Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 18 Jan 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.2    0Xl3.1-xl317b04.3                           20 END     5          38       25                hypothetical protein LOC100037845 [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xl330h10.5                            4 PI      95       1331     1524                hypothetical protein LOC100037845 [Xenopus tropicalis]
     3   0.0    0Xl3.1-IMAGE:5514339.5                       4 PI      79       1201     1523                hypothetical protein LOC100037845 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012777896 Xl3.1-IMAGE:5156055.5 - 13 ESTs
                                                                       -1170.....-1160.....-1150.....-1140.....-1130.....-1120.....-1110.....-1100.....-1090.....-1080.....-1070.....-1060.....-1050.....-1040.....-1030.....-1020.....-1010.....-1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5156055.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTGGCAGTGATGTTTCTGTGGCTATTGGGGGACGTCCCTGCATGTTTTCATGGCGAACTGCGAAAGAGATCCGCTGTAAGACTCCGCAGGGACCAAGCACGGGTAAAGCCGAAATACAAATCCTCATCAACCGCGCCACGATGAACAACTCTGAAGTACATTACAATTACACCGAAGATCCAACCGTGCAAAAGATAGAACCAGAGTGGAGCATCGCCAGTGGGGGAACCCCTCTGATAGTAACTGGGATGAATCTGGCAACTATTAAAGAACCCAAAATAAGAGCTAAATACGGAGATGTGGAGAAAGAAAATAACTGCACTCTTTACAATGACACCACCATGGTGTGCTTGGCACCCTCCGTTGACAATCCCTTGAGGAGCCCTCCGGAGAATGGGGACCGTCCTGATGAGATAGGCTTCATAATGGACAATGTTCATGCCCTCCTTATTGTGAACACTACCAGCTTCCTTTATTACCCGGATCCTGTGTTTGAACCGCTGACGGCATCTGGAAACCTTGAGCTGAAGCCCAGCTCTCCTCTTATAATCAAGGGTCGGAATCTCATTCCAGCAGCCCCAGGGAACTTCAGGCTTAATTATACAGTGTTGATTGGTGACACTCCGTGTGCCCTTACTGTCTCCGAGACCCAGCTCCTGTGCGAGTCTCCGAACCTTACTGGACAGCATAAAGTTACTATTAAAGCCGGAGGGTTTGAGTACTCACCGGGCACACTGCAGATTTACTCGGACAGCCTGCTGACCTTGCCTGCCATTATTGGCATTGGAGGAGGAGGGGGTTTGCTGTTGCTCATTATAATCATCGTGCTTATTGCCTACAAGAGGAAATCGCGGGATGCCGACCGCACCCTGAAACGACTGCAGCTGCAAATGGACAATCTGGAGTCCCGTGTGGCACTGGAGTGCAAAGAAGCCTTTGCAGAGCTGCAGACTGACATCCACGAGCTGACCAACGACCTTGACGGGGCTGGAATTCCTTTCCTGGAGTACCGTACTTACGCCATGCGAGTCCTTTTCCCCGGGATAGAAGATCATCCTGTCCTGAAAGAAATGGAGGTACAAGCCAACGTGGAGAAATCCCTGACGCTTTTTGGGCAGCTCCTCACCAAGAAGCACTTCCTGTTGACCTTCATTCGGACGCTGGAGGCCCAGAGGAGCTTCTCCATGAGAGACAGGGGTAACGTGGCTTCGCTCATCATGACGGCGTTGCAGGGGGAGATGGAATACGCCACCGGCGTTCTCAAGCAGCTTCTCTCCGACCTCATTGAGAAGAATCTTGAAAGCAAAAACCACCCTAAGCTGCTGCTGAGGAGGACAGAGTCTGTGGCTGAGAAGATGCTGACAAACTGGTTTACGTTCCTCCTCTACAAGTTCTTAAAGGAATGTGCTGGGGAGCCGCTCTTCATGTTGCACTGTGCCATCAAGCAACAGATGGAGAAAGGACCTATTGATGCCATCACTGGAGAAGCCCGCTACTCACTGAGCGAGGACAAGCTGATCCGT
                                                  Xl3.1-CHK-1012693014                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTGATGTTTCTGTGGCTATTGGGGGACGTCCCTGCATGTTTTCATGGCGAACTGCGAAAGAGATCCGCTGTAAGACTCCGCAGGGACCAAGCACGGGTAAAGCCGAAATACAAATCCTCATCAACCGCGCCACGATGAACAACTCTGAAGTACATTACAATTACACCGAAGATCCAACCGTGCAAAAGATAGAACCAGAGTGGAGCATCGCCAGTGGGGGAACCCCTCTGATAGTAACTGGGATGAATCTGGCAACTATTAAAGAACCCAAAATAAGAGCTAAATACGGAGATGTGGAGAAAGAAAATAACTGCACTCTTTACAATGACACCACCATGGTGTGCTTGGCACCCTCCGTTGACAATCCCTTGAGGAGCCCTCCGGAGAATGGGGACCGTCCTGATGAGATAGGCTTCATAATGGACAATGTTCATGCCCTCCTTATTGTGAACACTACCAGCTTCCTTTATTACCCGGATCCTGTGTTTGAACCGCTGACGGCATCTGGAAACCTTGAGCTGAAGCCCAGCTCTCCTCTTATAATCAAGGGTCGGAATCTCATTCCAGCAGCCCCAGGGAACTTCAGGCTTAATTATACAGTGTTGATTGGTGACACTCCGTGTGCCCTTACTGTCTCCGAGACCCAGCTCCTGTGCGAGTCTCCGAACCTTACTGGACAGCATAAAGTTACTATTAAAGCCGGAGGGTTTGAGTACTCACCGGGCACACTGCAGATTTACTCGGACAGCCTGCTGACCTTGCCTGCCATTATTGGCATTGGAGGAGGAGGGGGTTTGCTGTTGCTCATTATAATCATCGTGCTTATTGCCTACAAGAGGAAATCGCGGGATGCCGACCGCACCCTGAAACGACTGCAGCTGCAAATGGACAATCTGGAGTCCCGTGTGGCACTGGAGTGCAAAGAAGCCTTTGCAGAGCTGCAGACTGACATCCACGAGCTGACCAACGACCTTGACGGGGCTGGAATTCCTTTCCTGGAGTACCGTACTTACGCCATGCGAGTCCTTTTCCCCGGGATAGAAGATCATCCTGTCCTGAAAGAAATGGAGGTACAAGCCAACGTGGAGAAATCCCTGACGCTTTTTGGGCAGCTCCTCACCAAGAAGCACTTCCTGTTGACCTTCATTCGGACGCTGGAGGCCCAGAGGAGCTTCTCCATGAGAGACAGGGGTAACGTGGCTTCGCTCATCATGACGGCGTTGCAGGGGGAGATGGAATACGCCACCGGCGTTCTCAAGCAGCTTCTCTCCGACCTCATTGAGAAGAATCTTGAAAGCAAAAACCACCCTAAGCTGCTGCTGAGGAGGACAGAGTCTGTGGCTGAGAAGATGCTGACAAACTGGTTTACGTTCCTCCTCTACAAGTTCTTAAAGGAATGTGCTGGGGAGCCGCTCTTCATGTTGCACTGTGCCATCAAGCAACAGATGGAGAAAGGACCTATTGATGCCATCACTGGAGAAGCCCGCTACTCACTGAGCGAGGACAAGCTGATCCGTCAGCAG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     4     4     3     4     3     4     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     5     6     5     6     4     6     4     6     4     6     4     6     4     5     4     5     4     5     4     5     4     6     4     6     5     6     4     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     3     6     3     5     3     5     3     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
  5   1   0       add Ov1                             IMAGE:8330469.5p TGCTCCTTTGAGGATTTTACTGAGATGGAAGGACGGATACTGGATGGAAAGATCTACTGCACATCTCCCTCTGCTAAAGAAGTTATTCCTATCACAAGGGGCCATGGAGACAAGAGGGTTGTAAAACTCTACCTTAAATCCAAAGAAACTGGGAAGAAGTTTGCAAGTGTGGATTTTGTCTTCTACAACTGTAGTGTCCATCAGTCATGCCTCTCCTGTGTAAATGGATCCTTTCCCTGCCACTGGTGCAAATATAGACACGTGTGCACCCACAATGCAGCCGACTGCTCCTTTCAAGAGGGCCGAGTGAACATGTCGGAGGACTGCCCCCAGATTCTGCCTTCCTCCCAGATCTACATCCCTGTTGGGGTCGTGAAGCCCATCACACTGACTGCCAAGAACCTCCCGCAGCCCCAGTCCGGTCAGCGCAACTACGAGTGTATTTTCCACATCCCCGGGAGTGTGACTCGGGTCACTGCTTTGCGCTTCAACAGTACCAGCATCCAGTGCCAGAACACTTCGTATAACTATGAAGGCAATGATATCAGTGACCTACCTGTCAATTTATCTGTGGTCTGGAATGGGCACTTTGTCATAGACAACCCTCAAAACATTCAAGCTCATCTGTACGAGTGCTCGGCCCTAAGGAAAACTGCGGACTTTGCCTTAATCCGAACGTCGCTTGAGTGTGGNCTGTGCGTCAGTGAGAAAAGTGCACTCTGCGCCAGAA
  5   1   2      skin Emb1                            IMAGE:5156263.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACTGCTTTGCGCTTCAACAGTACCAGCATCCAGTGCCAGAACACTTCGTATAACTATGAAGGCAATGATATCAGTGACCTACCTGTCAATTTATCTGTGGTCTGGAATGGGCACTTTGTCATAGACAACCCTCAAAACATTCAAGCTCATCTGTACAAGTGCTCGGCCCTAAGGGAAAGCTGCGGACTTTGCCTTAAATCCGACCGTCGCTTTGAGTGTGGCTGGTGCGTCAGTGAGAAGAAGTGCACTCTGCGCCAGAATTGTCCCACCCTTGAAAACCCTTGGATGCATGCCAGTACCGCCAATAGTCGCTGCACTGACCCAAAGATCACCAAGCTTTTTCCAGAGACGGGCCCCAGGCAGGGTGGAACCCGACTGACCATCACAGGAGAAAATCTGGGCTTGAGGTTTGAGGACATTCGCTTTGGAGTGAGGGTTGGGCACGTCATGTGTGTCCCTGTCGAGAGCGAGTATATCAGCGCAGAGCAGATCGTTTGTGAGATTAACGATGCCGGAAGGACCCGTGTCCACGAGGCTCAAGTGGAGGTCTGTGTAAAAGACTGCTCTCAAGACTACAGGGCTATTTCTCCAAAGTCATTCACCTTTGTGTTACCCTCCTTTAACCGGGTCACCCCTTCCCGAGGTCCTTTGTCTGGTGGCACCTGGATATCCATTGAAGGAAACTATCTGAACGCTGGCAGNTGATGTTTCTGTGGCTAATTGGGGGGACGTCCCTGCATGTTTTCATGGCGAACTGCGAAAGAGATCCGCTGTAAGACTCCGCAGGGACCAAGCACGGGTAAAGCCGAAATACAAATCCTCATCAACGCGCCACGATGAACAACTCTGAAGTACATTACAATTTACACCGAAAGATCCAACCGTGGCAAAGATAGAACCCGA
  5   1   0       add DMZ       out                        xl284p18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAGCATCCAGCTGCCAGAACACTTCGTATAACTATGAAGGCAATGATATCAGTGACCTACCTGTCAATTTATCTGTGGTCTGGAATGGGCACTTTGTCATAGACAACCCTCAAAACATTCAAGCTCATCTGTACAAGTGCTCGGCCCTAAGGGAAAGCTGCGGACTTTGCCTTAAATCTGACCGTCGATTTGAGTGTGGCTGGTGCGTCAGTGAGAAGAAGTGCACTCTGCGCCAGAATTGTCCCACCCTTGAAAACCCTTGGATGCATGCCAGTACCGCCAATAGTCGCTGCACTGACCCAAAGATCACCAAGCTTTTTCCAGAGACAGGCCCCAGGCAGGGTGGAACCCGACTGACCATCACAGGAGAAAATCTGGGCTTGAGGTTCGAGGACATTCGCTTTGGAGTGAGGGTTGGGCACGTCATGTGTGTCCCTGTCGAGAGCGAGTATATCAGCGCAGAGCAGATCGTTTGTGAGATTAACGATGCCGGAAGGACCCGTGTCCACGAGGCTCAAGTGGAGGTCTGTGTAAAAGACTGCTCTCAAGACTACAGGGCTATTTCTCCAAAGTCATTCACCTTTGTGTTACCCTCCTTTAACCGGGTCACACCTTCCCGAGGTCCTTTGTCTGGTGGCAC
  5   1   0       add Lu1       out                   IMAGE:4057626.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGGCCCTAAGGGAAAGCTGCGGACTTTGCCTTAAATCCGACCGTCGCTTTGAGTGGGCTGGTGCGTCAGTGAGAAGAAGTGCACTCTGCGCCAGAATTGTCCCACCCTTGAAAACCCTTGGATGCATGCCAGTACCGCCAATAGTCGCTGCACTGACCCAAAGATCACCAAGCTGTTTCCAGAGACGGGCCCCAGGCAGGGTGGAACCCGACTGACCATCACAGGAGAAAATCTG
  5   1   2       bld Emb4                            IMAGE:5542680.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACCTTCCCGAGGTCCTTTGTCTGGTGGCACCTGGATATCCATTGAAGGAAACTATCTGAACGCTGGCAGTGATGTTTCTGTGGCTATTGGGGGACGTCCCTGCATGTTTTCATGGCGAACTGCGAAAGAGATCCGCTGTAAGACTCCGCAGGGACCAAGCACGGGTAAAGCCGAAATACAAATCCTCATCAACCGCGCCACGATGAACAACTCTGAAGTACATTACAATTACACCGAAGATCCAACCGTGCAAAAGATAGAACCAGAGTGGAGCATCGCCAGTGGGGGAACCCCTCTGATAGTAACTGGGATGAATCTGGCAACTATTAAAGAACCCAAAATAAGAGCTAAATACGGAGATGTGGAGAAAGAAAATAACTGCACTCTTTACAATGACACCACCATGGTGTGCTTGGCACCCTCCGTTGACAATCCCTTGAGGAGCCCTCCGGAGAATGGGGACCGTCCTGATGAGATAGGCTTCATAATGGACAATGTTCATGCCCTCCTTATTGTGAACACTACCAGCTTCCTTTATTACCCNNGGATCCTGTGTTTGAACCGCTGACGGCATCTGGAAACCTTGAGCTGAAGCCCAGCTCTCCTCTTATANNATCAAGGGTCGGAATCTCATTCCAGCAGCCCCAGGGAACTTCAGGCTTAATTTATACCAGTGGTTGATTTGGTGAACTCCCNGTGTGCCCTTACTGGTCTCCGAGACCCAGCTTCCTGGTGCGAGTCTCCNGAACCCTTACTGGGACAGCATAAAAGTTACTATTAAAAAGGCCCGGAAAGGGTTTTGGAGGTACTTCAACCGGGGC
  5   1   2      seed Emb1                   IMAGE:6633031-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGAACGCTGGCAGTGATGTTTCTGTGGCTATTGGGGGACGTCCCTGCATGTTTTCATGGCGAACTGCGAAAGAGATCCGCTGTAAGACTCCGCAGGGACCAAGCACGGGTAAAGCCGAAATACAAATCCTCATCAACCGCGCCACGATGAACAACTCTGAAGTACATTACAATTACACCGAAGATCCAACCGTGCAAAAGATAGAACCAGAGTGGAGCATCGCCAGTGGGGGAACCCCTCTGATAGTAACTGGGATGAATCTGGCAACTATTAAAGAACCCAAAATAAGAGCTAAATACGGAGATGTGGAGAAAGAAAATAACTGCACTCTTTACAATGACACCACCATGGTGTGCTTGGCACCCTCCGTTGACAATCCCTTGAGGAGCCCTCCGGAGAATGGGGACCGTCCTGATGAGATAGGCTTCATAATGGACAATGTTCATGCCCTCCTTATTGTGAACACTACCAGCTTCCTTTATTACCCGGATCCTGTGTTTGAACCGCTGACGGCATCTGGAAACCTTGAGCTGAAGCCCAGCTCTCCTCTTATAATCAAGGGTCGGAATCTCATTCCAGCAGCCCCAGGGAACTTCAGGCTTAATTATACAGTGTTGATTGGTGACACTCCGTGTGCCCTTACTGTCTCCGAGACCCAGCTCCTGTGCGAGTCTCCGAACCTTACTGGACA
  5   1   2       bld Emb1                            IMAGE:6633031.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGAACGCTGGCAGTGATGTTTCTGTGGCTATTGGGGGACGTCCCTGCATGTTTTCATGGCGAACTGCGAAAGAGATCCGCTGTAAGACTCCGCAGGGACCAAGCACGGGTAAAGCCGAAATACAAATCCTCATCAACCGCGCCACGATGAACAACTCTGAAGTACATTACAATTACACCGAAGATCCAACCGTGCAAAAGATAGAACCAGAGTGGAGCATCGCCAGTGGGGGAACCCCTCTGATAGTAACTGGGATGAATCTGGCAACTATTAAAGAACCCAAAATAAGAGCTAAATACGGAGATGTGGAGAAAGAAAATAACTGCACTCTTTACAATGACACCACCATGGTGTGCTTGGCACCCTCCGTTGACAATCCCTTGAGGAGCCCTCCGGAGAATGGGGACCGTCCTGATGAGATAGGCTTCATAATGGACAATGTTCATGCCCTCCTTATTGTGAACACTACCAGCTTCCTTTATTACCCGGATCCTGTGTTTGAACCGCTGACGGCATCTGGAAACCTTGAGCTGAAGCCCAGCTCTCCTCTTATAATCAAGGGTCGGAATCTCATTCCAGCAGCCCCAGGGAACTTCAGGCTTAATTATACAGTGTTGATTGGTGACACTCCGTGTGCCCTTACTGTCTCCGAGACCCAGCTCCTGTGCGAGTCTCCGAACCTTACTGGACAGCATAAAGTTACTATTAAAGCCGGNAGGGTTTGAGTACTCACCGGGGCACACTGGCAGATTTACTCGGGACAGCCCTGGCTGACCCTTGCCTGCCATTATTGGGCATTTGAAGGNAAGAAAGGGGGGNTTTGCCTGGTTGGCTCCATTTAA
  5   1   2       bld Spl                             IMAGE:8460692.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGGGATGAATCTGGCAACTATTAAAGAACCCAAAATAAGAGCTAAATACGGAGATGTGGAGAAAGAAAATAACTGCACTCTTTACAATGACACCACCATGGTGTGCTTGGCACCCTCCGTTGACAATCCCTTGAGGAGCCCTCCGGAGAATGGGGACCGTCCTGATGAGATAGGCTTCATAATGGACAATGTTCATGCCCTCCTTATTGTGAACACTACCAGCTTCCTTTATTACCCGGATCCTGTGTTTGAACCGCTGACGGCATCTGGAAACCTTGAGCTGAAGCCCAGCTCTCCTCTTATAATCAAGGGTCGGAATCTCATTCCAGCAGCCCCAGGGAACTTCAGGCTTAATTATACAGTGTTGATTGGTGACACTCCGTGTGCCCTTACTGTCTCCGAGACCCAGCTCCTGTGCGAGTCTCCGAACCTTACTGGACAGCATAAAGTTACTATTAAAGCCGGAGGGTTTGAGTACTCACCGGGCACACTGCAGATTTACTCGGACAGCCTGCTGACCTTGCCTGCCATTATTGGCATTGGAGGAGGAGGGGGTTTGCTGTTGCTCATTATAATCATCGTGCTTATTGCCTACAAGAGGAAATCGCGGGATGCCGACCGCACCCTGAAACGACTGCAGCTGCAAATGGACAATCTGGAGTCCCGTGTGGCACTGGAGTGCAAAGAGCCTTTGCAGACTGCAGACTGACATCACGAGCTGACCACGACCTGACNGGGCTGGATTCCTTNNCTGATACGTACTACGCATGCGAGTCTTTCCCCGATAGGATCTCTGTCTGAAGAATGAGTACAGCACTGAGAATCTGA
  5   1   2       bld Emb1                            IMAGE:5156055.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCACGCGTCCGCCCTCCGTTGACAATCCCTTGAGGAGCCCTCCGGAGAATGGGGACCGTCCTGATGAGATAGGCTTCATAATGGACAATGTTCATGCCCTCCTTATTGTGAACACTACCAGCTTCCTTTATTACCCGGATCCTGTGTTTGAACCGCTGACGGCATCTGGAAACCTTGAGCTGAAGCCCAGCTCTCCTCTTATAATCAAGGGTCGGAATCTCATTCCAGCAGCCCCAGGGAACTTCAGGCTTAATTATACAGTGTTGATTGGTGACACTCCGTGTGCCCTTACTGTCTCCGAGACCCAGCTCCTGTGCGAGTCTCCGAACCTTACTGGACAGCATAAAGTTACTATTAAAGCCGGAGGGTTTGAGTACTCACCGGGCACACTGCAGATTTACTCGGACAGCCTGCTGACCTTGCCTGCCATTATTGGCATTGGAGGAGGAGGGGGTTTGCTGTTGCTCATTATAATCATCGTGCTTATTGCCTACAAGAGGAAATCGCGGGATGCCGACCGCACCCTGAAACGACTGCAGCTGCAAATGGACAATCTGGAGTCCCGTGTGGCACTGGAGTGCAAAGAAGCCTTTGCAGAGCTGCAGACTGACATCCACGAGCTGACCAACGACCTTGACGGGGCTGGAATTCCTTTCCTGGAGTACCGTACTTACGCCATGCGAGTCCTTTTCCCTGGGATAGAAGATCATCCTGTCCCTGAAGAAATGGAAGTACAAAGCCAACGTGGGAGAAAATCCCTGAACGCTTTTTTGGGCCAAGCTCCCTCCCCCAAGAAAAGCACCTTTCCCTTGTTGGAACCTTTCATA
  5   1   2       bld Emb1                            IMAGE:5156077.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTACGCGTCCGCCCTCCGTTGACAATCCCTTGAGGAGCCCTCCGGAGAATGGGGACCGTCCTGATGAGATAGGCTTCATAATGGACAATGTTCATGCCCTCCTTATTGTGAACACTACCAGCTTCCTTTATTACCCGGATCCTGTGTTTGAACCGCTGACGGCATCTGGAAACCTTGAGCTGAAGCCCAGCTCTCCTCTTATAATCAAGGGTCGGAATCTCATTCCAGCAGCCCCAGGGAACTTCAGGCTTAATTATACAGTGTTGATTGGTGACACTCCGTGTGCCCTTACTGTCTCCGAGACCCAGCTCCTGTGCGAGTCTCCGAACCTTACTGGACAGCATAAAGTTACTATTAAAGCCGGAGGGTTTGAGTACTCACCGGGCACACTGCAGATTTACTCGGACAGCCTGCTGACCTTGCCTGCCATTATTGGCATTGAAGGAGGAGGGGGTTTGCTGTTGCTCATTATAATCATCGTGCTTATTGCCCAACAGAAGAAATCGCGGGGATGCCGGACCGCTACCCCTGAAACGAACTGCCAGCTTGCAAAAGGGACAATCCGGGAACTTCCCGTGGTGGGCCACTGGAAAGTGGCAAGAAAAAAGCCCCTTTTTAAAAAACCCTTGCATGAACTGGACCATTCCCCCCAAATCTTTGAACCCCAACTGATCCCTTTTGGCCCCAGGGGGTCCTGGAGAACATTTCCATTTTCCCCTGGGAAGATCCACCCGTTAACTTTATCGCCCCAATGTCGCAAAATTCCACTTTTTTCCCCCTGTGGGGATACAGCAAACAAAATCCATCCCGCTGTTCCCCCGCGAAAGGCAACCAATGGCAAGGGTCTCACCAGAACTCCAGCGTATGTGGGAGAAATATTTCCCTCATGCAACCCACCTCTTCTTGTGGGGGCAAGAATTTCCCTTCGACTCGAGAAAGGAAGCCACCTCTCTCCCTTGGGGTGAGAACACCTCTGATATTATCTCGCCATACCCCTCTCCCAAAGG
  5   1   2       bld DMZ       out                        xl317b04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTCCTGATGAGATAGGCTTCATAATGGACAATGTTCATGCCCTCCTTATTGTGAACACTACCAGCTTCCTTTATTACCCGGATCCTGTGTTTGAACCGCTGACGGCATCTGGAAACCTTGAGCTGAAGCCCAGCTCTCCTCTTATAATCAAGGGTCGGAATCTCATTCCAGCAGCCCCAGGGAACTTCAGGCTTAATTATACAGTGTTGATTGGTGACACTCCGTGTGCCCTTACTGTCTCCGAGACCCAGCTCCTGTGCGAGTCTCCGAACCTTACTGGACAGCATAAAGTTACTATTAAAGCCGGAGGGTTTGAGTACTCACCGGGCACACTGCAGATTTACTCGGACAGCCTGCTGACCTTGCCTGCCATTATTGGCATTGGAGGAGGAGGGGGTTTGCTGTTGCTCATTATAATCATCGTGCTTATTGCCTACAAGAGGAAATCACGGGATGCCGACCGCACCCTGAAACGACTGCAGCTGCAAATGGACAATCTGGAGTCCCGTGTGGCACTGGAGTGCAAAGAAGCCTTTGCAGAGCTGCAGACTGACATCCACGAGCTGACCAACGACCTTGACGGGGCTGGAATTCCTTTCCTGGAGTACCGTACTTACGCCATGCGAGTCCTTTTCCCCGGG
  5   1   2       bld Tbd7      out                        XL096i22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCAGGNAATTCGGCACGAGGGTGCTTATTGCCTACAAGNAGGAAATCGCGGGATGCCGACCGCACCCTGAAACGACTGCAGCTGCAAATGGACAATCTGGAGTCCCGTGTGGCACTGGAGTGCAAAGAAGCCTTTGCAGAGCTGCAGACTGACATCCACGAGCTGACCAACGACCTTGACGGGGCTGGAATTCCTTTCCTGGAGTACCGTACTTACGCCATGCGAGTCCTTTTCCCCGGGATAGAAGATCATCCTGTCCTGAAAGAAATGGAGGTACAAGCCAACGTGGAGAAATCCCTGACGCTTTTTGGGCAGCTCCTCACCAAGAAGCACTTCCTGTTGACCTTCATTCGGACGCTGGAGGCCCAGAGGAGCTTCTCCATGAGAGACAGGGGTAACGTGGCTTCGCTCATCATGACGGCGTTGCAGGGGGAGATGGAATACGCCACTGGCGTTCTCAAGCAGCTTCTCTCCGACCTCATTGAGAAGAATCTTGAAAGCAAAAACCACCCTAAGCTGCTGCTGAGGAGGACAGAGTCTGTGGCTGAGAAGATGCTGACAAACTGGTTTACGTTCCTCCTCTACAAGTTCTTAAAGGAATGTGCTGGGGAGCCGCTCTTCATGTTGCACTGTGCCATCAAGCAACAGATGGAGAAAGGACCTATTGATGCCATCACTGGAGAAGCCCGCTACTCACTGAGCGAGGACAAGCTGATCCGTCAGCAGAT
  5   1   2       bld DMZ       out                        xl249a08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGTGCTTATTGCCTACAAGAGGAAATCGCGGGATGCCGACCGCACCCTGAAACGACTGCAGCTGCAAATGGACAATCTGGAGTCCCGTGTGGCACTGGAGTGCAAAGAAGCCTTTGCAGAGCTGCAGACTGACATCCACGAGCTGACCAACGACCTTGACGGGGCTGGAATTCCTTTCCTGGAGTACCGTACTTACGCCATGCGAGTCCTTTTCCCCGGAATAGAAGATCATCCTGTCCTGAAAGAAATGGAGGTACAAGCCAACGTGGAGAAATCCCTGACGCTTTTTGGGCAGCTCCTCACCAAGAAGCACTTCCTGTTGACCTTCATTCGGACGCTGGAGGCCCAGAGGAGCTTCTCCATGAGAGACAGGGGTAACGTGGCTTCGCTCATCATGACGGCGTTGCAGGGGGAGATGGAATACGCCACCGGCGTTCTCAAGCAGCTTCTCTCCGACCTCATTGAGAAGAATCTTGAAAGCAAAAACCACCCTAAGCTGCTGCTGAGGAGGACAGAGTCTGTGGCTGAGAAGATGCTGACAAACTGGTTTACGTTCCTCCTCTACAAGTTCTTAAAGGAATGTGCTGGGGAGCCGCTCTTCATGTTGCACTGTGCCATCAAGCAACAGATGGAGAAAGGACCTATTGATGCCATCACTGGAGAAGCCCGCTACTCACTGAGCGAGGACAAGCTGATCCGTCAGCAGATCGACTACAAGACACTGACCCTGAACTGTGTGAAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)