Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Oct 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     11.8899999999999999    0Xl3.1-xlk131h15ex.3.5                      67 END     9          75       13                sal-like 1 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 95%

 1012777842 Xl3.1-IMAGE:6631038.5 - 12 ESTs
                                                                       ......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6631038.5                                                                                                                                                                                                                                                                 GGGGCTCCCTGCCCGCAATTGGGAGCACATTTTGGGAGTAAATTATTTGTCTTCTGTCCCAGCTGATGTGTGAGCCAGCATGTCTCGGAGGAAGCAGCCGAAACCCCAGCATTTCCAATCGGACCCCGGCCTGGCCTTGCCTGGAAGTCATGGTACACTGGATTTGCTACAACTAAGGATCAGCAGAGAATCTGAAGAAATGAAATCTGAACCAGAAGAAATAAAACTAAAGTTTAATCATGAAAGAAGAACAGAGAGGGGTCAAATCCATCGGACGCCCAAGAACAAGGAGGCGCATGTCTGTAGCAGATGTTGTGCAGAGTTCTTTGAACTATCAGATTTGTTGCAACACAAGAAGAACTGCACTAAAAATCAATTGGTTCTAATTGTGAATGAAAATCCACCACCTCCTGCTGAAGCCAGCTCTCCTAGTCTCCCCTCAGATAATCCTGATGAGCACATGAATGACACAGTTAATAACTCAGATCAAGCAGACTGCAGTGACCTTTCAGAGCATGGTGAGCACGGCAAGCCTGACAAAGAAGAATCCATGGAGGTGGAGATTTCGGAAACTAACAATAGCAGCAGTGGTTCTAACAAAGTGGACAATGGTGATTCAAGCAGTAATAATCCCACATTGGGTACCTCAGCTATCACAACTTCGCTACCTCAAGTAAGGGATCTGACAGCTTTGGGCAACTTCTCTATGATTAACAGCAATGTCATAATTGAGAACCTTCAGAGCACTAGAGTGGCAGTGGCACAATTCTCCCAAGAAGCCAAAACTAAGGGGGCAGCAAACAACAAGTTGGCAGTGCCTGCATTCATGGAGCAGCTCTTGGCTTTACAGCAGCAACAGATTCACCAGTTGCATCTGATTGAACAAATCCGTCACCAAATATTACTGTTGGCATCACAGAGTGCAGAGATGCCCACTTCATCTAGTAGCCCTCAAGGGGCTTTAAGGGTATC
                                                  Xl3.1-CHK-1012693594                                                                                                                                                                                                                                                                       CCCTGCCCGCAATTGGGAGCACATTTTGGGAGTAAATTATTTGTCTTCTGTCCCAGCTGATGTGTGAGCCAGCATGTCTCGGAGGAAGCAGCCGAAACCCCAGCATTTCCAATCGGACCCCTGCCTGGCCTTGCCTGGAAGTCATGGTACACTGGATTTGCTACAACTAAGGATCAGCAGAGAATCTGAAGAAATGAAATCTGAACCAGAAGAAATAAAACTAAAGTTTAATCATGAAAGAAGAACAGAGAGGGGTCAAATCCATCGGACGCCCAAGAACAAGGAGGCGCATGTCTGTAGCAGATGTTGTGCAGAGTTCTTTGAACTATCAGATTTGTTGCAACACAAGAAGAACTGCACTAAAAATCAATTGGTTCTAATTGTGAATGAAAATCCACCACCTCCTGCTGAAGCCAGCTCTCCTAGTCTCCCCTCAGATAATCCTGATGAGCACATGAATGACACAGTTAATAACTCAGATCAAGCAGACTGCAGTGACCTTTCAGAGCATGGTGAGCACGGCAAGCCTGACAAAGAAGAATCCATGGAGGTGGAGATTTCGGAAACTAACAATAGCAGCAGTGGTTCTAACAAAGTGGACAATGGTGATTCAAGCAGTAATAATCCCACATTGGGTACCTCAGCTATCACAACTTCGCTACCTCAAGTAAGGGATCTGACAGCTTTGGGCAACTTCTCTATGATTAACAGCAATGTCATAATTGAGAACCTTCAGAGCACTAGAGTGGCAGTGGCACAATTCTCCCAAGAAGCCAAAACTAAGGGGGCAGCAAACAACAAGTTGGCAGTGCCTGCACTCATGGAGCAGCTCTTGGCTTTACAGCAGCAACAGATTCACCAGTTGCATCTGATTGAACAAATCCGTCACCAAATATTACTGTTGGCATCACAGAGTGCAGAGATGCCCACTTCATCTAGTAGCCCTCAAGGGGCTTTAAGGGTATCTGCCAC
                                                      consensus depths                                                                                                                                                                                                                                                                      3     6     4     6     4     6     4     6     4     6     4     6     3     6     4     6     4     6     4     7     5     8     5     8     6     8     8     9     8     9     7     9     8     9     8     9     9     9     9     9     9     9    10    10    10    10    10    10    10    10    10    10     9    10    10    10    10    10    11    11    11    11    10    11    11    11    11    11     9    11    11    11    10    11    11    11    10    10     9    10     9     9     9     9     8     8     8     8     8     8     7     8     8     8     8     8     8     8     8     8     7     7     7     7     5     6     5     6     5     6     4     5     4     5     4     5     4     6     4     6     4     6     4     6     4     6     2     6     4     6     4     6     3     5     3     5     2     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     3     4     4     4     2     4     3     4
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                         ---GT-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                 C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --------AC--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --C------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----A-------
                                               BLH ATG      79     192                                                                                                                                                                                                                                                                 
                                               BLH MIN      79      94                                                                                                                                                                                                                                                                 
                                               BLH MPR      79      94                                                                                                                                                                                                                                                                 
                                               BLH OVR      79     360                                                                                                                                                                                                                                                                 
                                               CDS MIN      79      94                                                                                                                                                                                                                                                                 
                                               ORF LNG      79      25                                                                                                                                                                                                                                                                 
                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = Sp ==== 3e-018     XP_001186630.1 PREDICTED: similar to Msal-3 protein [Strongylocentrotus purpuratus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = ?? ==== 1e-022     XP_614880.3 PREDICTED: similar to sal-like 4 isoform 1 [Bos taurus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = Dr ==== 4e-073     XP_683406.2 PREDICTED: sal-like 1a (Drosophila) [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Mm ==== 2e-080     NP_067365.2 sal-like 1 [Mus musculus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = Bt ==== 9e-089     XP_592327.2 PREDICTED: similar to Sal-like protein 1 (Zinc finger protein SALL1) (Spalt-like transcription factor 1) (HSal1) [Bos taurus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = Cf ==== 3e-089     XP_544410.2 PREDICTED: similar to Sal-like protein 1 (Zinc finger protein SALL1) (Spalt-like transcription factor 1) (HSal1) isoform 1 [Canis familiaris] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Hs ==== 5e-093     NP_002959.2 sal-like 1 [Homo sapiens] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Gg ==== 6e-104     NP_990038.1 spalt 1 [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Xl ==== 3e-158     AAG45108.1 spalt transcription factor Sall1 [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Xt ==== 7e-164     NP_001090646.1 sal-like 1 [Xenopus tropicalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6631038.5                                                                                                                                                                                                                                                                                                                                       TGA------ATG---------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ...
  5   1   2       add Ga18      out                     xlk161b09ex.5p TTGGTTTGAATAGAGCTGGCCATGTNNNNNCCCCCCTCCCCTATTACTAACCCCACTCCTATGATTAATCGCAATGCATTATTGATCATCATAATTATGGCAGGACACATGCGCGCTGGNTGGGANTCCCTGGCCGCAATTGGGAGCACATTTTGGGAGTAAATTATTTGTCTTCTGTCCCAGCTGATGTGTGAGCCAGCATGTCTCGGAGGAAGCAGCCGAAACCCCAGCATTTCCAATCGGACCCCGGCCTGGNCTTGNNTGGAAGTCATGAGCAGAATCCAACCATGAGTTTCATTCAAGACAACTGTTACAATGGTTGCAAATATTCCACAGGAGATGCTGATGTAGCAAATTGTAACAGTTCAGAATCTAAAAGCAACTTGACAGAAAAAAAGTGTTTGGAAGGTACACTGGATTTGCTACAGTTAAGGATCAGCAGAGAATCCGAAGAAATGAAATCTGAACCAGAAGAAATAAAACTAAAGTTTAATCATGAAAGAAACACAGAGAGGGGTCAAATCCATCGGACGCCCAAGAACAAGGAGGCGCATGTCTGTAGCAGATGTTGTGCAGAGNTCTTTGAACTATCAGANTTGTTGCAACACAAGAAGAACTGCACTAAAAATCAATTNGNTCTAATTGTGAATGAAAATCCACCACCTCCNNCTGAAGNCAGCTCTCCTGGNCCTCCCTCGGATAATCCTGATGAGCACNTG
  5   1   2       bld Emb1                            IMAGE:6862463.5p                                                                                                                                         TTATGGCAGGACACATGCGCGCTGGCTGGGGCTCCCTGCCCGCAATTGGGAGCACATTTTGGGAGTAAATTATTTGTCTTCTGCCCCAGCTGATGTGTGAGCCAGCATGTCTCGGAGGAAGCAGGCGAAACCCCAGCATTTCCAATCGGACCCCGGCCTGGCCTTGCCTGGAAGTCATGGCGCTGAGTAAATGATTAGAAGGGCTGAAAAGATCACCAAGCATTTAACATAAGTTAGTCACCAGGTCTTGAGCAAGCTGCCTGCAGGACATGGTACACTGGATTTGCTACAACTAAGGATCAGCAGAGAATCTGAAGAAATGAAATCTGAACCAGAAGAAATAAAACTAAAGTTTAATCATGAAAGAAGAACAGAGAGGGGTCAAATCCATCGGACGCCCAAGAACAAGGAGGCGCATGTCTGTAGCAGATGTTGTGCAGAGTTCTTTGAACTATCAGATTTGTTGCAACACAAGAAGAACTGCACTAAAAATCAATTGGTTCTAATTGTGAATGAAAATCCACCACCTCCTGCTGAAGCCAGCTCTCCTAGTCTCCCCTCAGATAATCCTGATGAGCACATGAATGACACAGTTAATAACTCAGATCAAGCAGACTGCAGTGACCTTTCAGAGCATGGTGAGCACGGCAAGCCTGACAAAGAAGAATCCATGGAGGTGGAGATTTCGGAAACTAACAATAGCAGCAGTGGTTCTAACAAAGTGGACAATGGTGATTCAAGCAGGTAATAATCCCACATTGGGGTACCTCAGCCTATCACCAACTTCGCTACCTCAAGGTAAGGGGATCTGGACAGCCTTTTGGGCCAACCTTCTCCTATGGAATTAACCAGCAAATGTTCCATTAATTTGAAGAAAACCCTTCCAGAGGCAACTATTAAGTGTGGGCAGGTGG
  5   1   2       add Emb1 5g3  out                   IMAGE:3402285.5p                                                                                                                                          TTTGAATAGAGCTGGCCATGTGCCAGcccccccctccccTATTACTAACCCCACTCCTATGATTAATCGCAATGCATTATTGATCATCATAATTATGGCAGGACACATGCGCCCTGGCTGGGGCTCCCTGGCCGCAATTGGGAGCACATTTTGGGAGTAAATTATTTGTCTTCTGTCCCAGCTGATGTGTGAGCCAGCATGTCTCGGAGGAAGCAGCCGAAACCCCAGCATTTCCAATCGGACCCCTGCCTGGCCTTGCCTGGAAGTCATGGTACACTGGATTTGCTACAGTTAAGGATCAGCAGAGAATCCGAAGAAATGAAATCTGAACCAGAAGAAATAAAACTAAAGTTTAATCATGAAAGAAACACAGAGAGGGGTCAAATCCATCGGACGCCCAAGAACAAGGAGGCGCATGTCTGTAGCAGATGTTGTGCAGAGTTCTTTGAACTATCAGATTTGTTGCAACACAAGAAGAACTGCACTAAAAATCAATTGGTTCTAATTGTGAATGAGAATGCACCACCTCCCGCTGAAGCCAGCTCTCCTAGTCCTCCCTCGGATAATCCTGATGAGCACATGAATGACACAATTAATAACTCAGATCAAGCAGACTGCAGTGAC
  5   1   2       add DMZ  5g3  out                        xl234d08.5p                                                                                                                                                                                                                                                        CCCTGGCTGGGGCTCCCGTGGCCGCAATTGGGAGCACATTTTGGGAGTAAATTATTTGTCTTCTGTCCCAGCTGATGTGTGAGCCAGCNTGTCTCGGAGGAAGCAGCCGAAACCCCAGNATTTCCNATCGGACCCCTGCCTGGCCTTGCCTGGAAGTCATGGTACACTGGATTTGCTACAGTTAAGGATCAGCAGAGAATCCGAAGAAATGAAATCTGAACCAGAAGAAATAAAACTAAAGTTTAATCATGAAAGAAACACAGAGAGGGGTCAAATCCATCGGACGCCTAATAACAAGGAGGCGCATGTCTGTAGCAGATGTTGTGCAGAGTTCTTTGAACTATCAGATTTGTTGCAACACAAGAAGAACTGCNCTAAAAATCAATTGGTTCTAATTGTGAATGAAAATCCACCACCTCCCGCTGAANCCAGCTCTCCTAGTCCTCCCTCGGATAATCCTGATGAGCACATGAATGACACAATTAATAACTCAGA
  5   1   2      seed Ga12 5g3  out                        XL212c08.5p                                                                                                                                                                                                                                                         GGCTGGCTGGGGCTCCCTGCCCGCAATTGGGAGCACATTTTGGGAGTAAATTATTTGTCTTCTGCCCCAGCTGATGTGTGAGCCAGCATGTCTCGGAGGAAGCAGGCGAAACCCCAGCATTTCCAATCGGACCCCGGCCTGTCCTTGCCTGGAAGTCATGGTACACTGGATTTGCTACAACTAAGGATCAGCAGAGAATCTGAAGAAATGAAATCTGAACCAGAAGAAATAAAACTAAAGTTTAATCATGAAAGAAGAACAGAGAGGGGTCAAATCCATCGGACGCCCAAGAACAAGGAGGCGCATGTCTGTAGCAGATGTTGTGCAGAGTTCTTTGAACTATCAGATTTGTTGCAACACAAGAAGAACTGCACTAAAAATCAATTGGTTCTAATTGTGAATGAAAATCCACCACCTCCTGCTGAAGCCAGCTCTCCTAGTCTCCCCTCAGATAATCCTGATGAGCACATGAATGACACAGTTAATAACTCAGATCAAGCAGACTGCAGTGACCTTTCAGAGCATGGTGAGCACGGCAAGCCTGACAAAGAAGAATCCATGGAGGTGGAGATTTCGGAAACTAACAATAGCAGCAGTGGTTCTAACAAA
  5   1   2       bld DMZ       out                        xl275f03.5p                                                                                                                                                                                                                                                          GCTGGCTGGGGCTCCCTGCCCGCAATTGGGAGCACATTTTGGGAGTAAATTATTTGTCTTCTGCCCCAGCTGATGTGTGAGCCANCATGNCTCGGAGGAAGCAGGCGAAACCCCAGCATTTCCAATCGGACCCCGGCCTGTCCTTGCCTGGAAGTCATGGTACACTGGATTTGCTACAACTAAGGATCAGCNNAGAATCTGAAGAAATGAAATCTGAACCAGAAGAAATAAAACTAAAGTTTAATCATGAAAGAAGAACAGAGAGGGGTCAAATCCATCGGACGCCCAAGAACAAGGAGGCGCATGTCTGTAGCAGATGTTGTGCANAGTTCTTTGAACTATCAGATTTGTTGCAACACAAGAAGAACTGCACTAAAAATCAATTGGTTCTAATTGTGAATGAAAATCCACCACCTCCTGCTGAAGCCAGCTCTCCTAGTCTCCCCTCAGATAATCCTGATGAGCACATGAATGACACAGTTNATAACTCAGATCANGCAGACTGCANTGACCTTTCAGAGCATGGTGAGCACGGCAAGCCTGACAAAGAANAATCCATGGAGGTGGAGATTTCGGATACTAACAATAGCAGCAGTGGTTCTAACAAAGTGGACAATGGTGATTCAAGCAGTAATA
  5   1   2       bld Emb1                            IMAGE:6631038.5p                                                                                                                                                                                                                                                                                                                                                                    GAAACCCCAGCATTTCCAATCGGACCCCGGCCTGGCCTTGCCTGGAAGTCATGGTACACTGGATTTGCTACAACTAAGGATCAGCAGAGAATCTGAAGAAATGAAATCTGAACCAGAAGAAATAAAACTAAAGTTTAATCATGAAAGAAGAACAGAGAGGGGTCAAATCCATCGGACGCCCAAGAACAAGGAGGCGCATGTCTGTAGCAGATGTTGTGCAGAGTTCTTTGAACTATCAGATTTGTTGCAACACAAGAAGAACTGCACTAAAAATCAATTGGTTCTAATTGTGAATGAAAATCCACCACCTCCTGCTGAAGCCAGCTCTCCTAGTCTCCCCTCAGATAATCCTGATGAGCACATGAATGACACAGTTAATAACTCAGATCAAGCAGACTGCAGTGACCTTTCAGAGCATGGTGAGCACGGCAAGCCTGACAAAGAAGAATCCATGGAGGTGGAGATTTCGGAAACTAACAATAGCAGCAGTGGTTCTAACAAAGTGGACAATGGTGATTCAAGCAGTAATAATCCCACATTGGGTACCTCAGCTATCACAACTTCGCTACCTCAAGTAAGGGATCTGACAGCTTTGGGCAACTTCTCTATGATTAACAGCAATGTCATAATTGAGAACCTTCAGAGCACTAGAGTGGCAGTGGCACAATTCTCCCAAGAAGCCAAAACTAAGGGGGCAGCAAACAACAAGTTGGCAGTGCCTGCACTCATGGAGCAGCTCTTGGCTTTACAGCAGCAACAGATTCACCAGTTGCATCTGATTGAACAAATCCGTCACCAAATATTACTGTTGGCATCACAGAGTGCAGAGATGCCCACTTCATCTAGTAGCCCTCAAGGGGCTTTAAGGGTATCTGCCAC
  5   1   2       bld Ga18      out                     xlk122j06ex.5p                                                                                                                                                                                                                                                                                                                                                                                         ACAATGAGCTCCACATGAACTCAATCACCANNNNNCACTGGATTTGCTACAACTAAGGATCAGCAGAGAATCTGAAGAAATGAAATCTGAACCAGAAGAAATAAAACTAAAGTTTAATCATGAAAGAAGAACAGAGAGGGGTCAAATCCATCGGACGCCCAAGAACAAGGAGGCGCATGTCTGTAGCAGATGTTGTGCAGAGTTCTTTGAACTATCAGATTTGTTGCAACACAAGAAGAACTGCACTAAAAATCAATTGGTTCTAATTGTGAATGAAAATCCACCACCTCCTGCTGAAGCCAGCTCTCCTAGTCTCCCCTCAGATAATCCTGATGAGCACATGAATGACACAGTTAATAACTCAGATCAAGCAGACTGCAGTGACCTTTCAGAGCATGGTGAGCACGGCAAGCCTGACAAAGAAGAATCCATGGAGGTGGAGATTTCGGAAACTAACAATAGCAGCAGTGGTTCTAACAAAGTGGACAATGGTGATTCAAGCAGTAATAATCCCACATTGGGTACCTCAGCTATCACAACTTCGCTACCTCAAGTAAGGGATCTGACAGCTTTGGGCAACTTCTCTATGATTAACAGCAATGTCATAATTGAGAACCTTCAGAGCACTAGAGTGGCAGTGNNNCAATTCTCCCAAGAAGCCAAAACTAAGGGGGCANNAAACAACAAGNTGGCAGTNNTNCACTCATNGAGCAGCTCTTGGCTTTACAGCAGNA
  5   1   2       bld Ga12      out                        XL192g21.5p                                                                                                                                                                                                                                                                                                                                                                                                                          CACTGGATTTGCTACAACTAAGGATCAGCAGAGAATCTGAAGAAATNGAAATCTCGAACCAGAAGAAATAAAACTAAAGTTTAATCATGAAAGAAGAACAGAGAGGGGTCAAATCCATCGGACGCCCAAGAACAAGGAGGCGCATGTCTGTAGCAGATGTTGTGCAGAGTTCTTTGAACTATCAGATTTGTTGCAACACAAGAAGAACTGCACTAAAAATCAATTGGTTCTAATTGTGAATGAAAATCCACCACCTCCTGCTGAAGCCAGCTCTCCTAGTCTCCCCTCAGATAATCCTGATGAGCACATGAATGACACAGTTAATAACTCAGATCAAGCAGACTGCAGTGACCTTTCAGAGCATGGTGAGCACGGCAAGCCTGACAAAGAAGAATCCATGGAGGTGGAGATTTCGGAAACTAACAATAGCAGCAGTGGTTCTAACAAAGTGGACAATGGTGATTCAAGCAGTAATAATCCCACATTGGGTACCTCAGCTATCACAAC
  5   1   2       bld Ga18      out                     xlk121i22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGAACAGAGAGGGGNCAAATCCATCGGACGCCCAAGAACAAGGAGGCGCATGTCTGTAGCAGATGTTGTGCAGAGTTCTTTGAACTATCAGATTTGTTGCAACACAAGAAGAACTGCACTAAAAATCAATTGGTTCTAATTGTGAATGAAAATCCACCACCTCCTGCTGAAGCCAGCTCTCCTAGTCTCCCCTCAGATAATCCTGATGAGCACATGAATGACACAGTTAATAACTCAGATCAAGCAGACTGCAGTGACCTTTCAGAGCATGGTGAGCACGGCAAGCCTGACAAAGAAGAATCCATGGAGGTGGAGATTTCGGAAACTAACAATAGCAGCAGTGGTTCTAACAAAGTGGACAATGGTGATTCAAGCAGTAATAATCCCACATTGGGTACCTCAGCTATCACAACTTCGCTACCTCAAGTAAGGGATCTGACAGCTTTGGGCAACTTCTCTATGATTAACAGCAATGTCATAATTGAGAACCTTCAGAGCACTAGAGTGGCAGTGNNACAATTCTCCCAAGAAGCCAAAACTAAGGGGNCAGCAAACAACAAGTTGGCAGTNCCTGCACTCATGGAGCAGCTCTTGGCTTTACAGCAGCAACAGATTCACCAGTTGCATCTGATTGAACAAATCCGTCACCAAATATTACTGTTGGCATCACAGAGTGCAGAGATNNCCACTTCATCTAGTAGCCCTCAAGGGNNTTTAAGGGTNTCT
  5   1   2       add Emb1                            IMAGE:6632957.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTGTCGCAACACAAGAAGAACTGCACTAAAAATCAATTGGTTCTAATTGTGAATGAAAATCCACCACCTCCCGCTGAAGCCAGCTCTCCTAGTCCTCCCTCGGATAATCCTGATGAGCACATGAATGACACAATTAATAACTCAGATCAAGCAGACTGCAGTGACCTTTCAAAGCATGGTGAGCACGGCAAGCCTGACAATGAAGAATCAGTGGAGGTGGAGATTTCGGAAACTAACAATAGCAGCAGTGGTTCTAACAAAGTGGACAATGGTGATTCAAGCAGTAATAATCCCACATTGGGTACCTCAGCTATCACAACTTCGCTACCTCAAGTAAGGGATCTGACAGCCTTGGGCAACTTCTCTATGATTAACAGCAATGTCATCATTGAGAACCTTCAGAGCACTAGAGTGGCAGTGGCACAATTCTCCCAAGAAGCCAAAACTAAGGGGGCAGCAAACAATAAACTGGCAGTGCCTGCATTCATGGAGCAGCTCTTGGCTTTACAGCAACAGCAGATACACCAGTTGCATCTAATTGAACAAATCCGTCACCAAATATTACTGTTGGCATCACAGAGTGCAGAGATGCCCACTTCATCTAGTGACCCTCAAGGGGCTTTAAGGGTATCTGCCACTCCATTGACTACTCTGAGTTCCCATTTGTCCCAGCAGCTAGCTGCAGCAGCTGGCTTAGCACAAAGTCTTGCTAGCCAGTCAGCGAGCATCGGTGGGATGAAACCACTTACCACCATTACAGCTACCTTCAGAACAACTCTGTTAAACACAGTTTCCATCCCATCCGGTAAGTTCCCCCTCCAAAAAATGAATGGCATTGGGCCAACAAACCGGTTAAATTCCACCCT
  5   1   1       add Ga18      out                     xlk131h15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTGGGCAACTTCTCTATGATTAACAGCAATGTCATAATTGAGAACCTTCAGAGCACTAGAGTGGCAGNNNNNAATTCTCCCAAGAAGCCAAAACTAAGGGGGCAGCAAACAACAAGTTGGCAGTNNNGCACTCATGGAGCAGCTCTTGGCTTTACAGCAGCAACAGATTCACCAGTTGCATCTGATTGAACAAATCCGTCACCAAATATTACTGTTGGCATCACAGAGTGCAGAGATGCCCACTTCATCTAGTAGCCCTCAAGNNNNTTAAGGGTATCTGCCACTCCACTGACTACTCTGAGTTCCCATTTGTCCCAGCAGCTANNNNNNCAGCTGGCTTAGCACAAAGTCTTGCTAGCCAATCAGCTAACATCAGTGGTATGAAGCAACTACCCCCCATACAGCTACCTCAGAGCAACCCAGTTAACACAGTTCCATCCATCAGTAGTTCCTCTCCAAATATAAATTCATTGGCAGCAACAGTTACTCCACCCTCCTCAGAGAGAGTACCTTCAAGCTCTGGTGGCTCACAGGTCAGTAACACACCCGTTCCTGTAACATCATCACCAGCTTTTGCAATAAGTAGTTTATTAAGCCCTGCACCCAATCCACTACTACCTCAACCTGCCCCTNATACCACAGCTTNNNCTAGCTCATTGCCCAGCATAGGAACAACAGCAGANGNNTTAAACTCCCTGAGGAAAAGNAANNNACCCAGTGTGACTGCNTTTGAAACTAAGAGTACATCTNANGAGGCATNCTTNNAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)