Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:8535590.5                      17 PI      90          1      784                (no blast hit)

 This cluster: approximate FL confidence score = 83%

 1012777573 Xl3.1-IMAGE:7208123.5 - 5 ESTs
                                                                       ...0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7208123.5    GTCAGGCGCGGAGGCCGCCATTTTGGATCGGAGAGAGTGCTGTTGGACGGATTGAGGCGCCCGGCGGGAGAGCCGTTATCTTCCGTTCGCTTCCCTTTTCCCCCCTTCTAGCCGGTAACATGTCCGATAAGTACATAGGAGACTCGCACCTGGAAGAGACCGGCGAGGAAAAGCAGGACTCACAAGAAAAGGAAGCGGTGACTCCTGAAAAAGCAGAGGAGCAGAAATTGAAAGCCAAATACCCTAATTTAGGACAAAAACCTGGAGGTTCAGATTTCCTGATGAAAAGGCTTCAAAAAGGACAAAAGTACTTTGACTCGGGTGACTACAACATGGCAAAGGCCAAGATAAAGAACAAACAGCTGCCATGCGCAGGGCCAGACAAGAACTTGGTAACCGGAGACCACATCCCTACGCCACAGGACCTTCCGCAGAGGAAGTCTTCACTGGTGACCAGCAAGCTAGCGGGGCATGTCGAGGACTTGCACCACGTGTAAAGAAAGTGACGCCAACGCAGTGGTGCTCCCCGGACGCTGTTACGTCGGTCAACAGAACGAACAACGCGAAACCTTTGAAGGGCGGACAATCACCACTCAACTTGTCGAAGGAAAGGCCTTCTTGCATGGAAAGGGGCACCCATGCACCCGCAGAACTTTATAACCAGAACGTGTAAGATAAATGACTTTGTGAAATCCGCTACATCTCCTGTACGATTCGGCAACTGGATGGATGTACAGAGGCTTCAGACCTCACGGCTTGTGATTTATTTTGAGCTCTCTCGGAAGAGTTTGTGCTACGTCTCAT
                                                  Xl3.1-CHK-1012705616          CGCGGAGGCCGCCATTTTGGATCGGAGAGAGTGCTGTTGGACGGATTGAGGCGCCCGGCGGGAGAGCCGTTATCTTCCGTTCGCTTCCCTTTTCCCCCCTTCTAGCCGGTAACATGTCCGATAAGTACATAGGAGACTCGCACCTGGAAGAGACCGGCGAGGAAAAGCAGGACTCACAAGAAAAGGAAGCGGTGACTCCTGAAAAAGCAGAGGAGCAGAAATTGAAAGCCAAATACCCTAATTTAGGACAAAAACCTGGAGGTTCAGATTTCCTGATGAAAAGGCTTCAAAAAGGACAAAAGTACTTTGACTCGGGTGACTACAACATGGCAAAGGCCAAGATAAAGAACAAACAGCTGCCATGCGCAGGGCCAGACAAGAACTTGGTAACCGGAGACCACATCCCTACGCCACAGGACCTTCCGCAGAGGAAGTCTTCACTGGTGACCAGCAAGCTAGCGGGGCATGTCGAGGACTTGCACCACGTGTAAAGAAAGTGACGCCAACGCAGTGGTGCTCCCCGGACGCTGTTACGTCGGTCAACAGAACGAACAACGCGAAACCTTTGAAGGGCGGACAATCACCACTCAACTTGTCGAAGGAAAGGCCTTCTTGCATGGAAAGGGGCACCCATGCACCCGCAGAACTTTATAACCAGAACGTGTAAGATAAATGACTTTGTGAAATCCGCTACATCTCCTGTACGATTCGGCAACTGGATGGATGTACAGAGGCTTCAGACCTCACGGCTTGTGATTTATTTTGAGCTCTCTCGGAAGAGTTTGTGCTACG
                                                      consensus depths         2     2     2     2     2     2     2     3     2     4     2     4     2     4     2     4     3     4     3     4     3     4     4     5     4     5     4     5     4     5     4     5     5     5     5     5     5     5     5     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     3     4     3     4     3     4     3     4     3     4     3     4     2     4     2     4     2     4
                                               BLH ATG     119     107    
                                               BLH MIN     119      54    
                                               BLH MPR     107      54    
                                               BLH OVR     119     220    
                                               CDS MIN     119      54    
                                               ORF LNG     119       2    
  5   1   2      seed Emb4 5x3               IMAGE:5536925-IMAGp.IMAGp GACGTCAGGCGCGGAGGCCGCCATTTTGGATCGGAGAGAGTGCTGTTGGACGGATTGAGGCGCCCGGCGGGAGAGCCGTTATCTTCCGTTCGCTTCCCTTTTCCCCCCTTCTAGCCGGTAACATGTCCGATAAGTACATAGGAGACTCGCACCTGGAAGAGACCGGCGAGGAAAAGCAGGACTCACAAGAAAAGGAAGCGGTGACTCCTGAAAAAGCAGAGGAGCAGAAATTGAAAGCCAAATACCCTAATTTAGGACAAAAACCTGGAGGTTCAGATTTCCTGATGAAAAGGCTTCAAAAAGGACAAAAGTACTTTGACTCGGGTGACTACAACATGGCAAAGGCCAAGATAAAGAACAAACAGCTGCCATGCGCAGGGCCAGACAAGAACTTGGTAACCGGAGACCACATCCCTACGCCACAGGACCTTCCGCAGAGGAAGTCTTCACTGGTGACCAGCAAGCTAGCGGGGCATGTCGAGGACTTGCACCACGTGTAAAGAAAGTGACGCCAACGCAGTGGTGCTCCCCGGACGCTGTTACGTCGGTCAACAGAACGAACAACGCGAAACCTTTGAAGGGCGGACAATCACCACTCAACTTGTCGAAGGAAAGGCCTTCTTGCATGGAAAGGGGCACCCATGCACCCGCAGAACTTTATAACCAGAACGTGTAAGATAAATGACTTTGTGAAATCCGCTACATCTCCT
  5   1   2      skin Emb4 5x3                        IMAGE:5536925.5p    GTCAGGCGCGGAGGCCGCCATTTTGGATCGGAGAGAGTGCTGTTGGACGGATTGAGGCGCCCGGCGGGAGAGCCGTTATCTCCCGTTCGCTTCCCTTTTCCCCCCTTCTAGCCGGTAACATGTCCGATAAGTACATAGGAGACTCGCACCTGGAAGAGACCGGCGAGGAAAAGCAGGACTCACAAGAAAAGGAAGCGGTGACTCCTGAAAAAGCAGAGGAGCAGAAATTGAAAGCCAAATACCCTAATTTAGGACAAAAACCTGGAGGTTCAGATTTCCTGATGAAAAGGCTTCAAAAAGGACAAAAGTACTTTGACTCGGGTGACTACAACATGGCAAAGGCCAAGATAAAGAACAAACAGCTGCCATGCGCAGGGCCAGACAAGAACTTGGTAACCGGAGACCACATCCCTACGCCACAGGACCTTCCGCAGAGGAAGTCTTCACTGGTGACCAGCAAGCTAGCGGGGCATGTCGAGGACTTGCACCACGTGTAAAGAAAGTGACGCCAACGCAGTGGTGCTCCCCGGACGCTGTTACGTCGGTCAACAGAACGAACAACGCGAAACCCTTTGAGGGCGGACAATCACCACTCAACTTGTCGAAGGAAAGGCCTTCTTGCATGGAAAGGGGCACCCATGCACCCCGCGGAACTTTATTACCCGAACGTGGAAGATAAATGACTTTTGGGAAATCCGCTACATCTCCTGGACGATTCCGCAACTGGATGGATGTACAGAGGGTTTCAGACCTCCCGGGGTTGGGATTTATTTTGGAAGCTCCTCTCGGGAGGAGTTTTGGGGCTACGGTCTCCCATCACGTGCCCTGAATTGGGGAAACTTCCCTAAGGGGGGGTCCTTACCACCAATCCACGAAAAGCCAGGCCCTAACTTATAACGGGG
  5   1   2       bld Te2  5g3  in                    IMAGE:7208123.5p                                    AGAGAGTGGTGTTGGACGGATTGAGGCGCCCGGCGGGAGAGCCGTTATCTTCCGTTCGCTTCCCTTTTCCCCCTTCTAGCCGGTAACATGTCCGATAAGTACATAGGAGACTCGCACCTGGAAGAGACCGGCGAGGAAAAGCAGGACTCACAAGAAAAGGAAGCGGTGACTCCTGAAAAAGCAGAGGAGCAGAAATTGAAAGCCAAATACCCTAATTTAGGACAAAAACCTGGAGGTTCAGATTTCCTGATGAAAAGGCTTCAAAAAGGACAAAAGTACTTTGACTCGGGTGACTACAACATGGCAAAGGCCAAGATAAAGAACAAACAGCTGCCATGCGCAGGGCCAGACAAGAACTTGGTAACCGGAGACCACATCCCTACGCCACAGGACCTTCCGCAGAGGAAGTCTTCACTGGTGACCAGCAAGCTAGCGGGGCATGTCGAGGACTTGCACCACGTGTAAAGAAAGTGACGCCAACGCAGTGGTGCTCCCCGGACGCTGTTACGTCGGTCAACAGAACGAACAACGCGAAACCTTTGAAGGGCGGACAATCACCACTCAACTTGTCGAAGGAAAGGCCTTCTTGCATGGAAAGGGGCACCCATGCACCCGCAGAACTTTATAACCAGAACGTGTAAGATAAATGACTTTGTGAAATCCGCTACATCTCCTGTACGATTCGGCAACTGGATGGATGTACAGAGGCTTCAGACCTCACGGCTTGTGATTTATTTTGAGCTCTCTCGGAAGAGTTTGTGCTACGTCTCATCCTGCCNTGATTGGAAACTCATA
  3   1   2       add Te2  5g3  in                    IMAGE:7208123.3p                                                   CCCGGGCGGGAGAGGCCGGTTATCTTCCGTTTCGCCTCCCTTTTTTCCCCCTTTTTAAAGGCCGTTAACATGTCCGATAAGTACATAGGAGACTCGCACCTGGGAAGAGACCGCGANGGAAAAAGCAGGACTCACAAGAAAAAGGAAGCGGTGACTCCTGAAAAAGCAGAGGAGCAGAAATTGAAAGCCAAATACCNTAATTNAGGACAAAAACCTGGAGGTTCAGATTTCCTGATGAAAAGGCTTCAAAAAGGACAAAAGTACTTTGACTCGGGTGACTACAACATGGCAAAGGCCAAGATAAAGAACAAACAGCTGCCATGCGCAGGGCCAGACAAGAACTTGGTAACCGGAGACCACATCCCTACGCCACAGGACCTTCCGCAGAGGAAGTCTTCACTGGTGACCAGCAAGCTAGCGGGGCATGTCGAGGACTTGCACCACGTGTAAAGAAAGTGACGCCAACGCAGTGGTGCTCCCCGGACGCTGTTACGTCGGTCAACAGAACGAACAACGCGAAACCTTTGAAGGGCGGACAATCACCACTCAACTTGTCGAAGGAAAGGCCTTCTTGCATGGAAAGGGGCACCCATGCACCCGCAGAACTTTATAACCAGAACGTGTAAGATAAATGACTTTGTGAAATCCGCTACATCTCCTGTACGATTCGGCAACTGGATGGATGTACAGAGGCTTCAGACCTCACGGCTTGTGATTTATTTTGAAGCTCTCTCGGAAGAGTTTTGTGCTACGTCTCCATCACTGCCCTGATTGGGAACTTCATTAAGTGGCTCATACCACAATCCAGAAGCCAGTCCTACATTAACTGCTGTCTTTCATCCCATATGCTGTAAAGTGGAGATTTGCCTAAACCCTGAACAGGGGATATAGAAAATTAGGACACGTTTCGGCTATCCCAATTAAAAAATATCGTAAAGCGTT
  5   1   2       bld Te2                             IMAGE:7209995.5p                                                                                                                             GTCCGATAAGTACATAGGAGACTCGCACCTGGAAGAGACCGGCGAGGAAAAGCAGGACTCACAAGAAAAGGAAGCGGTGACTCCTGAAAAAGCAGAGGAGCAGAAATTGAAAGCCAAATACCCTAATTTAGGACAAAAACCTGGAGGTTCAGATTTCCTGATGAAAAGGCTTCAAAAAGGACAAAAGTACTTTGACTCGGGTGACTACAACATGGCAAAGGCCAAGATAAAGAACAAACAGCTGCCATGCGCAGGGCCAGACAAGAACTTGGTAACCGGAGACCACATCCCTACGCCACAGGACCTTCCGCAGAGGAAGTCTTCACTGGTGACCAGCAAGCTAGCGGGGCATGTCGAGGACTTGCACCACGTGTAAAGAAAGTGACGCCAACGCAGTGGTGCTCCCCGGACGCTGTTACGTCGGTCAACAGAACGAACAACGCGAAACCTTTGAAGGGCGGACAATCACCACTCAACTTGTCGAAGGAAAGGCCTTCTTGCATGGAAAGGGGCACCCATGCACCCGCAGAACTTTATAACCAGAACGTGTAAGATAAATGACTTTGTGAAATCCGCTACATCTCCTGTACGATTCGGCAACTGGATGGATGTACAGAGGCTTCAGACCTCACGGCTTGTGATTTATTTTGAGCTCTCTCGGAAGAGTTTGTGCTACGTCTCATCACTGCCCTGATGGGAACTCATTAGTGCTCATACACATCCAGAGCAGTCTAATTACTGCTGTCTCATCATATGCGTAAGTGAGATGCTACCTGACAGGATTGAATAGACCGTCGTTCATAAATTCTAAGCGCATGACTTCGCTCTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)