACTTTATAAGTCTGCCACACTCCCACCCCCCAGAtttttttttttttGTAGACTTAGCCGTTCTTTCCCTTTAAACGTACCTATACTGGCAACGCACCNN
  3   1   2       add Tail      out                   IMAGE:8542123.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATTGAACACGCGACAAAGTCTGTTCAGCAAGCATGACGGACGATCTGCAATTCATCGATCGACTGAAGAGAAAGAGCAGTAGCTACTATGCAGACGTAAAAGACAAGTGGCTGTAATCCACCGAGCTTGCTAAATCCACCCACGGATCACTGTGAAACACATGCGTCGGTGAGGGAGGAGTAGACGCCGACACGCGACAGTCTTCGATGGGGAGGAGTCCTGTTACATTATGATGCAAAACTTGAAGGCAACTTGGGTCGATACTTGAATCATAGCTGCAGCCCCAATCTCTTTGTACAGAATGTGTTTGTGGATACACATGATCTGCGCTTCCCTTGGGTGGCTTCTTCGCCAGCAAGAGGATCCGCGCTGGTACTGAGCTCACGTGGGATTATAATTATGAGGTTGGCAGTGTAGAAGGCAAGAAACTCCTGTGCTGCTGCGGATCCACAGAATGTCGTGGGCGCCTCCTGTAAACTCACTGTAAAGATGGCAGCTAAAGGTCATGACACTTCACCCATAGTTATAAGCCTTTCCTTTTAACCTTACATCTCTCATCTTTTTTTTTTTTTTCTTCCCCCTGTTAAATTATCACAACCCCCTGTAAGTCATCACACTGTCCCCATATGTAATAAAGGGCACAGGGTTTGCCCAGGAGCAGTAACCCATAGCAGCCAATAAGATGTTTGCTTTTAAACAGGTGACCAGTAAATGCTACCTGCTGATTGGTTGCTATGGATTATTGCTCCTGGGCACACTTAGTGCCTTTTATTACATAATAATGCCCAGAACACTCCCCCTGTTTATTTGTAGCTTTAGCTAGATGTTTGATATTTTTTACCATGTTTAAATAAAATGTAGTAAAAGGGTTTACGTCCCTTACTGTCTGGAACGAAAGACTAACAAGTGTTTGCTGCAGCGTTATATTAATTTC
  3   1   2       bld Neu4      in                    IMAGE:3475796.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGGGCATCACTGTGAAAAGCAACATGGCGTCTGGTGAGGGCGGTCCCGGGCGCAGGAACACACGGCAGTTCTTTGATGGGGAGGAGTCCTGTTACATTATTGATGCAAAACTTGAAGGCAACTTGGGTCGATACTTGAATCATAGCTGCAGCCCCAACCTCTTTGTACAGAACGTGTTTGTGGATACACATGATCTACGCTTCCCGTGGGTGGCCTTCTTTGCCAGCAAGAGGATTCGGGCTGGTACTGAGCTCACGTGGGATTATAATTATGAGGTGGGCAGTGTAGAAGGAAAGAAACTCCTGTGCTGCTGCGGATCCACAGAATGTCGGGGTCGTCTCCTATAAACTCACTGTAAAGGTTATATCAGGCCTTTCATTTTATCCCTACATTTCTCTTGCTTTTGTTTCCCTGTGAAATGATCATGTGACAGTGAATTAATCCCCAGTAAGTAGTAAGTCAGCGCACTATCCGTATGTCTTGTATAGATACTTTATAAGTTTGCCACACTCCCACCCCCCAGATTTTTTTTTTTTTTGTAGATTTAGCCGTTTGTTTNCCATGTATAAATAAAACGTAATAAAAGGGTTATGCTCCTTACTGGCCCGAAAA
  3   1   2       bld Egg1      in                    IMAGE:4783781.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCAACATGGCGTCGGGTGAGGGCGGTCCCGGGCGCAGGAACACGCGGCAGTTCTTTGATGGGGAGGAGTCCTGTTACATTATTGATGCAAAACTTGAAGGCAACTTGGGTCGATACTTGAATCATAGCTGCAGCCCCAACCTCTTTGTACAGAACGTGTTTGTGGATACACATGATCTTCGCTTCCCGTGGGTGGCCTTCTTTGCCAGCAAGAGGATTCGGGCTGGTACTGAGCTCACGTGGGATTATAATTATGAGGTGGGCAGTGTAGAAGGAAAGAAACTCCTGTGCTGCTGCGGATCCACAGAATGTCGGGGTCGTCTCCTATAAACTCACTGTAAAGGTTATATCAGGCCTTTCATTTTATCCCTACATTTCTCTTGCTTTTGTTTCCCTGTGAAATGATCATGTGACAGTGAATTAATCCCCAGTAAGTCAGCGCACTATCCGTATGTCTTGTATAGATACTTTATAAGTCTGCCACACTCCCACCCCCCAGATTTTTTATCTTTTTGTAGATTTAGCCGTTTGTTTCCATGTATAAATAAAACGTAATAAAAGGGTTATGCTCCTTAAAAAAAAAAAAAAA
  3   1   2       add Neu4                            IMAGE:3475791.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCGGTCCCGGGCGCAGGAACACACGGCGGTTTTTTGAGGGGAGGAGTCCTGTTACATTATTGATGCAAAACTTGAAGGCAACTTGGGTCGATACTTGAATCATAGATGCAGCCCCAACCTCTTTGTACAGAACGTGTTTGTGGAAACACATGATCTACGCTTCCCGTGGGTGGCCTTCTTTGCCAGCAAGAGGATTCGGGCTGGTAATGAGCTCACGTGGGATTATAATTATGAGGTGGGCAGTGTAGAAGGAAAGAAACTCCTGTGCTGCTGCGGATCCACAGAATGTCGGGGTCGTCTCCTATAAACTCACTGTAAAGGTTAGATCAGGCCTTTCATTTTATCCCTACATTTCTCTTGCATTTGTTTCCCTGTGCAACGATCATGTGACAGTGAATTAATCCCCAGTAAGTAGTAAGTCAGCGCACTATCCGTATGTCTTGTATAGATACTTTATAAGTTTGCCACACTCCCACCCCCCAGATTTTTTTTTTTTTTGTAGATTTAGCCGTTTGTTTCCCATGTATAAATAAAACGTAATAAAAGGGTTATGCTCCTTAATGTCCCGAAAA
  3   1   2       bld Egg2                            IMAGE:5278796.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGATGGGGAGGAGTCCTGTTACATTATTGATGCAAAACTTGAAGGCAACTTGGGTCGATACTTGAATCATAGCTGCAGCCCCAATCTCTTTGTACAGAATGTGTTTGTGGATACACATGATCTGCGCTTCCCTTGGGTGGCCTTCTTCGCCAGCAAGAGGATCCGCGCTGGTACTGAGCTCACGTGGGATTATAATTATGAGGTTGGCAGTGTAGAAGGCAAGAAACTCCTGTGCTGCTGCGGATCCACAGAATGTCGTGGGCGCCTCCTGTAAACTCACTGTAAAGATGGCAGCTAAAGGTCATGACACTTCACCCATAGTTATAAGCCTTTCCTTTTAACCTTACATCTCTCATCTTTTTTTAATTTTCTTCCCCCTGTTAAATTATCACAACCCCCTGTAAGTCATCACACTGTCCCCATATGTAATAAGGGGCACACTTAGTGCCTTTTATTACATAATAATGCCCAGAACACTCCCCCTGTTTATTTGTAGCTTTAGCTAGATGTTTGATATTTTTTACCATGTTTAAATAAAATGTAGTAAAAGGGTTTACGTCCCT
  5   1   2       bld Tbd2                   IMAGE:3201045-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGCAACTTGGGTCGATACTTGAATCATAGCTGCAGCCCCAACCTCTTTGTACAGAACGTGTTTGTGGATACACATGATCTTCGCTTCCCGTGGGTGGCCTTCTTTGCCAGCAAGAGGATTCGGGCTGGTACTGAGCTCACGTGGGATTATAATTATGAGGTGGGCAGTGTAGAAGGAAAGAAACTCCTGTGCTGCTGCGGATCCACAGAATGTCGGGGTCGTCTCCTATAAACTCACTGTAAAGGTTATATCAGGCCTTTCATTTTATCCCTACATTTCTCTTGCTTTTGTTTCCCTGTGAAATGATCATGTGACAGTGAATTATTCCCCAGTAAGTCAGCGCACTATCCGTATGTCTTGTATAGATACTTTATAAGTCTGCCACACTCCCACCCAGTTTTTT
  5   1   2       bld Tbd2                            IMAGE:3201045.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGCAACTTGGGTCGATACTTGAATCATATCTGCAGCCCCAACCTCTTTGTACAGAACGTGTTTGTGGATACACATGATCTTCGCTTCCCGTGGGTGGCCTTCTTTGCCAGCAAGAGGATTCGGGCTGGTACTGAGCTCACGTGGGATTATAATTATGAGGTGGGCAGTGTAGAAGGAAAGAAACTCCTGTGCTGCTGCGGATCCACAGAATGTCGGGGTCGTCTCCTATAAACTCACTGTAAAGGTTATATCAGGCCTTTCATTTTATCCCTACATTTCTCTTGCTTTTGTTTCCCTGTGAAATGATCATGTGACAGTGAATTATTCCCCAGTAAGTCAGCGCACTATCCGTATGTCTTGTATAGATACTTTATAAGTCTGCCACACTCCCACCCAGtttttttttGTAGATTTAGCCGTTTGTTTCCATGTATAAATAAAACTTAAT
  5   1   2       add Egg1                               PBX0123A01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGTGTTTGTGGATACACATGATCTGCGCTTCCCTTGGGTGGCCTTCTTTGCCAGCAAGAGGATCCGCGCTGGTACTGAGCTCACGTGGGATTACAATTATGAGGTTGGCAGTGTAGAAGGCAAGAAACTCCTGTGCTGCTGCGGATCCACAGAATGTCGTGGGCGTCTCCTGTAAACTCACTGTAAAGATGGCAGCTAAAGGTCATGACACTTCACCCATAGGTATAAGCCTTTCCTTTTAACCTTACATCTCTCATCtttttttttttttCTTCCCCCTGTTAAATTATCACAACCCCCTGTAAGTCATCACACTGTCCCCCATATGTAGTGGGGGGCACACAGTTTGCCCAGGAGCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)