Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 95%

 1012777546 Xl3.1-IMAGE:6318926.5 - 9 ESTs
                                                                       -20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6318926.5                     TTCCCAATCAGTGGAGGATATTGGCATACCGAATTGTTTGTACAATGGAATTTCCAGATCTAGGGCGTCATTGCTCAGAGACAACATGCAAGCAACTTGATTTCCTTCCCCTAAAATGTGATGCCTGCGAGGAGCTTTTCTGTAAAAATCACATCACATATGACCAACACAAGTGTTCAGCTGCCTACATGAAGAATGTGCTAGTTCCTGTCTGTCCACTGTGTGGCACTCCAGTTCCAGTTAAGAAAGGAGAAATGGCAGATATTGCTGTTGGTCAACACATTGACAAAAATTGCACCTCAGATCTTTCAAGACCCAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAACAAAGAACTAATGAAAATCATATGTGACCATTGTCACAATAATTTCTGCCTATCGCATAGACATCCTGTGGACCACAACTGTAAAGCAGGAGAACAAGTCCTTAATAAAGCTGGTTTGGCAGCCCTGAACAGATCTAAAATATCTTCTCAAGATTATAATTCAAAAGGCAATCATACCTCCAATTCCACAAGAAGTAAAGCATCGGAAATTGTCAAGTCGAATCAAAAAAGAAACATTCAGCCTGGTTCTAAAGCACCAAAAGGGATCACAGTTGATATCCACAGTGGATTGAATGAAGATGAAGCTCTAAAGAAGGCTCTGGAACTGTCTTTACTGGAGGCAGGAGTCAACAACGTACTGACGTTAAGCTCACAGGATGAAGATCTGGAACTAGAGCAGGCTTTAGCCGCCAGCAGAGAGGAATACAGACTGTTTCAGAGGAAAGCTGTTAAAGCCACAGGGAAATGACATGTTTTTAATGTGCATG
                                                  Xl3.1-CHK-1012696699                           ATCAGTGGAGGATATTGGCATACCGAATTGTTTGTACAATGGAATTTCCAGATCTAGGGCGTCATTGCTCAGAGACAACATGCAAGCAACTTGATTTCCTTCCCCTAAAATGTGATGCCTGCGAGGAGCTTTTCTGTAAAAATCACATCACATATGACCAACACAAGTGTTCAGCTGCCTACATGAAGAATGTGCTAGTTCCTGTCTGTCCACTGTGTGGCACTCCAGTTCCAGTTAAGAAAGGAGAAATGGCAGATATTGCTGTTGGTCAACACATTGACAAAAATTGCACCTCAGATCTTTCAAGACCCAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAACAAAGAACTAATGAAAATCATATGTGACCATTGTCACAATAATTTCTGCCTATCGCATAGACATCCTGTGGACCACAACTGTAAAGCAGGAGAACAAGTCCTTAATAAAGCTGGTTTGGCAGCCCTGAACAGATCTAAAATATCTTCTCAAGATTATAATTCAAAAGGCAATCATACCTCCAATTCCACAAGAAGTAAAGCATCGGAAATTGTCAAGTCGAATCAAAAAAGAAACATTCAGCCTGGTTCTAAAGCACCAAAAGGGATCACAGTTGATATCCACAGTGGATTGAATGAAGATGAAGCTCTAAAGAAGGCTCTGGAACTGTCTTTACTGGAGGCAGGAGTCAACAACGTACTGACGTTAAGCTCACAGGATGAAGATCTGGAACTAGAGCAGGCTTTAGCTGCCAGCAGAGAGGAATACAGACTGTTTCAGAGGAAAGCTGTTAAAGCCACAGGGAAATGACATGTTTTTAATGTGCATGAATAGA
                                                      consensus depths                          3     4     3     4     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     6     6     6     7     5     6     6     6     6     6     6     6     6     6     5     6     4     6     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     5     3     5     3     5     3     5     2     5     2     5     2     4
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----------G-
                                               BLH ATG      44     817                     
                                               BLH MIN      44      94                     
                                               BLH MPR      41      94                     
                                               BLH OVR      44     210                     
                                               CDS MIN      44       5                     
                                               EST CLI     -20       5                     
                                               ORF LNG      44      10                     
                                                                                                                                       PROTEIN --- Ci ==== 2e-015     FAA00178.1 TPA: zinc finger protein [Ciona intestinalis] ================================================================================================================================================================================================================================================================================================================================
                                                                                                                                    PROTEIN === Ce ==== 2e-036     NP_506479.1 arsenite inducible RNA associated protein, Arsenite Inducible Protein AIP-1(22.8 kD) (aip-1) [Caenorhabditis elegans] ===============================================================================================================================================================================================================================================================================
                                                                                                                                       PROTEIN === Ag ==== 6e-048     XP_312629.3 AGAP002339-PA [Anopheles gambiae str. PEST] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                       PROTEIN === Dm ==== 3e-052     NP_001097074.1 CG12795 CG12795-PB [Drosophila melanogaster] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                       PREDICTED = Cf ==== 4e-054     XP_537924.2 PREDICTED: similar to CG12795-PA isoform 1 [Canis familiaris] ==================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                       PREDICTED = Gg ==== 3e-059     XP_422896.1 PREDICTED: similar to Hypothetical protein MGC66295 [Gallus gallus] =========================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                       PREDICTED = Sp ==== 1e-063     XP_001194105.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                       PREDICTED = Hs ==== 5e-066     NP_620157.1 hypothetical protein BC018415 [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                       PREDICTED = Mm ==== 5e-067     NP_081122.1 RIKEN cDNA 1110060O18 [Mus musculus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                       PROTEIN === Bt ==== 5e-069     NP_001092376.1 zinc finger, AN1-type domain 2B [Bos taurus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                       PREDICTED = Dr ==== 6e-075     NP_956811.1 hypothetical protein MGC66295 [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                       PREDICTED = Xt ==== 3e-124     NP_001016899.2 hypothetical protein LOC549653 [Xenopus tropicalis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                       PROTEIN === Xl ==== 6e-153     NP_001086833.1 MGC83152 protein [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6318926.5                                                                 ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA
                                                                   ORF                                                                 ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  5   1   2       bld Egg3 5g                         IMAGE:6324638.5p TCCCGGGACGACCCGGCAACTCGTCCCATCAGTGGAGGAATTGGCATACCGAATTGTTTGTACAATGGAATTTCCAGATCTAGGGCGTCATTGCTCAGAGACAACATGCAAGCAACTTGATTTCCTTCCCCTAAAATGTGATGCCTGCGAGGAGCTTTTCTGTAAAAATCACATCACATATGACCAACACAAGTGTTCAGCTGCCTACATGAAGAATGTGCTAGTTCCTGTCTGTCCACTGTGTGGCACTCCAGTTCCAGTTAAGAAAGGAGAAATGGCAGATATTGCTGTTGGTCAACACATTGACAAAAATTGCACCTCAGATCTTTCAAGACCCAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAACAAAGAACTAATGAAAATCATATGTGACCATTGTCACAATAATTTCTGCCTATCGCATAGACATCCTGTGGACCACAACTGTAAAGCAGGAGAACAAGTCCTTAATAAAGCTGGTTTGGCAGCCCTGAACAGATCTAAAATATCTTCTCAAGATTATAATTCAAAAGGCAATCATACCTCCAATTCCACAAGAAGTAAAGCATCGGAAATTGTCAAGTCGAATCAAAAAAGAAACATTCAGCCTGGTTCTAAAGCACCAAAAGGGATCACAGTTGATATCCACAGTGGATTGAAATGAGATGAAGCTCTAAAGAAGGCTCTGGAACTGTCTTTACTGGAGGCAGGAGTCAACAACGTACTGACGTTAAGCTCACAGGATGAAGATCTGGAACTAGAGCAGGCTTTACCCGCCGCAGAGAGAATACAGACTGTTTCAGAAGAAAGCTGTTAAAGCCACAGGGAAATGTTTTTAATGTGCATGAAATAGAGCATTTTATCCGTTGNAAAATCCGGCCGTTTTTATAACAAGGGCTCTGTA
  5   1   2       bld Ov1  5g                         IMAGE:6319193.5p         ACCGGCAACAGGTTCCCAATCAGTGGAGGATATTGGCATACCGAATTGTTTGTACAATGGAATTTCCAGATCTAGGGCGTCATTGCTCAGAGACAACATGCAAGCAACTTGATTTCCTTCCCCTAAAATGTGATGCCTGCGAGGAGCTTTTCTGTAAAAATCACATCACATATGACCAACACAAGTGTTCAGCTGCCTACATGAAGAATGTGCTAGTTCCTGTCTGTCCACTGTGTGGCACTCCAGTTCCAGTTAAGAAAGGAGAAATGGCAGATATTGCTGTTGGTCAACACATTGACAAAAATTGCACCTCAGATCTTTCAAGACCCAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAACAAAGAACTAATGAAAATCATATGTGACCATTGTCACAATAATTTCTGCCTATCGCATAGACATCCTGTGGACCACAACTGTAAAGCAGGAGAACAAGTCCTTAATAAAGCTGGTTTGGCAGCCCTGAACAGATCTAAAATATCTTCTCAAGATTATAATTCAAAAGGCAATCATACCTCCAATTCCACAAGAAGTAAAGCATCGGAAATTGTCAAGTCGAATCAAAAAAGAAACATTCAGCCTGGTTCTAAAGCACCAAAAGGGATCACAGTTTGATATCCACAGGTGGATTGAATGAAGATGAAGCTCTAAAGAAGGCTCTGGAACTGTCTTTACTGGGAGCAGGAGTTCACAAAGTACTGAACGTTAAGCTCACAGGATGAAGATCTGGGAACTAGAGCAAGCTTTTAACCGCCCAGCAGAGAGGGATACCGACTGTTTCACAGGGAAAGCTGTTAAAGCCACACGGAAAATGAAATGGTT
  5   1   2       bld Ga12      in                         XL217k20.5p         GCACGAGGCAGGTTCCCAATCAGTCGAGGATATTGGCATACCGAATTGTTTGTACAATGGAATTTCCAGATCTAGGGCGTCATTGCTCAGAGACAACATGCAAGCAACTTGATTTTCTTCCCCTAAAATGTGATGCCTGCGAGGAGCTTTTCTGTAAAAATCACATCACATACGACCAACACAAGTGTTCAGCTGCCTACATGAAGAATATGCTAGTTCCTGTCTGTCCACTGTGTGGCACTCCAGTTCCAGTTAAGAAAGGAGAAATGGCAGATATTGCTGTTGGTCAACACATTGACAAAAATTGCACCTCAGATCTTTCAAGACCCAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAACAAAGAACTAATGAAAATCATATGTGACCATTGTCACAATAATTTCTGCCTATCTCATAGACATCCTGTGGACCACAACTGTAAAGCAGGAGAACAAGTCCTAAATAAAGCTGGGTTGGCAGCCCTGAACAGATCTAAAATATCTTCTCAAGATTATAATTCAAAAGGCNATCATACCTCCNATTCCACAANA
  5   1   2       bld Egg1 5g                            PBX0129C12.5p                 CAGGTTCCCAATCAGTGGAGGATATTGGCATACCGAATTGTTTGTACAATGGAATTTCCAGATCTAGGGCGTCATTGCTCAGAGACAACATGCAAGCAACTTGATTTCCTTCCCCTAAAATGTGATGCCTGCGAGGAGCTTTTCTGTAAAAATCACATCACATATGACCAACACAAGTGTTCAGCTGCCTACATGAAGAATGTGCTAGTTCCTGTCTGTCCACTGTGTGGCACTCCAGTTCCAGTTAAGAAAGGAGAAATGGCAGATATTGCTGTTGGTCAGCACATTGACAAAAATTGCACCTCAGATCTTTCAAGACCCAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAACAAAGAACTAATGAAAATCATATGTGACCATTGTCACAATAATTTCTGCCTATCTCATAGACATCCTGTGGACCACAACTGTAAAGCAGGAGAACAAGTCCTAAATAAAGCTGGGTTGGCAGCCCTGAACAGATCTAAAATATCTTCTCAAGATTATAATTCAAA
  5   1   2       bld Te2N 5g                         IMAGE:7766340.5p                                            GCATACCGAATTGTTTGTACAATGGAATTTCCAGATCTAGGGCGTCATTGCTCAGAGACAACATGCAAGCAACTTGATTTCCTTCCCCTAAAATGTGATGCCTGCGAGGAGCTTTTCTGTAAAAATCACATCACATATGACCAACACAAGTGTTCAGCTGCCTACATGAAGAATGTGCTAGTTCCTGTCTGTCCACTGTGTGGCACTCCAGTTCCAGTTAAGAAAGGAGAAATGGCAGATATTGCTGTTGGTCAGCACATTGACAAAAATTGCACCTCAGATCTTTCAAGACCCAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAACAAAGAACTAATGAAAATCATATGTGACCATTGTCACAATAATTTCTGCCTATCGCATAGACATCCTGTGGACCACAACTGTAAAGCAGGAGAACAAGTCCTTAATAAAGCTGGTTTGGCAGCCCTGAACAGATCTAAAATATCTTCTCAAGATTATAATTCAAAAGGCAATCATACCTCCAATTCCACAAGAAGTAAAGCATCGGAAATTGTCAAGTCGAATCAAAAAAGAAACATTCAGCCTGGTTCTAAAGCACCAAAAGGGATCACAGTTGATATCCACAGTGGAATGAATGAAGAA
  5   1   2      seed Ov1  5g                         IMAGE:5048431.5p                                             CATACCGAATTGTTTGTACAATGGAATTTCCAGATCTAGGGCGTCATTACTCAGAGACAACATGCAAGCAACTTGATTTCCTTCCCCTAAAATGTGATGCCTGCGAGGAGCTTTTCTGTAAAAATCACATCACATATGACCAACACAAGTGTTCAGCTGCCTACATGAAGAATGTGCTAGTTCCTGTCTGTCCACTGTGTGGCACTCCAGTTCCAGTTAAGAAAGGAGAAATGGCAGATATTGCTGTTGGTCAACACATTGACAAAAATTGCACCTCAGATCTTTCAAGACCCAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAACAAAGAACTAATGAAAATCATATGTGACCATTGTCACAATAATTTCTGCCTATCGCATAGACATCCTGTGGACCACAACTGTAAAGCAGGAGAACAAGTCCTTAATAAAGCTGGTTTGGCAGCCCTGAACAGATCTAAAATATCTTCTCAAGATTATAATTCAAAAGGCAATCATACCTCCAATTCCACAAGAAGTAAAGCATCGGAAATTGTCAA
  5   1   2       bld Ov1  5g                         IMAGE:6318926.5p                                             CATACCGAATTGTTTGTACAATGGAATTTCCAGATCTAGGGCGTCATTGCTCAGAGACAACATGCAAGCAACTTGATTTCCTTCCCCTAAAATGTGATGCCTGCGAGGAGCTTTTCTGTAAAAATCACATCACATATGACCAACACAAGTGTTCAGCTGCCTACATGAAGAATGTGCTAGTTCCTGTCTGTCCACTGTGTGGCACTCCAGTTCCAGTTAAGAAAGGAGAAATGGCAGATATTGCTGTTGGTCAACACATTGACAAAAATTGCACCTCAGATCTTTCAAGACCCAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAACAAAGAACTAATGAAAATCATATGTGACCATTGTCACAATAATTTCTGCCTATCGCATAGACATCCTGTGGACCACAACTGTAAAGCAGGAGAACAAGTCCTTAATAAAGCTGGTTTGGCAGCCCTGAACAGATCTAAAATATCTTCTCAAGATTATAATTCAAAAGGCAATCATACCTCCAATTCCACAAGAAGTAAAGCATCGGAAATTGTCAAGTCGAATCAAAAAAGAAACATTCAGCCTGGTTCTAAAGCACCAAAAGGGATCACAGTTGATATCCACAGTGGATTGAATGAAGATGAAGCTCTAAAGAAGGCTCTGGAACTGTCTTTACTGGANGCAGGAGTTCACAAAGTACTGACGTTAAGCTCACAGGATGAAGATCTGGAACTAGAGCAGGCTNTAGCCGCCAGCAGAGAGGAATACAGACTGGTTCAGAGGAAAGCTGTTAAAGCCCAGGGAAATGACATGTTTTTAATGTGCATGAATAAAGCATTTTATCTGTTGGAAATTCTGTTGTTTTTATAACAAAGGCTCTGTACGTACATTCTGCCTGGATGTCAACAAATAATGCACGTTACCTAGAAANAATTTTAAAGGGTTA
  3   1   2       bld Ga12      in                         XL217k20.3p                                                                                                                                                                                                                                                                                                                                                                                                                AATCATATGTGACCATTGTCACAATAATTTCTGCCTATCTCATAGACATCCTGTGGACCACAACTGTAAAGCAGGAGAACAAGTCCTAAATAAAGCTGGGTTGGCAGCCCTGAACAGATCTAAAATATCTTCTCAAGATTATAATTCAAAAGGCAATCATACCTCCAATTCCACAAGAAGTAAAGCATCGGAAATTATGAAGTCGAACCAAAAAAGAAACATTCATCCTGGTTCTGAAGCACCAAAAGGGATCACAGTTGATATCCACAGTGGATTGAATGAAGATGAAGCTCTAAAGAAGGCTCTGGAACTGTCTTTACTGGAGGCAGGAGTCAACAACGTACTGACGTTAAGCTCACAGGATGAAGATCTGGAACTAGAGCAGGCTTTAGCTGCCAGCAGAGAGGAATACAGACTGTTTCAGAGGAAAGCTGTTAAAGCCACAGGGAAATGACATGTCTTTAATGTGCATGAATTGAGCATTTTATCTGGCTCTGGTTGTACATTCTGCCTGGATGTCAACAAGTAATGCAGTTACTTAGAAGTATTTTAATGTTTATTTGTAATCGCCTTTTACTACTTGTATTTTCTTGTCATAGGGATTCTTTGTACATACTATAAGCTTCTGTACAGAAGCAATAAAG
  5   1   2       add Ov1                             IMAGE:6318239.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCTTCTGTACAGAAGCAATAAAGTACTATTTTTAAAAAAGAAACATTCAGCCTGGTTCTAAAGCACCAAAAGGGATCACAGTTGATATCCACAGTGGATTGAATGAAGATGAAGCTCTAAAGAAGGCTCTGGAACTGTCTTTACTGGAGGCAGGAGTTCACAAAGTACTGACGTTAAGCTCACAGGATGAAGATCTGGAACTAGAGCAGGCTTTAGCCGCCAGCAGAGAGGAATACAGACTGTTTCAGAGGAAAGCTGTTAAAGCCACAGGGAAATGACATGTTTTTAATGTGCATGAATAGAGCATTTTATCTGTTGTAAATCTGTTGTTTTTATAACAAGGGCTCTGTACGTACCATTCTGCCCTGGATGGCCAACAAGTAAATGGCAGGTTACTTTAAAAAGTAATTTTTAAAAGGGTTTAATTTTGGAAAATCCGCCCCTTTTTAACCAAACTTGGGGAATTTTTTTCCCTTGGGGCCCAAAAAAGGGGGGAATTTTCCTCTTTTGGGttaccccctttaaccccttaatttaaaaggccctttttcccttgggggtccccccGGAAAAAGGCCCCCAATTTATAAAAAGGGGCACCCTCTTTAttttttttttttttGCGGCAAAGCAAGTAGGAAACACCACCTAAACAAGGCGCATAAAACCTGACGACCCAACAANGGGGGGGGCGCGGGGGcccccccccttttcttaaaaaaaagaaatattcccccccccccccaaggggggggggcgcccccccaaaaggtttttttaatgcccccggggaaacaccccaccacgttttttt

In case of problems mail me! (mike.gilchrist@crick.ac.uk)