Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Nov 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL436n23ex.3                          2 END     2          25      100                (no blast hit)

 This cluster: approximate FL confidence score = 94%

 1012777591 Xl3.1-XL436n23ex.5 - 8 ESTs
                                                                       ........-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL436n23ex.5                                                                                                                                                                                                                                                                   TGTTCAGTAAGGCCGGCCTGGCAGTTTAGGAGCATTTGTACAGGCACAGGGATGTAATCCATTAATTCCACCTGGGATTTTACTGAACATACATTTCCGAAGGATGCTGAAAAGTCTGAGTGAAGGTTTTTCCATAATAACCTGACATTTTGCCATAGGCAGCCCAGTTCACCAGAAAACAGATGCCATATTTTGGCCAGTCAAATCAAAATGCCATCTTCAGGAGTCAAGAAAGAGCCTGAGGATTCCAAATGCCTTTTGTCTCCAGAAAAAGTCAAAGGCAAGGGACCCATAGGCCCCTTATTTCAACATAAAGCTGAGAAAATCATAATTACACGAAGTGACAGCGTACCAGATGAGAATGTACTGCAAATCACCATTACAGAAACAACCATTATTGAGTCCGACCTGGGAGTCTTCAATTCTCGAGCCCTTAGCTACCTCATATTGTGGTTTTTCTTCAGCTTCTGTACATTATTCCTTAATAAATACATACTTACTTTACTTGAAGGAGAACCGAGCATGTTAGGTGCTGTCCAAATGCTGACGACAACTTTTATTGGCAGTATAAAGATGTTCATTCCCTGTTGTCTATACCAACATAAAACAAGGCTCAATTATCCTTCAAATTTCCTCATGATAATGCTGTTTGTGGGACTAATGAGGTTTGTGACAGTAGTTCTG
                                                  Xl3.1-CHK-1012698916                                                                                                                                                                                                                                                                         GTAAGGCCGGCCTGGCAGTTTAGGAGCATTTGTACAGGCACAGGGATGTAATCCATTAATTCCACCTGGGATTTTACTGAACATACATTTCCGAAGGATGCTGAAAAGTCTGAGTGAAGGTTTTTCCATAATAACCTGACATTTTGCCATAGGCAGCCCAGTTCACCAGAAAACAGATGCCATATTTTGGCCAGTCAAATCAAAATGCCATCTTCAGGAGTCAAGAAAGAGCCTGAGGATTCCAAATGCCTTTTGTCTCCAGAAAAAGTCAAAGGCAAGGGACCCATAGGCCCCTTATTTCAACATAAAGCTGAGAAAATCATAATTACACGAAGTGACAGCGTACCAGATGAGAATGTACTGCAAATCACCATTACAGAAACAACCATTATTGAGTCCGACCTGGGAGTCTTCAATTCTCGAGCCCTTAGCTACCTCATATTGTGGTTTTTCTTCAGCTTCTGTACATTATTCCTTAATAAATACATACTTACTTTACTTGAAGGAGAACCGAGCATGTTAGGTGCTGTCCAAATGCTGACGACAACTTTTATTGGCAGTATAAAGATGTTCATTCCCTGTTGTCTATACCAACATAAAACAAGGCTCAATTATCCTTCAAATTTCCTCATGATAATGCTGTTTGTGGGACTAATGAGGTTTGTGACAGTAGTTCTGGGGTTA
                                                      consensus depths                                                                                                                                                                                                                                                                        2     5     2     5     3     6     4     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     6     6     6     6     5     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     5     5     5     5     5     5     5     3     4     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG     210     137                                                                                                                                                                                                                                                                   
                                               BLH MIN     210      45                                                                                                                                                                                                                                                                   
                                               BLH OVR     210     413                                                                                                                                                                                                                                                                   
                                               EST CLI     -22       1                                                                                                                                                                                                                                                                   
                                               ORF LNG     210      22                                                                                                                                                                                                                                                                   
                                                                                                                                                                                                                                                              PREDICTED - Sp ---- 1e-027     XP_001182420.1 PREDICTED: hypothetical protein, partial [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Dr ---- 3e-049     XP_001336246.2 PREDICTED: wu:fc27c12 [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Bt ---- 3e-054     XP_605985.2 PREDICTED: similar to solute carrier family 35, member E2 [Bos taurus] ===========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = Xt ==== 5e-054     NP_001011387.1 hypothetical protein LOC496855 [Xenopus tropicalis] ==============================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Mm ==== 1e-055     NP_796160.1 RIKEN cDNA A530082C11 gene [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Hs ---- 1e-055     XP_001717787.1 PREDICTED: similar to solute carrier family 35, member E2 [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Cf ---- 4e-057     XP_546710.2 PREDICTED: similar to solute carrier family 35, member E2 [Canis familiaris] ===============================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Gg ---- 6e-061     XP_417567.1 PREDICTED: similar to RIKEN cDNA A530082C11 gene [Gallus gallus] ==============================================================================================================================================================================================================================================================================================================================================================================
                                                    Xl3.1-XL436n23ex.5                                                                                                                                                                                                                                                                                                                      ATGTAA---------------------------------------------------------------TGA---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG------------------------------ATG------------------------------------------------------------ATG---ATG---------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ...
  5   1   2       bld Gas9 5g                              BG409832.5p                         CCCACGCGTCCGCTGGAAACTCCGAGCAGCAAAGATCAGAGAAAAACAGATATTACAAAGTCGTTTTATAAGCTGGAGCCTTTCAGACGGAAAACAGAGAGTTGCAGTTCAGCTACAGCAGGAGGATTACAGGCTTGACATCTCAACAAAAGAGCACAAATTACTTCTACACCTACTAAAATACAGCTACAAACAtttttttattttgccttgcacctgttttttgcacaattgtattctactttttcatatctacttttttttttGTAGATTTAAGGCACAGGGATGTAATCCATTAATTCCACCTGGGATTTTACTGAACATACATTTCCGAAGGATGCTGAAAAGTCTGAGTGAAGGTTTTTCCATAATAACCTGACATTTTGCCATAGGCAGCCCAGTTCACCAGAAAACAGATGCCATATTTTGGCCAGTCAAATCAAAATGCCATCTTCAGGAGTCAAGAAAGAGCCTGAGGATTCCAAATGCCTTTTGTCTCCAGAAAAAGTCAAAGGCAAGGGACCCATAGGCCCCTTATTTCAACATAAAGCTGAGAAAATCATAATTACACGAAGTGACAGCGTACCAGATGAGAATGTACTGCAAATCACCATTACAGAAATAACCATTATTG
  5   1   2       bld Ga12 5g                              XL168b23.5p                                                                                                                                                                   GGTGATTGGTGGCTGTGTGAAGGAAAGACGATGAGGTTGGGAATTGGCCCATCCTTGTGCCATGCGCCTGCAAAACTAGTCAGCTGGTGAAAGGGTTGTTCAGTAAGGCCGGCCTGGCAGTTTAGGAGCATTTGTACAGGCACAGGGATGTAATCCATTAATTCCACCTGGGATTTTACTGAACATACATTTCCGAAGGATGCTGAAAAGTCTGAGTGAAGGTTTTTCCATAATAACCTGACATTTTGCCATAGGCAGCCCAGTTCACCAGAAAACAGATGCCATATTTTGGCCAGTCAAATCAAAATGCCATCTTCAGGAGTCAAGAAAGAGCCTGAGGATTCCAAATGCCTTTTGTCTCCAGAAAAAGTCAAAGGCAAGGGACCCATAGGCCCCTTATTTCAACATAAAGCTGAGAAAATCATAATTACACGAAGTGACAGCGTACCAGAAGAGAATGTACTGCAAATCACCATTACAGAAACAACCATTATTGAGTCCGACCTGGGAGTCTTCAATT
  5   1   2       bld Egg1 5g                            PBX0148E06.5p                                                                                                                                                                                                                                             CACGAGGGGAAACTCCGAGCAGCAAAGATCAGAGAAAAACAGATATTACAAAGTCGTTTTATAAGGCACAGGGATGTAATCCATTAATTCCACCTGGGATTTTACTGAACATACATTTCCGAAGGATGCTGAAAAGTCTGAGTGAAGGTTTTTCCATAATAACCTGACATTTTGCCATAGGCAGCCCAGTTCACCAGAAAACAGATGCCATATTTTGGCCAGTCAAATCAAAATGCCATCTTCAGGAGTCAAGAAAGAGCCTGAGGATTCCAAATGCCTTTTGTCTCCAGAAAAAGTCAAAGGCAAGGGACCCATAGGCCCCTTATTTCAACATAAAGCTGAGAAAATCATAATTACACGAAGTGACAGCGTACCAGATGAGAATGTACTGCAAATCACCATTACAGAAACAACCATTATTGAGTCCGACCTGGGAGTCTTCAATTCTCGAGCCCTTAGCTACCTCATATTGTGGTTTTTCTTCAGCTTCTGTACATTATTCCTTAATAAATACATACTTACTTTACTTGAAGGAGAACCGAGCATGTTAGGTGCTGTCCAAATGCTGACGACAACTTTTATTGGCAGTATAAAGATGTTCATTCCCT
  5   1   2       bld Egg1 5g                            PBX0041G01.5p                                                                                                                                                                                                                                                   GGAAACTCCGAGTCAGCAAAGATCAGAGAAAAACAGATATTACAAAGTCGTTTTATAAGGCACAAGGATGTAATCCATTAATTCCACCTGAGATTTTACTGAACATACATTTCCGAAAGATGCTGAAAAGTCTGAGTGAAGGTTTTTCCATAATAACCTGACATTTTGCCATAGGCAGCCCAGTTCACCAGAAAACAGATGCCATATTTTGGCCAGTCAAATCAAAATGCCATCTTCAGGAGTCAAGAAAGAGCCTGAAGATTCCAAATGCCTTTTGTCTGCAGAAAAAGTCAAAGGCAAGGGACCCATAGGCCCCTTATTTCAACATAAAGCTGAGAAAATCATAATTACACGAAGTGACAGCGTACCAGATGAGAATGTACTGCAAATCACCATTACAGAAACAACCATTATTGAG
  5   1   2      seed Ov1  5g3  out                   IMAGE:5049257.5p                                                                                                                                                                                                                                                      CCACGCGTCCGGTTGTTCAGTAAGGCCGGCCTGGCAGTTTAGGAGCATTTGTACAGGCACAGGGATGTAATCCATTAATTCCACCTGGGATTTTACTGAACATACATTTCCGAAGGATGCTGAAAAGTCTGAGTGAAGGTTTTTCCATAATAACCTGACATTTTGCCATAGGCAGCCCAGTTCACCAGAAAACAGATGCCATATTTTGGCCAGTCAAATCAAAATGCCATCTTCAGGAGTCAAGAAAGAGCCTGAGGATTCCAAATGCCTTTTGTCTCCAGAAAAAGTCAAAGGCAAGGGACCCATAGGCCCCTTATTTCAACATAAAGCTGAGAAAATCATAATTACACGAAGTGACAGCGTACCAGATGAGAATGTACTGCAAATCACCATTACAGAAACAACCATTATTGAGTCCGACCTGGGAGTCTTCAATTCTCGAGCCCTTAGCTACCTCATATTGTGGTTTTTCTTCAGCTTCTGTACATTATTCCTTAATAAATACATACTTACTTTACTTGAAGGAGAACCGAGCATGTTAGGTGCTGTCCAAATGCTGACGACAACTTTTATTGGCAGTATAAAGATGTTCATTCCCTGTTGTCTATACCAACATAAAACAAGGCTC
  5   1   2       bld Ga15 5g3  out                      XL436n23ex.5p                                                                                                                                                                                                                                                                                      TCCGGTTTAGGAGCATTTGTACAGGCACAGGGATGTAATCCATTAATTCCACCTGGGATTTTACTGAACATACATTTCCGAAGGATGCTGAAAAGTCTGAGTGAAGGTTTTTCCATAATAACCTGACATTTTGCCATAGGCAGCCCAGTTCACCAGAAAACAGATGCCATATTTTGGCCAGTCAAATCAAAATGCCATCTTCAGGAGTCAAGAAAGAGCCTGAGGATTCCAAATGCCTTTTGTCTCCAGAAAAAGTCAAAGGCAAGGGACCCATAGGCCCCTTATTTCAACATAAAGCTGAGAAAATCATAATTACACGAAGTGACAGCGTACCAGATGAGAATGTACTGCAAATCACCATTACAGAAACAACCATTATTGAGTCCGACCTGGGAGTCTTCAATTCTCGAGCCCTTAGCTACCTCATATTGTGGTTTTTCTTCAGCTTCTGTACATTATTCCTTAATAAATACATACTTACTTTACTTGAAGGAGAACCGAGCATGTTAGGTGCTGTCCAAATGCTGACGACAACTTTTATTGGCAGTATAAAGATGTTCATTCCCTGTTGTCTATACCAACATAAAACAAGGCTCAATTATCCTTCAAATTTCCTCATGATAATGCTGTTTGTGGGACTAATGAGGTTTGTGACAGTAGTTCTGGGGTTAATTAGCCTTAAAAATGTAGCGGTTTCTTTTGCTGAAACTGTTAA
  5   1   2       bld Emb4 5g                         IMAGE:4957686.5p                                                                                                                                                                                                                                                                                                    ATTTGTACATGTACACCGATGTAATCCATTAATTCCACCTGGGATTTTACTGAACATACATTTCCGAAGGATGCTGAAAAGTCTGAGTGAAGGTTTTTCCATAATAACCTGACATTTTGCCATAGGCAGCCCAGTTCACCAGAAAACAGATGCCATATTTTGGCCAGTCAAATCAAAATGCCATCTTCAGGAGTCAAGAAAGAGCCTGAGGATTCCAAATGCCTTTTGTCTCCAGAAAAAGTCAAAGGCAAGGGACCCATAGGCCCCTTATTTCAACATAAAGCTGAGAAAATCATAATTACACGAAGTGACAGCGTACCAGATGAGAATGTACTGCAAATCACCATTACAGAAACAACCATTATTGAGTCCGACCTGGGAATCTTCAATTCTCGAGCCCCTTACCTACCTCATATTGGGGTTTTTCTTCAGCTTCTGTACATTATTCCCTTATAAAAACCTACTTACTTTACTTGAAGGAAAAACAACCATGTAGGTGCTGTCCAAATGCTGACCAACACTTTTATTGGCAGCATAAAGATGCCCATTCCCCGGTGT
  5   1   2       bld Oo1                             IMAGE:5079403.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAATGCCTTTTGTCTCCAGAAAAAGTCAAAGGCAAGGGACCCATAGGCCCCTTATCTCAACATAAAGCTGAGAAAATCATAATTACACGAAGTGACAGCGTACCAGATGAGAATGTACTGCAAATCACCATTACAGAAACAACCATTATTGAGTCCGACCTGGGAGTCTTCAATTCTCGAGCCCTTAGCTACCTCATATTGTGGTTTTTCTTCAGCTTCTGTACATTATTCCTTAATAAATACATACTTACTTTACTTGAAGGAGAACCGAGCATGTTAGGTGCTGTCCAAATGCTGACGACAACTTTTATTGGCAGTATAAAGATGTTCATTCCCTGTTGTCTATACCAACATAAAACAAGGCTCAATTATCCTTCAAATTTCCTCATGATAATGCTGTTTGTGGGACTAATGAGGTTTGTGACAGTAGTTCTGGGGTTATTAGCCCTTANAAATGTAGCGGTTTCCTTTTGCTGAAACTNTAAAAAGCTCACCTCCAATATTTTACCGGTATTAATGGCCCAGGCTCATTATGGGAGAAGTACCCTGGAAGGATGGGTGAAACCTTTCCTTTGTTTCCAGCCATGGGCGTGAATTAACTCCTTTGGACCACAAACAGAAATCCAGTTTCCACAATggggggggCTTCCCCTGGCGGGGTTGGCCAACAAACAATTCTTGGAATGGGTTGCGCAAAAGGGCTTTTTTCCAAGAAAACTTTCCTTTACCGGGGAGAAAAAATAACAAATTTTTcccccccccgggaatctccagtttttaaaaccaaaggcttggaaaaaaggggtttttggtttataaacccccaccggggggtttttttgaaggggggaaattgcccctttggggggggggaaaaaaaggggggaggcgcctttttccttttttAAACAGGGGGAGAATA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)