Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 05 Jun 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6642483.5                       8 END     1           3       12                cytoskeleton associated protein 5 [Xenopus laevis]
     2   2.0    0Xl3.1-IMAGE:6634263.5                       5 END     1           3       20                Microtubule Associated Protein 215 kDa (XMAP215) [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-IMAGE:5079117.5                       3 PI      93          1      959                (no blast hit)
     4   0.0    0Xl3.1-IMAGE:5078003.3                       3 PI      81       1716     2388                Microtubule Associated Protein 215 kDa (XMAP215) [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012777778 Xl3.1-IMAGE:6868478.5 - 30 ESTs
                                                                       ....-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6868478.5                                                                                                                                                                                                                                                                         CACTATAGTGACAGTGTACAACGTTCATGGAGAACAGGTCTTCAAACTCATTGGCAATCTTTCAGAGAAGGACATGAGCATGCTAGAGGAGAGGATCAAACGTGCAGGCAAGAAGCAAGCTGCGGCGGCTCCAGCTAAGCAAGTGGAGGAGAAACCTCAGCGTGTGCAGAGTGCCAATGCCAGCATCCTACGCAAAGCACCCCCGGAAGACATGTCCTCCAAACTGAATCAAGCCCGAAACATGGGAGGCCACACTGAGCCGTCTCACTCTGTCCCGCGGGAGTTCCAGTTGGACCTGGATGAGATTGAGAATGACAATGGCACAGTCCGATGTGAGATGCCGGCACTTGTACAGCACAAACTGGACGAGATATTTGAGCCAGTCCTAATCCCGGAACCAAAGATCCGTGCCGTGTCTCCGCACTTTGATGACATGCACAGTAACACGGCTTCCACCATCAACTTTGTAATCTCCCAGGTGGCCAGCGTAGACATCAATGCCAGCATTCAAGCCCTTGCACAGATTGATGAGGTGCTGAGGCAGGAAGATAAGGCTGAAGCCATGTCTGGCCACATTGACCAGTTCCTCATTGCCACCTTCATGCAACTGCGTTTGGCCTACAACACTCACATGGCAGATGAGCGGCTGGATAAGGACGATATTGTGCGCTTGTATAGTTGCATCATCGGGAACATGATCTCGTTATTCCAGATGGAAAGCCTGGCCAGGGAAGCTTCTACTGGAGTGCTGAAGGACTTAATGCACGGCCTTATTAGCCTGATGCTGGATGCTCGAATAGAGGATCTCGAGGAGGGGCAGCAGGTGGTGCGCTCTGTTAATTTGTTGGTGGTGAAGGTGCTGGAGAAGTCGGACCAGACCAATATCATAAGTGCTCTGCTTATGCTGCTCCAGGATAGCCTTCTGGCTACAGCGAGTTCCCCCAATTTCTCCGAGCTGGTTATGAAGTGTCTTTGGCGAATGATTCGTCTCCTGCCAGAGGCCATAAACAACCTCAATCTGGATAGGATTCTGCTGGACATCCATAACTTCATGAGGGTCCTACCCAAGGAAAAGCTAAAGCAGCACAAGAGCGAGATGCCTATGAGGACTCTGAAAACTCTCCTACACACACTTTGCAAGCTAAAAGGGCCCAAAATCATGGACCACCTGAGTATGATTGAGAACAAACATGAGTCTGAGTTGGAGGCCCATCTCCTCAGGGTGATGAAGCACTCCATAGACCGAACTGGTTCAAAGGGCGACAAGGAGACTGAGAAGGGAGCATCTTGCATTGAAGACAAGGTGGGAAAAGCAAACGTGAGTGACTTTCTTGCTGAAATGTTTAAGAAGATTGGCTCTAAAGAGAACACTAAAGAGGGCCTGGCAGAACTCTACGAGTATAAAAAGAAATACTCTGATGCAGACATCAAGCCATTCCTCAAGAACTCCTCGCAGTTCTTCCAGAGCTATGTAGAGCGGGGCCTCCGGCTCATAGAGATGGAAAGGGAGGGCAAAGCCAGAATAGCCCCAAACACAGGAATGTCAACCCATGTGACAGAGATGACCCCTCTCCCTACAGTGACCAATACAGCAGCTCCTGTTTCAAACACAAATGGGGAGGAAGTCGGGCCCTCCGTTTACCTGGAGCGGCTGAAAATTCTGCGCCAGAGATGTGGGCTTGACAATGCCAAGCAGGACGAGAGGCCCCCATTGACCTCGTTACTTTCAAAGTCTTCTGCCCCCGCCGTCGTGTCCTCCACCGACATGCTACACAGCAAACTCTCCCAACTGCGAGAGTCACGGGAACAATTTCAGCATGTCGAACTCGACTCCAACCAGACCTACCCTAGCACAACCACCTCATCCTCCGCCTCTTCAACAAACATCGACGACTTGAAAAAGAGACTGGAAAGGATCAAAAGTAGCCGGAAATAATAGCTTGCTAATAATAACATCTGGCTGTTGTCCTATTATTACTCAAGGCCCCGTATAGGAATCCTATTGGCAGCAGAGTGGCTGTTATCTAGGCCTAACTTCTTTTATGTAACATAATGTGCAATTGTTTAGTCTGGAGGAGGGACAACAACATATTTACTGTGGCTGAGCTTGTTTTCTTTTTTTGTACATACATTGCTGTTCTAACTCCCTAGGTGTTTTAGTGTACAGAATTGTCTGTCATTTCCGCTTCCCTTCCTACAATCTGAAATTCTTTTTTTTTTTTTCTTCTTCTTTTGTCTGGTTTTAATTGTTCTTTCCCCTGGCTCTTATATTTGTAACTCTGGCTGTTTAACATGCTTTTAATTTAACATAAAGCAGTGGATTGCTGATTCTGTATGGAATCGTACGGCATGGCATGAAGACTTTTTTTGTAAATAAAGTTTAAAATA
                                                  Xl3.1-CHK-1012688115                                                                                                                                                                                                                                                                               AGTGACAGTGTACAACGTTCATGGAGAACAGGTCTTCAAACTCATTGGCAATCTTTCAGAGAAGGACATGAGCATGCTAGAGGAGAGGATCAAACGTGCAGGCAAGAAGCAAGCTGCGGCGGCTCCAGCTAAGCAAGTGGAGGAGAAACCTCAGCGTGTGCAGAGTGCCAATGCCAGCATCCTACGCAAAGCACCCCCGGAAGACATGTCCTCCAAACTGAATCAAGCCCGAAACATGGGAGGCCACACTGAGCCGTCTCACTCTGTCCCGCGGGAGTTCCAGTTGGACCTGGATGAGATTGAGAATGACAATGGCACAGTCCGATGTGAGATGCCGGCACTTGTACAGCACAAACTGGACGAGATATTTGAGCCAGTCCTAATCCCGGAACCAAAGATCCGTGCCGTGTCTCCGCACTTTGATGACATGCACAGTAACACGGCTTCCACCATCAACTTTGTAATCTCCCAGGTGGCCAGCGTAGACATCAATGCCAGCATTCAAGCCCTTGCACAGATTGATGAGGTGCTGAGGCAGGAAGATAAGGCTGAAGCCATGTCTGGCCACATTGACCAGTTCCTCATTGCCACCTTCATGCAACTGCGTTTGGCCTACAACACTCACATGGCAGATGAGCGGCTGGATAAGGACGATATTGTGCGCTTGTATAGTTGCATCATCGGGAACATGATCTCGTTATTCCAGATGGAAAGCCTGGCCAGGGAAGCTTCTACTGGAGTGCTGAAGGACTTAATGCACGGCCTTATTAGCCTGATGCTGGATGCTCGAATAGAGGATCTCGAGGAGGGGCAGCAGGTGGTGCGCTCTGTTAATTTGTTGGTGGTGAAGGTGCTGGAGAAGTCGGACCAGACCAATATCATAAGTGCTCTGCTTATGCTGCTCCAGGATAGCCTTCTGGCTACAGCGAGTTCCCCCAATTTCTCCGAGCTGGTTATGAAGTGTCTTTGGCGAATGATTCGTCTCCTGCCAGAGGCCATAAACAACCTCAATCTGGATAGGATTCTGCTGGACATCCATAACTTCATGAGGGTCCTACCCAAGGAAAAGCTAAAGCAGCACAAGAGCGAGATGCCTATGAGGACTCTGAAAACTCTCCTACACACACTTTGCAAGCTAAAAGGGCCCAAAATCATGGACCACCTGAGTATGATTGAGAACAAACATGAGTCTGAGTTGGAGGCCCATCTCCTCAGGGTGATGAAGCACTCCATAGACCGAACTGGTTCAAAGGGCGACAAGGAGACTGAGAAGGGAGCATCTTGCATTGAAGACAAGGTGGGAAAAGCAAATGTGAGTGACTTTCTTGCTGAAATGTTTAAGAAGATTGGCTCTAAAGAGAACACTAAAGAGGGCCTGGCAGAACTCTACGAGTATAAAAAGAAATACTCTGATGCAGACATCAAGCCATTCCTCAAGAACTCCTCGCAGTTCTTCCAGAGCTATGTAGAGCGGGGCCTCCGGCTCATAGAGATGGAAAGGGAGGGCAAAGCCAGAATAGCCCCAAACACAGGAATGTCAACCCATGTGACAGAGATGACCCCTCTCCCTACAGTGACCAATACAGCAGCTCCTGTTTCAAACACAAATGGGGAGGAAGTTGGGCCCTCCGTTTACCTGGAGCGGCTGAAAATTCTGCGCCAGAGATGTGGGCTTGACAATGCCAAGCAGGACGAGAGGCCCCCATTGACCTCGTTACTTTCAAAGTCTTCTGCCCCCGCCGTCGTGTCCTCCACCGACATGCTACACAGCAAACTCTCCCAACTGCGAGAGTCACGGGAACAATTTCAGCATGTCGAACTCGACTCCAACCAGACCTACCCTAGCACAACCACCTCATCCTCCGCCTCTTCAACAAACATCGACGACTTGAAAAAGAGACTGGAAAGGATCAAAAGTAGCCGGAAATAATAGCTTGCTAATAATAACATCTGGCTGTTGTCCTATTATTACTCAAGGCCCCGTATAGGAATCCTATTGGCAGCAGAGTGGCTGTTATCTAGGCCTAACTTCTTTTATGTAACATAATGTGCAATTGTTTAGTCTGGAGGAGGGACAACAACATATTTACTGTGGCTGAGCTTGTTTTCTTTTTTTGTACATACATTGCTGTTCTAACTCCCTAGGTGTTTTAGTGTACAGAATTGTCTGTCATTTCCGCTTCCCTTCCTACAATCTGAAATTCTTTTTTTTTTTTTCTTCTTCTTTTGTCTGGTTTTAATTGTTCTTTCCCCTGGCTCTTATATTTGTAACTCTGGCTGTTTAACATGCTTTTAATTTAACATAAAGCAGTGGATTGCTGATTCTGTATGGAATCGTACGGCATGGCATGAAGACTTTTTTTGTAAATAAAGTTTAAAATACTGTGT
                                                      consensus depths                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     5     5     5     5     5     5     5     5     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     6     5     5     5     5     5     5     5     5     5     5     5     5     4     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     6     7     6     7     6     7     6     7     6     7     6     6     6     6     5     6     5     6     4     6     4     4     4     4     4     4     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     6     7     6     8     6     9     8    10     7    10     7    10     7    10     7    10     7    10     6    10     5     9     5     9     5     9     5     9     5     9     5     8     5     8     5     8     5     8     6     9     6     9     6     9     7    10     7    10     7    10     7    11     6    11     8    11     8    11     9    11     9    11     8    11     8    11     9    11    10    12    10    12     9    12    10    12    10    12    10    13    11    12     7    11     8    11     8    11     9    10     8    10     9    10     8    10     9    10     9    10     8    10     7    10     8    10     8    11     8    11     8    11     8    12     6    12     9    14     7    14     8    12     8    12     8    12     7    11     7    11     7    11     7    11     7    11     5    11     5    10     3     8     2     7     2     5
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----C-------
  5   1   2       bld Oo1                             IMAGE:6642146.5p CCAAAGGACATAGTGGCGGAAAGATGTACGTGCCATCCTAACTAAAATGTGCCAGGTGTATCCTGCCAGCAAGATGTTTAACTTTGTGATGGAAGGGACCAAATCAAAGAACTCCAAGCAGCGAGCTGAGTGCCTGGAGGAGCTGGGTTGCTTGGTGGAGTCTTACGGTATGAATGTGTGCCAGCCCACACCTGCCAAAGCTCTGAAGGAGATCGCTATACATATAGGGGACAGAGACACGACTGTGCGTAACGCTGCCCTCAACACTATAGTGACAGTGTACAACGTTCATGGAGAACAGGTCTTCAAACTCATTGGCAATCTTTCAGAGAAGGACATGAGCATGCTAGAGGAGAGGATCAAACGTGCAGGCAAGAAGCAAGCTGCGGCGGCTCCAGCTAAGCAAGTGGAGGAGAAACCTCAGCGTGTGCAGAGTGCCAATGCCAGCATCCTACGCAAAGCACCCCCGGAAGACATGTCCTCCAAACTGAATCAAGCCCGAAACATGGGAGGCCACACTGAGCCGTCTCACTCTGTCCCGCGGGAGTTCCAGTTGGACCTGGATGAGATCGAGAATGACAATGGCACAGTCCGATGTGAGATGCCAGCACTTGTACAGCACAAACTGGACGAGATATTTGAGCCAGTCCTAATCCCGGAACCAAAGATCCGTGCCGTGTCTCCGCACTTTGATGACATGCACAGTAACACGGCTTCCACCATCAACTTTGTAATCTCCCAGGTGGCCAGCGTAGACATCAATGCCAGCATTCAAGCCCTTGCACAGATTGATGAGGTGCTGAGGGCAGGAAGATAAAGCTGAAGCCATGTCTGGCCACATTTGACCANTCCTCATTGCCACCCTCCATGCAACTGCGGTTTGGCCTACAACACTCACATGCCANAATGACGGCTGGATAAGGAC
  5   1   2       bld Egg3                            IMAGE:6868478.5p                                                                                                                                                                                                                                                 GATCGATTCCCGGGGCTGCCCTCACACTATAGTGACAGTGTACAACGTTCATGGAGAACAGGTCTTCAAACTCATTGGCAATCTTTCAGAGAAGGACATGAGCATGCTAGAGGAGAGGATCAAACGTGCAGGCAAGAAACAAGCTGCGGCGGCTCCAGCTAAGCAAGTGGAGGAGAAACCTCAGCGTGTGCAGAGTGCCAATGCCAGCATCCTACGCAAAGCACCCCCGGAAGACATGTCCTCCAAACTGAATCAAGCCCGAAACATGGGAGGCCACACTGAGCCGTCTCATTCTGTCCCGCGGGAGTTCCAGTTGGACCTGGATGAGATTGAGAATGACAATGGCACAGTCCGATGTGAGATGCCGGCACTTGTACAGCACAAACTGGACGAGATATTTGAGCCAGTCCTAATCCCGGAACCAAAGATCCGTGCCGTGTCTCCGCACTTTGATGACATGCACAGTAACACGGCTTCCACCATCAACTTTGTAATCTCCCAGGTGGCCAGCGTAGACATCAATGCCAGCATTCAAGCCCTTGCACAGATTGATGAGGTGCTGAGGCAGGAAGATAAGGCTGAAGCCATGTCTGGCCACATTGACCAGTTCCTCATTGCCACCTTCATGCAACTGCGTTTGGCCTACAACACTCACATGGCAGATGAGCGGCTGGATAAGGACGATATTGTGCGCTTGTATAGTTGCATCATCGGGAACATGATCTCGTTATTCCAGATGGAAAGCCTGGCCAGGGAAGCTTCTACTGGAGTGCTGAAAGACTTAATGCACGGCCTTATTAGCCTGATGCTGGATGCTCGAATAGAGGATCTCGAGGAGGGGCAGCAGGGGGTGCGCTCTGGTAATTTGTTGGTGGTGAAAGGGCTGGAGAAAATCGGAC
  5   1   2       bld Egg4      in                    IMAGE:3744278.5p                                                                                                                                                                                                                                                                                                                                                                  AGAGGATCAAACGTGCAGGCAAGAAGCAAGCTGCGGCGGCTCCAGCTAAGCAAGTGGAGGAGAAACCTCAGCGTGTGCAGAGTGCCAATGCCAGCATCCTACGCAAAGCACCCCCGGAAGACATGTCCTCCAAACTGAATCAAGCCCGAAACATGGGAGGCCACACTGAGCCGTCTCACTCTGTCCCGCGGGAGTTCCAGTTGGACCTGGATGAGATTGAGAATGACAATGGCACAGTCCGATGTGAGATGCCGGCACTTGTACAGCACAAACTGGACGAGATATTTGAGCCAGTCCTAATCCCGGAACCAAAGATCCGTGCCGTGTCTCCGCACTTTGATGACATGCACAGTAACACGGCTTCCACCATCAACTTTGTAATCTCCCAGGTGGCCAGCGTAGACATCAATGCCAGCATTCAAGCCCTTGCACAGATTGATGAGGTGCTGAGGCAGGAAGATAAGGCTGAAGCCATGTCTGGCCACATTGACCAGTTCCTCATTGCCACCTTCATGCAACTGCGTTTGGGCTACAACACTCACATGGCAGATGAGCGGCTGGGATAGGACGATATTGTGCGCTTG
  5   1   2       bld Oo1       in                    IMAGE:3404962.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGAATGACAATGGCACAGTCCGATGTGAGATGCCGGCACTTGTACAGCACAAACTGGACGAGATATTTGAGCCAGTCCTAATCCCGGAACCAAAGATTCGTGCCGTGTCTCCGCACTTTGATGACATGCACAGTAACACGGCTTCCACCATCAACTTTGTAATCTCCCAGGTGGCCAGCGTAGACATCAATGCCAGCATTCAAGCCCTTGCACAGATTGATGAGGTGCTGAGGCAGGAAGATAAGGCTGAAGCCATGTCTGGCCACATTGACCAGTTCCTCATTGCCACCTTCATGCAACTGCGTTTGGCCTACAACACTCACATGGCAGATGAGCGGCTGGATAAGGACGATATTGTGCGCTTGTATAGTTGCATCATCGGGAACATGATCTCGTTATTCCAGATGGAAAGCCTGGCCAGGGAAGCTTCTACTGGTGTGCTGAAGGACTTAATGCACGGCCTTATTAGCCTGATGCTGGATGCTCGAATAGAGGATCTCGAGGAGGGGCAGCAGGTGGTGCGCTCTGTTAATTTGTTGGTG
  5   1   2       bld Oo1                             IMAGE:5084835.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCACTTGTACAGCACAAACTGGACGAGATATTTGAGCCAGTCCTAATCCCGGAACCAAAGATTCGTGCCGTGTCTCCGCACTTTGATGACATGCACAGTAACACGGCTTCCACCATCAACTTTGTAATCTCCCAGGTGGCCAGCGTAGACATCAATGCCAGCATTCAAGCCCTTGCACAGATTGATGAGGTGCTGAGGCAGGAAGATAAGGCTGAAGCCATGTCTGGCCACATTGACCAGTTCCTCATTGCCACCTTCATGCAACTGCGTTTGGCCTACAACACTCACATGGCAGATGAGCGGCTGGATAAGGACGATATTGTGCGCTTGTATAGTTGCATCATCGGGAACATGATCTCGTTATTCCAGATGGAAAGCCTGGCCAGGGAAGCTTCTACCGGTGTGCTGAAGGACTTAATGCACGGCCTTATTAGCCTGATGCTGGATGCTCGAATAGAGGATCTCGAGGAGGGGCAGCAGGTGGTGCGCTCTGTTAATTTGTTGGTGGTGAAGGTGCTGGAGAAGTCGGACCAGACCAATATCATAAGTGCTCTGCTTATGCTGCTCCAGGATAGCCTTCTGGCTACAGCGAGTTCCCCCAATTTCTCCGAGCTGGTTATGAAGTGTCTTTGGCGAATGATTCGTCTCCTGCCAGAGGCCATAAACAACCTCAATCTGGATAGGATTCTGCTGGACATCCATAACTTCATGAGGGTCCTGCCCAAGGAAAAGCTAAAGCAGCACAAGAGCGAGATGCCTATGAGGACTCTGAAAACTCTCCTACACACACTTTGCAAGCTAAAAGGGCCCAAAATCATGGACCACNCTGAGTATGGATTTGAGAACAAACATGGAGTTCTGGAGTTGGGAAGGCCCACCCTCC
  5   1   2       bld Oo1                             IMAGE:5079291.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAACCAAAGATCCGTGCCGTGTCTCCGCACTTTGATGACATGCACAGTAACACGGCTTCCACCATCAACTTTGTAATCTCCCAGGTGGCCAGCGTAGACATCAATGCCAGCATTCAAGCCCTTGCACAGATTGATGAGGTGCTGAGGCAGGAAGATAAGGCTGAAGCCATGTCTGGCCACATTGACCAGTTCCTCATTGCCACCTTCATGCAACTGCGTTTGGCCTACAACACTCACATGGCAGATGAGCGGCTGGATAAGGACGATATTGTGCGCTTGTATAGTTGCATCATCGGGAACATGATCTCGTTATTCCAGATGGAAAGCCTGGCCAGGGAAGCTTCTACTGGAGTGCTGAAGGACTTAATGCACGGCCTTATTAGCCTGATGCTGGATGCTCGAATAGAGGATCTCGAGGAGGGGCAGCAGGTGGTGCGCTCTGTTAATTTGTTGGTGGTGAAGGTGCTGGAGAAGTCGGACCAGACCAATATCATAAGTGCTCTGCTTATGCTGCTCCAGGATAGCCTTCTGGCTACAGCGAGTTCCCCCAATTTCTCCGAGCTGGTTATGAAGTGTCTTTGGCGAATGATTCGTCTCCTGCCAGAGGCCATAAACAACCTCAATCTGGATAGGATTCTGCTGGACATCCATAACTTCATGAGGGTCCTACCCAAGGAAAAGCTAAAGCAGCACAAGAGCGAGATGCCTATGAGGACTCTGAAAACTCTCCTACACACACTTTGCAAGCTAAAAGGGCCCAAAATCATGGACCACCTGAGTATGATTGAGAACAAACATGAGTCTGAGTTGGAGGGCCATCTCCTCAGGGTGATGAAGCACTCCATAGACCGAACTGGTTCAAAAGGCGACAAGGAGACTGAGAAAGGAAN
  5   1   2       bld Oo1                             IMAGE:5083702.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTGTCTCCGCACTTTGATGACATGCACAGTAACACGGCTTCCACCATCAACTTTGTAATCTCCCAGGTGGCCAGCGTAGACATCAATGCCAGCATTCAAGCCCTTGCACAGATTGATGAGGTGCTGAGGCAGGAAGATAAGGCTGAAGCCATGTCTGGCCACATTGACCAGTTCCTCATTGCCACCTTCATGCAACTGCGTTTGGCCTACAACACTCACATGGCAGATGAGCGGCTGGATAAGGACGATATTGTGCGCTTGTATAGTTGCATCATCGGGAACATGATCTCGTTATTCCAGATGGAAAGCCTGGCCAGGGAAGCTTCTACTGGAGTGCTGAAGGACTTAATGCACGGCCTTATTAGCCTGATGCTGGATGCTCGAATAGAGGATCTCGAGGAGGGGCAGCAGGTGGTGCGCTCTGTTAATTTGTTGGTGGTGAAGGTGCTGGAGAAGTCGGACCAGACCAATATCATAAGTGCTCTGCTTATGCTGCTCCAGGATAGCCTTCTGGCTACAGCGAGTTCCCCCAATTTCTCCGAGCTGGTTATGAAGTGTCTTTGGCGAATGATTCGTCTCCTGCCAGAGGCCATAAACAACCTCAATCTGGATAGGATTCTGCTGGACATCCATAACTTCATGAGGGTCCTACCCAAGGAAAAGCTAAAGCAGCACAAGAGCGAGATGCCTATGAGGACTCTGAAAACTCTCCTACACACACTTTGCAAGCTAAAAGGGCCCAAAATCATGGACCACCTGAGTATGATTGAGAACAAACATGAGTCTGAGTTGGAGGCCCATCTCCTCAGGGTGATGAAGCACTCCATAGACCCGAACTGGTTCAAAGGGGCGACAGGNAGACTGAGAANGGGAGCATC
  5   1   2       bld Thy       in                    IMAGE:8548840.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCGAATAGAGGATCTCGAGGAGGGGCAGCAGGTGGTGCGCTCTGTTAATTTGTTGGTGGTGAAGGTGCTGGAGAAGTCGGACCAGACCAATATCATAAGTGCTCTGCTTATGCTGCTCCAGGATAGCCTTCTGGCTACAGCGAGTTCCCCCAATTTCTCCGAGCTGGTTATGAAGTGTCTTTGGCGAATGATTCGTCTCCTGCCAGAGGCCATAAACAACCTCAATCTGGATAGGATTCTGCTGGACATCCATAACTTCATGAGGGTCCTACCCAAGGAAAAGCTAAAGCAGCACAAGAGCGAGATGCCTATGAGGACTCTGAAAACTCTCCTACACACACTTTGCAAGCTAAAAGGGCCCAAAATCATGGACCACCTGAGTATGATTGAGAACAAACATGAGTCTGAGTTGGAGGCCCATCTCCTCAGGGTGATGAAGCACTCCATAGACCGAACTGGTTCAAAGGGCGACAAGGAGACCGAGAAGGGAGCATCTTGCATTGAAGACAAGGTGGGAAAAGCAAACGTGAGTGACTTTCTTGCTGAAATGTTTAAGAAGATTGGCTCTAAAGAGAACACTAAAGAGGGCCTGGCAGAACTCTACGAGTATAAAAAGAAATACTCTGATGCAGACATCAAGCCATTCCTCAAGAACTCCTCGCAGTTCTTCCAGAGCTATGTAGAGCGGGGCCTCCCGCTCATAGAGATGGAAAGGGAGGGCAAAGCCAGAATAGCCCCAAACACAGGAATATCAACCCATGTGACAGAGATCACCCTCTCCCTACAGTGACCATACATCAGCTCTGTTTCAACACAAATGGGGAGGAGTCGGCCCTCGTTACTGAGCGCTGAAATCTGCGCAGAAATGTGGCTGACATGCAGGCAGGACGAGAAAGTTCCGT
  5   1   2       bld Tbd7      in                         XL107i09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGTTATGAAGTGTCTTTGGCGAATGATTCGTCTCCTGCCGAGGCCATAAACAACCTCAATCTGGATAGGATTCTGCTGGACATCCATAACTTCATGAGGGTCCTACCCAAGGAAAAGCTAAAGCAGCACAAGAGCGAGATGCCTATGAGGACTCTGAAAACTCTCCTACACACACTTTGCAAGCTAAAAGGGCCCAAAATCATGGACCACCTGAGTATGATTGAGAACAAACATGAGTCTGAGTTGGAGGCCCATCTCCTCAGGGTGATGAAGCACTCCATAGACCGAACTGGTTCAAAGGGCGACAAGGAGACTGAGAAGGGAGCATCTTGCATTGAAGACAAGGTGGGAAAAGCAAATGTGAGTGACTTTCTTGCTGAAATGTTTAAGAAGATTGGCTCTAAAGAGAACACTAAAGAGGGCCTGGCAGAACTCTACGAGTATAAAAAGAAATACTCTGATGCAGACATCAAGCCATTCCTCAAGAACTCCTCGCAGTTCTTCCAGAGCTATGTAGAGCGGGGCCTCCGGCTCATAGAGATGGAAAGGGAGGGCAAAGCCAGAATAGCCCCAAACACAGGAATGTCAACCCATGTGACAGAGATGACCCCTCTCCCTACAGTGACCAATACAGCAGCTCCTGTTTCAAACACAAATGGGGAGGAAGTCGGGCC
  5   1   2       bld Ga15      in                       XL438i14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTCTTTGGCGAATGATTCGTCTCCTGCCAGAGGCCATAAACAATCTCAATCTGGATAGGATTCTGCTGGACATCCATAACTTCATGAGGGTCCTACCCAAGGAAAAGCTAAAGCAGCACAAGAGCGAGATGCCTATGAGGACTCTGAAAACTCTCCTACACACACTTTGCAAGCTAAAAGGGCCCAAAATCATGGACCACCTGAGTATGATTGAGAACAAACATGAGTCTGAGTTGGAGGCCCATCTCCTCAGGGTGATGAAGCACTCCATAGACCGAACTGGTTCAAAGGGCGACAAGGAGACTGAGAAGGGAGCATCTTGCATTGAAGACAAGGTGGGAAAAGCAAACGTGAGTGACTTTCTTGCTGAAATGTTTAAGAAGATTGGCTCTAAAGAGAACACTAAAGAGGGCCTGGCAGAACTCTACGAGTATAAAAAGAAATACTCTGATGCAGACATCAAGCCATTCCTCAAGAACTCCTCGCAGTTCTTCCAGAGCTATGTAGAGCGGGGCCTCCGGCTCATAGAGATGGAAAGGGAGGGCAAAGCCAGAATTGCCCCAAACACAGGAATATCAACCCATGTGACAGAGATGACCCCTCTCCCTACAGTGACCAATACAGCAGCTCCTGTTTCAAACACAAATGGGGAGGAAGTTGGGCCCTCCGTTTACCTGGAGCGGCTGAAAATTCTGCGCCAGAGATGTGGGCTTGACAATGCCAAGC
  5   1   2       bld Emb1                            IMAGE:6863213.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCACGCGTCCGATTTTAGATCATGGACCACCTGAGTATGATTGAGAACAAACATGAGTCTGAGTTGGAGGCCCATCTCCTCAGGGTGATGAAGCACTCCATAGACCGAACTGGTTCAAAGGGCGACAAGGAGACTGAGAAGGGAGCATCTTGCATTGAAGACAAGGTGGGAAAAGCAAATGTGAGTGACTTTCTTGCTGAAATGTTTAAGAAGATTGGCTCTAAAGAGAACACTAAAGAGGGCCTGGCAGAACTCTACGAGTATAAAAAGAAATACTCTGATGCAGACATCAAGCCATTCCTCAAGAACTCCTCGCAGTTCTTCCAGAGCTATGTAGAGCGGGGCCTCCGGCTCATAGAGATGGAAAGGGAGGGCAAAGCCAGAATAGCCCCAAACACAGGAATGTCAACCCATGTGACAGAGATGACCCCTCTCCCTACAGTGACCAATACAGCAGCTCCTGTTTCAAACACAAATGGGGGAGGAAGTCGGGCCCTCCGTTTACCTGGAGCGGCTGAAAATTCTGCGCCAGAGATGTGGGCTTGACAATGCCAAGCAGGACGAGAGGCCCCCATTGACCTCGTTACTTTCAAAGTCTTCTGCCCCCGCCGTCGTGTCCTCCACCGACATGCTACACAGCAAACTCTCCCAACTGCGAGAGTCACGGGAACAATTTCAGCATGTCGAACTCGACTCCAACCAGACCTACCCTAGCACAACCACCTCATCCTCCGCCTCTTCAACAAACATCGACGAACTTGAAAAAGAGACTGGGAAAGGATCAAAAGTAGCCGGGAATAATAAGCTTGCTAATAATAAACATCCTGGCTGTTGTCCTATTATTACTTCAGGCC
  5   1   2      seed DMZ       ?                          xl221a07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAATGTGAGTGACTTTCTTGCTGAAATGTTTAAGAAGATTGGCTCTAAAGAGAACACTAAAGAGGGCCTGGCAGAACTCTACGAGTATAAAAAGAAATACTCTGATGCAGACATCAAGCCATTCCTCAAGAACTCCTCGCAGTTCTTCCAGAGCTATGTAGAGCGGGGCCTCCGGCTCATAGAGATGGAAAGGGAGGGCAAAGCCAGAATAGCCCCAAACACAGGAATGTCAACCCATGTGACAGAGATGACCCCTCTCCCTACAGTGACCAATACAGCAGCTCCTGTTTCAAACACAAATGGGGAGGAAGTCGGGCCCTCCGTTTACCTGGAGCGGCTGAAAATTCTGCGCCAGAGATGTGGGCTTGACAATGCCAAGCAGGACGAGAGGCCCCCATTGACCTCGTTACTTTCAAAGTCTTCTGCCCCCGCCGTCGTGTCCTCCACCGACATGCTACACAGCAAACTCTCCCAACTGCGAGAGTCACGGGAACAATTTCAGCATGTCGAACTCGACTCCAACCAGACCTACCCTAGCACAACCACCTCATCCTCCGCCTCTTCAACAAACATCGACGACTTGAAAAAGAGACTGGAAAGGATCAAAAGTAGCCGGAAATAATAGCTTGCTAATAATAACATCTGGCTGTTGTCCTATTATTACTCAAGGCCCCGTATAGGAATCCTATTGCCAGCAGAGTGGCTGTTTATCTAGGCCTAACTTCTTTTATG
  5   1   2       bld DMZ       ?                          xl274l23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAATGTGAGTGACTTTCTTGCTGAAATGTTTAAGAAGATTGGCTCTAAAGAGAACACTAAAGAGGGCCTGGCAGAACTCTACGAGTATAAAAAGAAATACTCTGATGCAGACATCAAGCCATTCCTCAAGAACTCCTCGCAGTTCTTCCAGAGCTATGTAGAGCGGGGCCTCCGGCTCATAGAGATGGAAAGGGAGGGCAAAGCCAGAATAGCCCCAAACACAGGAATGTCAACCCATGTGACAGAGATGACCCCTCTCCCTACAGTGACCAATACAGCAGCTCCTGTTTCAAACACAAATGGGGAGGAAGTCGGGCCCTCCGTTTACCTGGAGCGGCTGAAAATTCTGCGCCAGAGATGTGGGCTTGACAATGCCAAGCAGGACGAGAGGCCCCCATTGACCTCGTTACTTTCAAAGTCTTCTGCCCCCGCCGTCGTGTCCTCCACCGACATGCTACACAGCAAACTCTCCCAACTGCGAGAGTCACGGGAACAATTTCAGCATGTCGAACTCGACTCCAACCAGACCTACCCTAGCACAACCACCTCATCCTCCGCCTCTTCAACAAACATCGACGACTTGAAAAAGAGACTGGAAAGGATCAAAAGTAGCCGGAAATAATAGCTTGCTAATAATAACATCTGGCTGTTGTCCTATTATTACTCAAGG
  3   1   2       add Thy       in                    IMAGE:8548840.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGCAGCAACTCTAGATCTGCGTTCGATAAGACGGCTCGTCAGAGTGAAGAGGCAGCAGATGCCAACACGGATTCACCATTGCGGATCACCTTCCTACGTGACATCATCAGTCTGTTCAACACAATGGGAGAAGTCGGCCCTCCGTTACCTGAGCGGCGAAAATCTGCGCCAGAGAGTGGGCTGACAATGCAAGCAGGACGAGAGGCCCCCATTGACCTCGTTACTTTCAAAGTCTTCTGCCCCCGCCGTCGTGTCCTCCACCGACATGCTACACAGCAAACTCTCCCAACTGCGAGAGTCACGGGAACAATTTCAGCACGTCGACCTCGACTCCAACCAGACCTACCCTAGCACAACCACCTCATCCTCCGCCTCTTCAACAAACATCGACGACTTGAAAAAGAGACTGGAAAGGATCAAAAGTAGCCGGAAATAATAGCTTGCTAATAATATCTGGCTGTTGTCCTATTATTACTCAAGGCCCCGTATAGGAATCCTATTGCCCGCAGAGTGGCTGTTATCTAGGCCTCACTTCTTTTATGTAACATAATGTGCAATTGTTTAGTCTGGAGGAGGGACAACAACATATTTACTGTGGCTGAGCTTTTTTTTCTTTTTTTGTACATACATTGCTGTTCTAACTCCCTAGGTGTTTTAGTGTACAGAATTGTCTGTCATTTCCGCTTCCCTTCCTACAATCTGAAATTCTTTTCTTTTTGTTTTTTTTTTCTTTTGTCTGGTTTTAATTGTTCTTTCCCATGGCCTTTATATCCAGTACCTCCGGCTGCCAAACAGGCTCTTCAATACACTACAGCTGTGGAATGAAGCTCATGTAACCATCCTACCTCACACCATAACACCCATGATAACATCCTCC
  5  -1   2       bld Emb1                            IMAGE:6633862.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCAGGGGGACGCCAAAATTATCAGAGCAGANGGTTCCCGTGTTTTTCAAAAACCCCCCAAAATTGGGGGAAGGGAAAGTTTGGGGCCCCCTCCCCTTTTATTCCTGGGAGAGCCGGGGTGAAAAATTTCTTGCCCCCACGAGAATTTGGGGGTTTGCCAAATGCCCAAGCCAGGACGGAGGAGGCCCCCCCATTGACCCTTGGTTACTTTCAAAGTTTTTTTGCCCCCGGCGTTGGTTTCCTTCCACGGGCATTTTTCCAGCCAAACTTTTCCAAGTGCGGGGGTCAGGGGAACAATTTCAGCACGTTGAATTCGACTTCAACCAGACCTACCCTAGCACAACCACCTCATCCTCCGCCTCTTCAACAAACATCGACGACTTGAAAAAGAGGCTGGAAAGGATCAAAAGTAGCCGGAAATAATAGCTTGCTAATAATAATATCTGGCTGTTGTCCTATTATTACTCAAGGCCCCGTATAGGAATCCTATTGCCAGCAGAGTGGCTGTTATCTAGGCCTAACTTCTTTTATGTAACATAATGTGCAATTGTTTAGTCTGGAGGAGGGACAACAACATATTTACTGTGGCTGAGCtttttttctttttttGTACATACATTGCTGTTCTAACTCCCTAGGTGTTTTAGTGTACAGAATTGTCTGTCATTTCCGCTTCCCTTCCTACAATTTGAAATTCttttttttttttttttttCCTTCTTTTGTCTGGTTTTAATTGTTCTTTCCCCTGGCTCTTATATTTGTAACTCTGGCTGTTTAACATGCTTTTAATTTAACATAAAGCAGTGGATTGCTGATTCTGTATGGAATCGTACGGCATGGCATGAAGACTTTTTTTGTAAATAAAGTTTAAAATACTGTGTAACATGTAGaaaaaagaaaaaaaaaaagaagaaaaaaaaaaaaaaaaaaaa
  5   1   2       bld Egg1                               PBX0069A01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CACGAGGGGAATATCAACCCATGTGACAGAGATGACCCCTCTCCCTACAGTGACCAATACAGCAGCTCCTGTTTCAAACACAAATGGGGAGGAAGTTGGGCCCTCCGTTTACCTGGAGCGGCTGAAAATTCTGCGCCAGAGATGTGGGCTTGACAATGCCAAGCAGGACGAGAGGCCCCCATTGACCTCGTTACTTTCAAAGTCTTCTGCCCCCGCCGTCGTGTCCTCCACCGACATGCTACACAGCAAACTCTCCCAACTGCGAGAGTCACGGGAACAATTTCAGCATGTCGAACTCGACTCCAACCAGACCTACCCTAGCACAACCACCTCATCCTCCGCCTCTTCAACAAACATCGACGACTTGAAAAAGAGACTGGAAAGGATCAAAAGTAGCCGGAAATAATAGCTTGCTAATAATAACATCTGGCTGTTGTCCTATTATTACTCAAGGCCCCGTATAGGAATCCTATTGCCAGCAGAGTGGCTGTTATCTAGGCCTAACTTCTTTT
  5   1   2       bld Egg1                               PBX0163F04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAATATCAACCCATGTGACAGAGATGACCCCTCTCCCTACAGTGACCAATACAGCATCTCCTGTTTCAAACACAAATGGGGAGGAAGTTGGGCCCTCCGTTTACCTGGAGCGGCTGAAAATTCTGCGCCAGAGATGTGGGCTTGACAATGCCAAGCAGGACGAGAGGCCCCCATTGACCTCGTTACTTTCAAAGTCTTCTGCCCCCGCCGTCGTGTCCTCCACCGACATGCTACACAGCAAACTCTCCCAACTGCGAGAGTCACGGGAACAATTTCAGCATGTCGAACTCGACTCCAACCAGACCTACCCTAGCACAACCACCTCATCCTCCGCCTCTTCAACAAACATCGACGACTTGAAAAAGAGACTGGAAAGGATCAAAAGTAGCCGGAAATAATAGCTTGCTAATAATAACATCTGGCTGTTGTCCTATTATTACTCAAGGCCCCGTATAGGAATCCTATTG
  3   1   2       bld Egg4      in                    IMAGE:3744278.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AATGCCAAGCAGACGAAAGCCCCCATGACCTTGGTTCTTTCAAATTCTTCTGCCCCCCCGTCGGGCCCTCGCCGACATGTACCCAGCCAACTCTCCCAACTGCGAGATACACGGGAACAATTTCAGCAAGTCGCCTCGACTCCANCCAGACCNACCCTAGGCACACACTCCCATCCTCCGCCTCTTCAACAAACATCGCCGACTTGAAAAAGAGACTGGAAAGGATCANAAGTAGCCGGAAATAATAGATTGCTAATAATAACATCTGGCTGTTGTCCTATTATTACTCAAGGCCCCGTATAGGAATCCTATTGGCAGCAGAGTGGCTGTTATCTAGGCCTCACTTCTTTTATGTAACATAATGTGCAATTGTTTAGTCTGGAGGAGGGACAACAACATATTTACTGTGGCTGAGCTTGTTTTCTTTTTTTGTACAACCATTGCTGTTCTAACTCCCTAGGTGTTTTAGTGTACAGAATTGTCTGTCATTTCCGCTTCCCTTCCTACAATCTGAAATTCTTTTTTTTTTTTTCTTCTTCTTTTGTCTGGTTTTAATTGTTCTTTCCCCTGGCTCTTATATTTGTAACTCTGGCTGTTTAACATGCTTTTAATTTAACATAAAGCAGTGGATTGCTGATTCTGTATGGAATCGTACGGCATGGCATGAAGACTTTTTTTGTAAATAAAGTTTAAAATACTGTGA
  5   1   2       bld Tbd7      in                         XL107o06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTGCCCCCGCCGTCGTGTCCTCCACCGACATGCTACACAGCAAACTCTCCCAACTGCGAGAGTCACGGGAACAATTTCAGCATGTCGAACTCGACTCCAACCAGACCTACCCTAGCACAACCACCTCATCCTCCGCCTCTTCAACAAACATCGACGACTTGAAAAAGAGACTGGAAAGGATCAAAAGTAGCCGGAAATAATAGATTGCTAATAATAACATCTGGCTGTTGTCCTATTATTACTCAAGGCCCCGTATAGGAATCCTATTGGCAGCAGAGTGGCTGTTATCTAGGCCTCACTTCTTTTATGTAACATAATGTGCAATTGTTTAGTCTGGAGGAGGGACAACAACATATTTACTGTGGCTGAGCTTGttttctttttttGTACATACATTGCTGTTCTAACTCCCTAGGTGTTTTAGTGTACAGAATTGTCTGTCATTTCCGCTTCCCTTCCTACAATCTGAAATTCttttttttttttNCTTCTTCTTTGGNCGGG
  3   1   2       add DMZ       out                        xl330g16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACAGCAAACTNTCCCAACTGGGNGAGTCNCGGGAACAATTTCAGCATGTCGAACTNGACTCCAACCNGACCTACCCTAGCACAACCNCCTCATCCTCCGCCTCTTCAACAAACATNGNCGACTTGAAAAAGNGNCTGGAAAGGATCAAAAGTAGCCGGAAATAATAGATTGCTAATAATAACATCTGGCTGNTGTCCTATTATTACTCAAGGCCCCGNATAGGAATCCTATTGGCANCAGNGNGGNTGTTATCTAGGCCNCACTTCTTTTATGTAACNTAATGNGCAATTGTTTAGTCTGGNGGNGGGNCAACAACATATTTACTGNGGCTGAGCTTGTTTTCTTTTTTTGNACATACNTTGCTGTTCTAACNCCCTAGGNGTTTTAGNGTACAGAATTGTCTGTCATTTCCGCTTCCCNTCCTACAATNTGAAATTCTTTTTTTTTTTTCTTCTTCTTTTGTCTGGTTTTAATTGTTCTTTCCCCTGGCTCTTATATTTGTAACTCNGGCTGTNTAACATGCTTTTAATTTAACATAAAGCAGTGGATTGCTGATTCTGTATGGAATCGTACG
  3   1   2       add Ov1       out                   IMAGE:5074243.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGAACAATTTCAGCACGTCGACCTCGACTCCAACCAGACCTACCCTAGCACAACCACCTCATCCTCCGCCTCTTCAACAAACATCGACGACTTGAAAAAGAGACTGGAAAGGATCAAAAGTAGCCGGAAATAATAGCTTGCTAATAATATCTGGCTGTTGTCCTATTATTACTCAAGGCCCCGTATAGGAATCCTATTGCCCGCAGAGTGGCTGTTATCTAGGCCTCACTTCTTTTATGTAACATAATGTGCAATTGTTTAGTCTGGAGGAGGGACAACAACATATTTACTGTGGCTGAGCTTTTTTTTCTTTTTTTGTACATACATTGCTGTTCTAACTCCCTAGGTGTTTTAGTGTACAGAATTGTCTGTCATTTCCGCTTCCCTTCCTACAATCTGAAATTCTTTTCTTTTTGTTTTTTTTTTCTTTTGTCTGGTTTTAATTGTTCTTTCCCCATGGCTCTTATATTTGTAACTCTGGCTGTTTAACATGCTTTTAATTTAACATAAAGCAGTGGATTGCTGATTCTGTATGGAATCGTACGGCATGGCATGAAGACTTTTTTTTGTAAATAAAGTTTAAAATACTGTGAAAA
  3   1   2       bld Oo1       in                    IMAGE:3404962.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAAGGATCAAAAGTAGCCGGAAATAATAGATTGCTAATAATAACATCTGGCTGTTGTCCTATTATTACTCAAGGCCCCGTATAGGAATCCTATTGGCAGCAGAGTGGCTGTTATCTAGGCCTAACTTCTTTTATGTAACATAATGTGCAATTGTTTAGTCTGGAGGAGGGACAACAACATATTTACTGTGGCTGAGCTTGTTTTCTTTTTTTGTACATACATTGCTGTTCTAACTCCCTAGGTGTTTTAGTGTACAGAATTGTCTGTCATTTCCGCTTCCCTTCCTACAATCTGAAATTCTTTTTTTTTTTTTCTTCTTCTTTTGTCTGGTTTTAATTGTTCTTTCCCCTGGCTCTTATATTTGTAACTCTGGCTGTTTAACATGCTTTTAATTTAACATAAAGCAGTGGATTGCTGATTCTGTATGGAATCGTACGGCATGGCATGAAGACTTTTTTTGTAAATAAAGTTTAAAATACTGTGTAAA
  5   1   2       add Ga15      in                       XL411d05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCAAGGCCCCGATATAGGAATCCTATTGGCAGCANAGTGGCTGTTATCTANGCCTAACTTCTTTTATGTAACATAATGTGCNATTGTTTAGTCTGGAGGAGGGACAACAACATATTTACTGTGGCTGAGCTTGttttctttttttGTACATACNTTGCTGTTCTAACTCCCTAGGTGTTTTAGTGTACAGAATTGTCTGTCATTNCCGCTTCCCTTCCTACNATCTGAAATTCNNTTTTTNTTTTTCNC
  5   1   2       bld Ga15      ?                        XL409d05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCAAGGCCCCGTATAGGAATCCTATTGGCAGCAGAGTGGCTGTTATCTAGGCCTAACTTCTTTTATGTAACATAATGTGCAATTGTTTAGTCTGGAGGAGGGACAACAACATATTTACTGTGGCTGAGCTTGttttctttttttGTACATACATTGCTGTTCTAACTCCCTAGGTGTTTTAGTGTACAGAATTGTCTGTCATTTCCGCTTCCCTTCCTACAATCTGAAATTCttttttttttttNCTNCTNCTTTNGCCGGGTTT
  5   1   2       bld Ga15                               XL459a21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTCTTTTATGTAACATAATGTGCAATTGTTTAGTCTGGAGGAGGGACAACAACATATTTACTGTGGCTGAGCTTGttttctttttttGTACATACATTGCTGTTCTAACTCCCTAGGTGTTTTAGTGTACAGAATTGTCTGTCATTTCCGCTTCCCTTCCTACAATCTGAAATTCttttttttttttCTTCTTCTTTNGNCGGGTTTNAATNGTTCTTTCCCCNGGCTCTNANATTTG
  3   1   2       add Ga15      in                       XL438i14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GNTTTAACNCCCNAGGGGNTTTAGGGNACNGAANTGTNTGNCNNTTCCGNTTCCCNTCCTACNATTTGAAANTNTTTTTTTTTTTTTTCTTCTTTTGTCTGGTTTTAATTGTTCTTTCCCCTGGCTCTTATATTTGTAACTCTGGCTGTTTAACATGCTTTTAATTTAACATAAAGCAGTGGATTGCTGATTCTGTATGGAATCGTACGGCATGGCATGAAGAC
  3   1   2       add Ga15      in                       XL411d05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCNNTTCCCTTCCTNCAATTNGAAANTNTTTTTTTTTTTTTCTTCTTCTTTTGTCTGGTTTTAATTGTTCTTTCCCCTGGCTCTTATATTNGTAACTCTGGCTGTTTAACATGCTTTTAATTTAACATAAAGCAGTGGATTGCTGATTCNGTATGGAATCGTACGGCANG
  3   1   2       bld Tbd7      in                         XL107o06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ANTCTTTTTTTTTTTTTCTTCTTCTTTTGTCTGGTTTTAATTGTTCTTTCCCCTGGCTCTTATATTTGTAACTCTGGCTGTTTAACATGCTTTTAATTTAACATAAAGCAGTGGATTGCTGATTCTGTAGGAATCGTACGGCAGGCATAAGACTTTTTTTGTAAATAAAGTTTAAAATACTG
  3   1   2       add Ga15                               XL410d05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ANTTTTTTTnTTTTTTTCTTCTTCTTTNGTCTGGTTTTAATTGTTCTTTCCCCTGGCTCTTATATTTGTAACTCTGGCTGTTTAACATGCTTTTAATNTAACATAAAGCAGTGGATTGCTGANTCNGTANGGAATCGTACGGCATGGCATGAAGACTT
  3   1   2       bld Tbd7      in                         XL107i09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCNTTTTTTTTTTTTCTTCTTTTGTCTGGTTTTAATTGTTCTTTCCCCTGGCTCTTATATTTGTAACTCTGGCTGTTTAACATGCTTTTAATTTAACATAAAGCAGTGGATTGCTGATTCTGTAGGAATCGTACGGCAGGCATAAGACTTTTTTTGTAAATAAAGTTTAAAATA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)