Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 96%

 1012777843 Xl3.1-IMAGE:8078288.5 - 6 ESTs
                                                                       ........-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8078288.5                             CTCAGGAGCTGTGCCCATCACTCAGCGACTTACTGGTGCCCTGAGCGAGAAGAGGGGAGAGAGTGACACTGATGTGCTGGGATCCTCACACACCCTCCCACCGACACAGTCCTGCAGCCCAGCATTGAGCCCAGACACACGGGCACAGCCATGAGCGGCCACTACCAAGAGGAGACTTCTGAGAGGTCGGAATGTAAAAGTAAATCTCCCACCCTGCTCTCTTCCTACTGTATAGACAGTATCCTGGGCAGGAGGAGCCCCTGCAAAATGAGACTTCTGGGCGCCCAGAGCCTGCCTTCCCTGGCACATCGGCTGGACCCCGACAAAACTTTGGAAGGGTCACCTAAGGGCAATGCTACATTTGAGGCCGATTTGCACCTGCCGCCCAAACTAAGGAGACTGTATGGCCCAGTGGGGGCTGGGGGCAGGATCCATCTCCAGTCCATTGCTGATGTCAGATCTGGGGTGCCCCGTTCAGAAAAGACTGATCGTATTTTACTTTTGGGGGGAGCAGGGGAGAATTCCTGGGACAATCACAGCCTAAAGATCAGCCAGGCCCCGCAGGTCAGCATCAGTCGCAGCAAGTCGTACAGAGAGAACAGCGCCCCCCTGCTGCGAGAGGAGCACAGCCCAGAGGGTCTCATGCAACAGTCACAGCAGCAGATCCAAAACAGCTCCAACAACGCCTGCACCTCTTTACAGGACAGACTGGGAAGCCCTTCTCAGAGTCCC
                                                  Xl3.1-CHK-1012701969                                   AGCTGTGCCCATCACTCAGCGACTTACTGGTGCCCTGAGCGAGAAGAGGGGAGAGAGTGACACTGATGTGCTGGGATCCTCACACACCCTCCCACCGACACAGTCCTGCAGCCCAGCATTGAGCCCAGACACACGGGCACAGCCATGAGCGGCCACTACCAAGAGGAGACTTCTGAGAGGTCGGAATGTAAAAGTAAATCTCCCACCCTGCTCTCTTCCTACTGTATAGACAGTATCCTGGGCAGGAGGAGCCCCTGCAAAATGAGACTTCTGGGCGCCCAGAGCCTGCCTTCCCTGGCACATCGGCTGGACCCCGACAAAACTTTGGAAGGGTCACCTAAGGGCAATGCTACATTTGAGGCCGATTTGCACCTGCCGCCCAAACTAAGGAGACTGTATGGCCCAGTGGGGGCTGGGGGCAGGATCCATCTCCAGTCCATTGCTGATGTCAGATCTGGGGTGCCCCGTTCAGAAAAGACTGATCGTATTTTACTTTTGGGGGGAGCAGGGGAGAATTCCTGGGACAATCACAGCCTAAAGATCAGCCAGGCCCCGCAGGTCAGCATCAGTCGCAGCAAGTCGTACAGAGAGAACAGCGCCCCCCTGCTGCGAGAGGAGCACAGCCCAGAGGGTCTCATGCAACAGTCACAGCAGCAGATCCAAAACAGCTCCAACAACGCCTGCACCTCTTTACAGGACAGACTGGGAxxCCxTTCTCAGAGTCCCAGGATG
                                                      consensus depths                                  2     2     3     3     3     3     3     3     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     5     6     5     6     5     6     4     5     4     5     4     5     4     5     3     5     3     5     3     5     2     5     2     5
                                               BLH ATG     150     255                             
                                               BLH MIN     150      28                             
                                               BLH MPR     150      28                             
                                               BLH OVR     150     700                             
                                               CDS MIN     150      28                             
                                               EST CLI     -28       1                             
                                               ORF LNG     150      33                             
                                                                                                                                                                                                                                                         PREDICTED = ?? ==== 2e-018     XP_607652.4 PREDICTED: similar to aristaless related homeobox gene (Drosophila) [Bos taurus] ==============================================================
                                                                                                                                                                                                                                                         PROTEIN === Cf ==== 4e-028     NP_001108138.1 aristaless related homeobox [Canis lupus familiaris] ==============================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                         PROTEIN === Dr ==== 1e-036     NP_571459.1 aristaless related homeobox; aristaless related homeobox gene; paired-like(aristaless) homeobox 2a [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                         PROTEIN === Mm ==== 9e-040     NP_031518.2 aristaless related homeobox gene [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                         PROTEIN === Hs ==== 4e-040     NP_620689.1 aristaless related homeobox [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                         PROTEIN === Xl ==== 1e-106     NP_001086450.1 aristaless-related homeobox 2 [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:8078288.5                                                                                            TGA---TGA------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                   [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ...
  5   1   2       bld Eye1 5g                         IMAGE:6949390.5p TCCGGAATTCCCGGGATGAAGAGAGAGGCTCAGGAGCTGTGCCCATCACTCAGCGACTTACTGGTGCCCTGAGCGAGAAGAGGGGAGAGAGTGACACTGATGTGCTGGGATCCTCACACACCCTCCCACCGACACAGTCCTGCAGCCCAGCATTGAGCCCAGACACACGGGCACAGCCATGAGCGGCCACTACCAAGAGGAGACTTCTGAGAGGTCGGAATGTAAAAGTAAATCTCCCACCCTGCTCTCTTCCTACTGTATAGACAGTATCCTGGGCAGGAGGAGCCCCTGCAAAATGAGACTTCTGGGCGCCCAGAGCCTGCCTTCCCTGGCACATCGGCTGGACCCCGACAAAACTTTGGAAGGGTCACCTAAGGGCAATGCTACATTTGAGGCCGATTTGCACCTGCCGCCCAAACTAAGGAGACTGTATGGCCCAGTGGGGGCTGGGGGCAGGATCCATCTCCAGTCCATTGCTGATGTCAGATCTGGGGTGCCCCGTTCAGAAAAGACTGATCGTATTTTACTTTTGGGGGGACCAGGGGAGAATTCCTGGGACAATCACAGCCTAAAGATCAGCCAGGCCCCGCAGGTCAGCATCAGTCGCAGCAAGTCGTACAGAGAGAACAGCGCCCCCCTGCTGCGAGAGGAGCACAGCCCAGAGGGTCTCATGCAACAGTCACAGCAGCAGATCCAAAACAGCTCCAACAACGCCTGCACCTCTTTACAGGACAGACTGGGAAGCCCTTTCTCAGAGTCCCAGGGATGaggaagacgacgatgagggacgaggaaaaggaggaggaggaagaagaagaggagTCNGACAAACAGCATAACTCCAGCCACCCCCACAGGGGGGCACCCTACAGATCAAGCACCCCCACCAATTCCAGCCCGCAACCCGCCGCCAAACAccccccccGGGTGGGGGAAATTGACACGGAAGCTGTTCCCCTAAGGGAGGGAAACGGATGCCTGCCCCTCC
  5   1   2       bld FaBN 5g                         IMAGE:8078288.5p                 GGAAGAGAGAGGCTCAGGAGCTGTGCCCATCACTCAGCGACTTACTGGTGCCCTGAGCGAGAAGAGGGGAGAGAGTGACACTGATGTGCTGGGATCCTCACACACCCTCCCACCGACACAGTCCTGCAGCCCAGCATTGAGCCCAGACACACGGGCACAGCCATGAGCGGCCACTACCAAGAGGAGACTTCTGAGAGGTCGGAATGTAAAAGTAAATCTCCCACCCTGCTCTCTTCCTACTGTATAGACAGTATCCTGGGCAGGAGGAGCCCCTGCAAAATGAGACTTCTGGGCGCCCAGAGCCTGCCTTCCCTGGCACATCGGCTGGACCCCGACAAAACTTTGGAAGGGTCACCTAAGGGCAATGCTACATTTGAGGCCGATTTGCACCTGCCGCCCAAACTAAGGAGACTGTATGGCCCAGTGGGGGCTGGGGGCAGGATCCATCTCCAGTCCATTGCTGATGTCAGATCTGGGGTGCCCCGTTCAGAAAAGACTGATCGTATTTTACTTTTGGGGGGAGCAGGGGAGAATTCCTGGGACAATCACAGCCTAAAGATCAGCCAGGCCCCGCAGGTCAGCATCAGTCGCAGCAAGTCGTACAGAGAGAACAGCGCCCCCCTGCTGCGAGAGGAGCACAGCCCAGAGGGTCTCATGCAACAGTCACAGCAGCAGATCCAAAACAGCTCCAACAACGCCTGCACCTCTTTACAGGACAGACTGGGAGNCCTTTCTCAGAGTCCCAGGNATGANGAAGACGACNNATGAGACGAAGAAAGAGAGAGGANGAAGAANNANNAGA
  5   1   2      seed Ga12 5g                              XL167f11.5p                                   GGCTGTGCCCATCACTCAGCGACTTACTGGTGCCCTGAGCGAGAAGAGGGGAGAGAGTGACACTGATGTGCTGGGATCCTCACACACCCTCCCACCGACACAGTCCTGCAGCCCAGCATTGAGCCCAGACACACGGGCACAGCCATGAGCGGCCACTACCAAGAGGAGACTTCTGAGAGGTCGGAATGTAAAAGTAAATCTCCCACCCTGCTCTCTTCCTACTGTATAGACAGTATCCTGGGCAGGAGGAGCCCCTGCAAAATGAGACTTCTGGGCGCCCAGAGCCTGCCTTCCCTGGCACATCGGCTGGACCCCGACAAAACTTTGGAAGGGTCACCTAAGGGCAATGCTACATTTGAGGCCGATTTGCACCTGCCGCCCAAACTAAGGAGACTGTATGGCCCAGTGGGGGCTGGGGGCAGGATCCATCTCCAGTCCATTGCTGATGTCAGATCTGGGGTGCCCCGTTCAGAAAAGACTGATCGTATTTTACTTTTGGGGGGACCAGGGGAGAATTCCTGGGACAATCACAGCCTAAAGATCAGCCAGGCCCCGCAGGTCAGCATCAGTCGCAGCAAGTCGTACAGAGAGAACAGCGCCCCCCTGCTGCGAGAGGAGCACAGCC
  5   1   2       bld FaBN 5g                         IMAGE:8076136.5p                                                                       GAGCGAGAAGAGGGGAGAGAGTGACACTGATGTGCTGGGATCCTCACACACCCTCCCACCGACACAGTCCTGCAGCCCAGCATTGAGCCCAGACACACGGGCACAGCCATGAGCGGCCACTACCAAGAGGAGACTTCTGAGAGGTCGGAATGTAAAAGTAAATCTCCCACCCTGCTCTCTTCCTACTGTATAGACAGTATCCTGGGCAGGAGGAGCCCCTGCAAAATGAGACTTCTGGGCGCCCAGAGCCTGCCTTCCCGGGCACATCGGCTGGACCCCGACAAAACTTTGGAAGGGTCACCTAAGGGCAATGCTACATTTGAGGCCGATTTGCACCTGCCGCCCAAACTAAGGAGACTGTATGGCCCAGTGGGGGCTGGGGGCAGGATCCATCTCCAGTCCATTGCTGATGTCAGATCTGGGGTGCCCCGTTCAGAAAAGACTGATCGTATTTTACTTTTGGGGGGAGCAGGGGAGAATTCCTGGGACAATCACAGCCTAAAGATCAGCCAGGCCCCGCAGGTCAGCATCAGTCGCAGCAAGTCGTACAGAGAGAACAGCGCCCCCCTGCTGCGAGAGGAGCACAGCCCAGAGGGTCTCATGCAACAGTCACAGCAGCAGATCCAAAACAGCTCCAACAACGCCTGCACCTCTTTACAGGACAGACTGGGAGCCCTTTCTCAGAGTCCCAGGATGAGGAAGAGACGATGANGACgaggaagagaggaggaggaagaagagaggagTCAGACAACNGCATACTCAGCAACCCACAGG
  5   1   2       bld FaBN 5g                         IMAGE:8076804.5p                                                                             GAAGAGGGGAGAGAGTGACACTGATGTGCTGGGATCCTCACACACCCTCCCACCGACACAGTCCTGCAGCCCAGCATTGAGCCCAGACACACGGGCACAGCCATGAGCGGCCACTACCAAGAGGAGACTTCTGAGAGGTCGGAATGTAAAAGTAAATCTCCCACCCTGCTCTCTTCCTACTGTATAGACAGTATCCTGGGCAGGAGGAGCCCCTGCAAAATGAGACTTCTGGGCGCCCAGAGCCTGCCTTCCCTGGCACATCGGCTGGACCCCGACAAAACTTTGGAAGGGTCACCTAAGGGCAATGCTACATTTGAGGCCGATTTGCACCTGCCGCCCAAACTAAGGAGACTGTATGGCCCAGTGGGGGCTGGGGGCAGGATCCATCTCCAGTCCATTGCTGATGTCAGATCTGGGGTGCCCCGTTCAGAAAAGACTGATCGTATTTTACTTTTGGGGGGAGCAGGGGAGAATTCCTGGGACAATCACAGCCTAAAGATCAGCCAGGCCCCGCAGGTCAGCATCAGTCGCAGCAAGTCGTACAGAGAGAACAGCGCCCCCCTGCTGCGAGAGGAGCACAGCCCAGAGGGTCTCATGNCACAGTCACAGCAGCAGATCCAAACAGCTCCNACACGCCTGCACTTCTTACAGGACGACTGGAGCCCTTCTCAAGTCCCGGATGAGGAGACANATGAGACGAGANGAGGAGAGAGAAAAAAAGATTCAANAACGCTACTCCGCACCCACAGGGGCCTA
  5   1   2       bld Emb4 5x                         IMAGE:5572304.5p                                                                                                                                                GATCCAAACACACCCTCCCACCGACACAGTCCTGCAGCCCAGCATTGAGCCCAGACACACGGGCACAGCCATGAGCGGCCACTACCAAGAGGAGACTTCTGAGAGGTCGGAATGTAAAAGTAAATCTCCCACCCTGCTCTCTTCCTACTGTATAGACAGTATCCTGGGCAGGAGGAGCCCCTGCAAAATGAGACTTCTGGGCGCCCAGAGCCTGCCTTCCCTGGCACATCGGCTGGACCCCGACAAAACTTTGGAAGGGTCACCTGCCGCCCAAACTAAGGAGACTGTATGGCCCAGTGGGGGCTGGGGGCAGGATCCATCTCCAGTCCATTGCTGATGTCAGATCTGGGGTGCCCCGTTCAGAAAAGACTGATCGTATTTTACTTTTGGGGGGAGCAGGGGAGAATTCCTGGGACAATCACAGCCTAAAGATCAGCCAGGCCCCGCAAGTCCAGCATCAGTCGCAGCAAGTCGTACAGGAGAGAACAGCGCCCCCCTGCTGCGAGAACAGCACAGCCCAGAGGGTCTCATGCAACAGTCACAGCAAGCAGATCCCAAACAGCCTCCAACAACGCCTGGCACCTCTTTTACAGGGAAAGACTGGGGAGCCCCTTTTCTTCAAAGCTCCCAGGGAATGGAGGAAGCACGAACCAATGCAGGGACGAAGGAAAGACGGACGGACGGGAGGAAAGTAATAAACAGGGAGTTTAGAACCAAACAGCAATAAACCTCCCAGGCAACCCCCCAAACAGGGGCGCCCCCCTAAAAAGAATCAGCGCAGGACCCCGTCAATTTCCCAAGTCCGGCGACTCCGGCCTCAGCCTATccccccccGGGCGGCGGGAAAACGTGCCGCCGCGGAGCCTGCGCCCCCCCAAAGGGAGGGAAATTCGTATGGCCCGGCACCCCTCTTCAAGATAGCTGGGTGTGTGTACAACAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)