Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 78%

 1012777908 Xl3.1-XL194i13.3 - 16 ESTs
                                                                       .....-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL194i13.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAGTACTATACGACGAACATGAGTGGAGGACTAGCGCCCAGTAAAAGCACAGTGTATGTGTCAAATCTTCCCTTTTCACTAACCAATAATGATTTACACCGGATTTTTTCAAAATATGGAAAAGTAGTCAAAGTCACTATATTGAAGGACAAAGATTCTCGAAAGAGCAAAGGAGTCTCATTTGTGTTATTTCTAGATAAGGAATCTGCACAGAACTGTGTTAGAGGCTTAAACAACAAACAATTGTTTGGCAGAGCAATTAAAGCAAGCATTGCTAAAGACAACGGCAGAGCAACAGAATTCATCCGGAGGCGGAATTACACAGATAAGTCCAGATGTTATGAGTGCGGGGACACTGGACACTTGAGTTATGCATGTCCCAAAAACATGCTAGGTGAACGGGAACCACCTCAAAAAAAAGAAAAAAAGAAAAGAAAAAGGCTTGTTGAAGAAGAAGAAGAAGAAGTTGTGGAAGAGGAAGAAAGTGAAGATGAAGGAGAAGACCCAGCTCTGGATAGCCTTAGCCAGGCCATAGCTTTTCAGCAAGCAAGAATTGATGAAGAGAAAAACAAATACAGACATGATCCAGCTGAAGCTTCTACTTCAGAAGATTCAAGACGTCCTAGAATTAAGAAAAGTACCTACTTTAGCGATGAAGATGAACTCAGCGACTGAACACTGACTTTATTTCATTAAATTCGGGAATAGTTCAATTCTCCTGTTGGAATATTTGACTATATACAGTGAATGTAGAATAATAATCATATATCATAATTCTAAACCTAAATTTTTAATATCCGTATAACATTTCCACTGGAAACAAGCTTTTGTTTTGTACATAATATAATTTACTAGTAGGAATTGAATATATAAAAAAACTTGTTTTAAAACAAAATATGTAGCATTTATAAAGCATCAGTTATGGTAATAATTACAGGCTGAGGAGCACTCAACAATCACACGTGTTGGCATTTCTTGGTACAGATGATAACGAAG
                                                  Xl3.1-CHK-1012691448                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TATACGACGAACATGAGTGGAGGACTAGCGCCCAGTAAAAGCACAGTGTATGTGTCAAATCTTCCCTTTTCACTAACCAATAATGATTTACACCGGATTTTTTCAAAATATGGAAAAGTAGTCAAAGTCACTATATTGAAGGACAAAGATTCTCGAAAGAGCAAAGGAGTCTCATTTGTGTTATTTCTAGATAAGGAATCTGCACAGAACTGTGTTAGAGGCTTAAACAACAAACAATTGTTTGGCAGAGCAATTAAAGCAAGCATTGCTAAAGACAACGGCAGAGCAACAGAATTCATCCGGAGGCGGAATTACACAGATAAGTCCAGATGTTATGAGTGCGGGGACACTGGACACTTGAGTTATGCATGTCCCAAAAACATGCTAGGTGAACGGGAACCACCTCAAAAAAAAGAAAAAAAGAAAAGAAAAAGGCTTGTTGAAGAAGAAGAAGAAGAAGTTGTGGAAGAGGAAGAAAGTGAAGATGAAGGAGAAGACCCAGCTCTGGATAGCCTTAGCCAGGCCATAGCTTTTCAGCAAGCAAGAATTGATGAAGAGAAAAACAAATACAGACATGATCCAGCTGAAGCTTCTACTTCAGAAGATTCAAGACGTCCTAGAATTAAGAAAAGTACCTACTTTAGCGATGAAGATGAACTCAGCGACTGAACACTGACTTTATTTCATTAAATTCGGGAATAGTTCAATTCTCCTGTTGGAATATTTGACTATATACAGTGAATGTAGAATAATAATCATATATCATAATTCTAAACCTAAATTTTTAATATCCGTATAACATTTCCACTGGAAACAAGCTTTTGTTTTGTACATAATATAATTTACTAGTAGGAATTGAATATATAAAAAAACTTGTTTTAAAACAAAATATGTAGCATTTATAAAGCATCAGTTATGGTAATAATTACAGGCTGAGGAGCACTCAACAATCACACGTGTTGGCATTTCTTGGTACAGATGATAACGAAGCTTATG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       2     2     2     4     3     7     6     9     7    10     9    11     9    11    10    12    10    12    10    13    10    13    13    13    12    13    13    13    13    13    13    13    12    13    12    12    11    12    11    12    12    12    10    12    10    12    10    12    10    12    10    12    10    12    10    12    10    12     8    12     8    12     8    12     8    12     8    12     8    13     5    11     5    10     6     9     6    10     5     9     3     9     4     9     4     9     3     8     4     8     3     7     3     7     3     7     2     6     2     6     3     6     3     6     3     6     2     6     4     7     3     7     4     7     4     7     3     6     3     6     3     6     3     6     3     5     3     5     3     5     3     5     2     4     3     4     3     4     3     4     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----A------
                                               BLH ATG      18     157                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               BLH MIN      18     111                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               BLH OVR      18      33                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               EST CLI      23      13                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               ORF LNG      18       1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Ce ---- 3e-009     NP_495014.1 serine/aRginine rich pre-mRNA SPlicing factor, Serpin (rsp-4) [Caenorhabditis elegans] ==============================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 8e-011     NP_727165.2 CG18350-PA, isoform A [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Os ---- 3e-048     NP_001063859.1 Os09g0549500 [Oryza sativa (japonica cultivar-group)] -----------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- At ---- 8e-052     NP_187651.1 RNA recognition motif (RRM)-containing protein [Arabidopsis thaliana] -------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Ci ==== 1e-056     FAA00151.1 TPA: zinc finger protein [Ciona intestinalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED = Dr ==== 5e-064     NP_001017589.1 hypothetical protein LOC550251 [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED = Sp ==== 2e-073     XP_001188422.1 PREDICTED: similar to Zinc finger CCHC-type and RNA binding motif 1 [Strongylocentrotus purpuratus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Mm ==== 4e-099     NP_080301.1 MADP-1 protein [Mus musculus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED = Gg ==== 3e-099     XP_416034.1 PREDICTED: similar to MADP-1 protein; U11/U12 snRNP 31K [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED = Cf ==== 1e-099     XP_534835.1 PREDICTED: similar to MADP-1 protein [Canis familiaris] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Hs ==== 4e-100     NP_149105.3 MADP-1 protein [Homo sapiens] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Bt ==== 2e-100     NP_001020489.1 MADP-1 protein [Bos taurus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xt ==== 4e-113     NP_001107973.1 zinc finger CCHC-type and RNA binding motif 1 [Xenopus tropicalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xl ==== 2e-122     NP_001086476.1 MGC82154 protein [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-XL194i13.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAG---------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------TAA---------TAG------------------------------------TGAATGTAG------------------TAA---TAA---TAA------------------------------------------------------------------TAGTAG------------TAA------------TAA---------------------------------ATG---------------TGA------------------------------------------ATG------------ATG------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
  5   1   2       bld Kid  5x3                        IMAGE:7012473.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATAAATTGCTAGTACTATACGACGAACATGAGTGGAGGACTAGCGCCCAGTAAAAGCACAGTGTATGTGTCAAATCTTCCCTTTTCACTAACCAATAATGATTTACACCGGATTTTTTCAAAATATGGAAAAGTAGTCAAAGTCACTATATTGAAGGACAAAGATTCTCGAAAGAGCAAAGGAGTCTCATTTGTGTTATTTCTAGATAAGGAATCTGCACAGAACTGTGTTAGAGGCTTAAACAACAAACAATTGTTTGGCAGAGCAATTAAAGCAAGCATTGCTAAAGACAACGGCAGAGCAACAGAATTCATCCGGAGGCGGAATTACACAGATAAATCCAGATGTTATGAGTGCGGGGACACTGGACACTTGAGTTATGCATGTCCCAAAAACATGCTAGGTGAACGGGAACCACCTCaaaaaaaagaaaaaaagaaaagaaaaaggcttgttgaagaagaagaagaagaagttgtggaagaggaagaaagtgaagatgaaggagaagACCCAGCTCTGGATAGCCTTAGCCAGGCCATAGCTTTTCAGCAAGCAAGAATTGATGAAGAGAAAAACAAATACAGACATGATCCAGCTGAAGCTTCTACTTCAGAAGATTCAAGACGTCCTAGAATTAAGAAAAGTACCTACTTTAGCGATGAAGATGAACTCAGCGACTGAACACTGACTTTATTTCATTAATTCGGGAATAGTTCATTTCTCTGNTGGAATATTGACTATATACGTAATGTAAA
  5   1   2       bld Ga18 5x3                          xlk133h07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAGTACTATACGACGAACATGAGTGGAGGACTAGCGCCCAGTAAAAGCACAGTGTATGTGTCAAATCTTCCCTTTTCACTAACCAATAATGATTTACACCGGATTTTTTCAAAATATGGAAAAGTAGTCAAAGTCACTATATTGAAGGACAAAGATTCTCGAAAGAGCAAAGGAGTCTCATTTGTGTTATTTCTAGATAAGGAATCTGCACAGAACTGTGTTAGAGGCTTAAACAACAAACAATTGTTTGGCANNNNNTTAAAGCAAGCATTGCTAAAGACAACGGCAGNNNACAGAATTCATCCGGNGCGGAATTACACAGATAAATCCAGATGTTATGAGTGCGGGGACACTGGACACTTGAGTTATGCATGTCCCAAAAACATGCTAGGTGAACGGGAACCACCTCaaaaaaaaagaaaaaaagaaaagaaaaaggcttgttgaagaagaagaagaagaagttgtggaagaggaagaaagtgaagatgaaggagaagaCCCAGCTCTGGATAGCCTTAGCCAGGCCATAGCTTTTCAGCAAGCAAGAATTGATGAAGAGAAAAACAAATACAGACATGATCCAGCTGAAGCTTCTACTTCAGAAGATTCAAGACGTCCTAGAATTAAGAAAAGTACCTACTTTAGCGATGAAGATGAACTCAGCGACTGAACACTGACTTTATTTCATTAAATTCGGGAA
  5   1   2       chi DMZ                                  xl302a06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCAATGGGACAGAAGTATAAATTGCTAGTACTATACGACGAACATGAGTGGAGGACTAGCGCCCAGTAAAAGCACAGTGTATGTGTCAAATCTTCCCTTTTCACTAACCAATAATGATTTACACCGGAGTCACTATATTGAAGGACAAAGATTCTCGAAAGAGCAAAGGAGTCTCATTTGTGTTATTTCTAGATAAGGAATCTGCACAGAACTGTGTTAGAGGCTTAAACAACAAACAATTGTTTGGCAGAGCAATTAAAGCAAGCATTGCTAAAGACAACGGCAGAGCAACAGAATTCATCCGGAGGCGGAATTACACAGATAAGTCCAGATGTTATGAGTGCGGGGTAAATTAAGGAAATACTCTGGATTTTAGAGGGACTGTTTATGCCATTAACtttttttttttttttNCTTNGGCTTTNCGGGGTNAAGGGGGTTNCAG
  5   1   2       chi DMZ                                  xl339k08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCAATGGGACAGAAGTATAAATTGCTAGTACTATACGACGAACATGAGTGGAGGACTAGCGCCCAGTAAAAGCACAGTGTATGTGTCAAATCTTCCCTTTTCACTAACCANTAATGATTTACACCGGAGTCACTATATTGAAGGACAAAGATTCTCGAAAGAGCAAAGGAGTCTCATTTGTGTTATTTCTAGATAAGGAATCTGCACAGAACTGTGTTAGAGGCTTAAACAACAAACAATTGTTTGGCAGAGCAATTAAAGCAAGCATTGCTAAAGACAACGGCNGAGCAACAGAATTCATCCGGAGGCGGAATTACACAGATAAGTCCAGATGTTATGAGTGCGGGGTAAATTAAGGAAATACTCTGGATTTTAGAGGGACTGTTTATGCCATTAACttttttttttttttNACTTNG
  5   1   2       bld Ga18      in                        xlk1n07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACGAACATGAGTGGAGNNTNGCGCCCAGTAAAAGCACAGTGTATGTGTCAAATCTTCCCTTTTCACTAACCAATAATGATTTACACCGGATTTTTTCAAAATATGGAAAAGTAGTCAAAGTCACTATATTGAAGGACAAAGATTCTCGAAAGANCAAAGGAGTCTCATTTGTGTTATTTCTAGATAAGGAATCTGCACAGAACTGTGTTAGAGGCTTAAACAACAAACAATTGTTTGGCAGANNATTAAAGCAAGCATTGCTAAAGACAACGGCAGANNACAGAATTCATCCGGAGCGGAATTACACAGATAAATCCAGATGTTATGAGTGCGGGGACACTGGACACTTGAGTTATGCATGTCCCAAAAACATGCTAGGTGAACGGGAACCACCTCaaaaaaaagaaaaaaagaaaagaaaaaggcttgttgaagaagaagaagaagaagttgtggaagaggaagaaagtgaagatgaagGAGAAGACCCAGCTCTGGATAGCCTTAGCCAGGNCATAGCTTTTCAGCAAGCAAGAATTGATGAAGAGAAAAACAAATACAGACATGATCCAGCTGAAGCTTCTACTTCAGAAGATTCAAGACGTCCTAGAATTAAGAAAAGTACCTACTTTAGCGATGAAGATGAACTCAGCGACTGAACACTGACTTTATTTCATTAAATTCGGGAATAGTTCAATTCTCCTGTTGGAATATTTGACTATATACAGNGAATGTAGAATAATAATCATATATCATAATTCTAAACCTAAATTTTTAATA
  5   1   2       bld Egg1                               PBX0077D05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACGAGGCTAGCGCCCAGTAAAAGCACAGTGTATGTGTCAAATCTTCCCTTTTCACTAACCAATAATGATTTACACCGGATTTTTTCAAAATATGGAAAAGTAGTCAAAGTCACTATATTGAAGGACAAAGATTCTCGAAAGAGCAAAGGAGTCTCATTTGTGTTATTTCTAGATAAGGAATCTGCACAGAACTGTGTTAGAGGCTTAAACAACAAACAATTGTTTGGCAGAGCAATTAAAGCAAGCATTGCTAAAGACAACGGCAGAGCAACAGAATTCATCCGGAGGCGGAATTACACAGATAAGTCCAGATGTTATGAGTGCGGGGACACTGGACACTTGAGTTATGCATGTCCCAAAAACATGCTAGGTGAACGGGAACCACCTCaaaaaaaagaaaaaaagaaaagaaaaaggcttgttgaagaagaagaagaagaagttgtggaagaggaagaaagtgaagatgaaggagaagACCCAGCTCTGGATAGCCTTA
  5   1   2       bld Ga12      in                         XL194i13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAAGGACTAGCGCCCAGTAAAAGCACAGTGTATGTGTCAAATCTTCCCTTTTCACTAACCAATAATGATTTACACCGGATTTTTTCAAAATATGGAAAAGTAGTCAAAGTCACTATATTGAAGGACAAAGATTCTCGAAAGAGCAAAGGAGTCTCATTTGTGTTATTTCTAGATAAGGAATCTGCACA
  5   1   2       bld Egg1                               PBX0048F03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCGCCCAGTAAAAGCACAGTGTATGTGTCAAATCTTCCCTTTTCACTAACCAATAATGATTTACACCGGATTTTTTCAAAATATGGAAAAGTAGTCAAAGTCACTATATTGAAGGACAAAGATTCTCGAAAGAGCAAAGGAGTCTCATTTGTGTTATTTCTAGATAAGGAATCTGCACAGAACTGTGTTAGAGGCTTAAACAACAAACAATTGTTTGGCAGAGCAATTAAAGCAAGCATTGCTAAAGACAACGGCAGAGCAACAGAATTCATCCGGAGGCGGAATTACACAGATAAGTCCAGATGTTATGAGTGCGGGGACACTGGACACTTGAGTTATGCATGTCCCAAAAACATGCTAGGTGAACGGGAACCACCTCaaaaaaaaagaaaaaaagaaaagaaaaaggcttgttgaagaagaagaagaagaagTTGTGGA
  5   1   2       bld Egg1                               PBX0111A07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCCCAGTAATAAGCACATGCGCTGTGTCAAATCTTCCCTTTTCACTAACCAATAATGATTTACACCGGATTTTTTCAAAATATGGAAAAGTAGTCAAAGTCACTATATTGAAGGACAAAGATTCTCGAAAGAGCAAAGGAGTCTCATTTGTGTTATTTCTAGATAAGGAATCTGCACAGAACTGTGTTAGAGGCTTAAACAACAAACAATTGTTTGGCAGAGCAATTAAAGCAAGCATTGCTAAAGACAACGGCAGAGCAACAGAATTCATCCGGAGGCGGAATTACACAGATAAATCCAGATGTTATGAGTGCGGGGACACTGGACACTTGAGTTATGCATGTCCCAAAAACATGCTAGGTGAACGGGAACCACCTCaaaaaaaagaaaaaaagaaaagaaaaaggcttgttgaagaagaagaagaagaagttgtggaagaggaagaaagtgaagatgaaggagaagaCCCAACTCTGGATAGCCTTAGCCAGGCCATAGCTTTTCAGCAA
  5   1   2       bld Egg4      in                    IMAGE:3744060.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGTGAAAGCACAGTGTATGTGTCAAATCTTAACTTTTCACTAACCATTAATGATTTACACCGGATTTTTTCAAACTATGGAAAAGTTGTCAAAGTCACTATATTGAAGGACAAAAATTCTCGAAAGAGCAAAGGAGTCTCATTGGTGTTATTACTATATAAAGAATCCGCACAGAACTGTGTGGGAGGCTATAACATCATACAATTGTTTGGCAGAACAGATAAAGCAAGCATTGCTAAAGACAACGGCAGAGCAACAGAATTCATCCGGAGGCGGAATTACACAGATAAATCCAGATGTTATGAGTGCGGGGACACTGGACACTTGAGTTATGCATGTCCCAAAAACATGCTAAGTGAACGGGAACCACCTCaaaaaaaagaaaagaaaaaa
  3   1   2       bld Egg4      in                    IMAGE:3744060.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGTGTCAAATCTTCCCTTTTCACTAACCAATAATGATTTACACCGGATTTTTTCTAAATATGGAAAAGTAGTCAAAGTCACTATATTGAAGGACAAAGATTCTCGAAAGAGCAAAGGAGTCTCATTTGTGTTATTTCTAGATAAGGAATCTGCACAGAACTGTGTTAGAGGCTTAAACAACAAACAATTGTTTGGCAGAGCAATTAAAGCAAGCATTGCTAAAGACAACGGCAGAGCAACAGAATTCATCCGGAGGCGGAATTACACAGATAAATCCAGATGTTATGAGTGCGGGGACACTGGACACTTGAGTTATGCATGTCCCAAAAACATGCTAGGTGAACGGGAACCACATCAAAAAAAAGAAAA
  5   1   2       add Ga12      in                         XL194h07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTCACTAACCAATAATGATTTACNCCGGATTTTTTCAAAATATGGAAAAGTAGTCNAAGTCACTATATTGAAGGACAAACACTCTCGAAAGAGCAAAGGAGTCTCATTTGTGTTATTTCTANATAAGGAATCTGCACAGAACTGTGTTANAGGCTTAAACGACAAACAATTGTTTGGCAGAGCAATTAAAGCAAGCATTGCTAAAGACAACGGCAGAGCAACAGAATTCATCCGGAGGCGGAATTACACAGATAAGTCCAGATGTTATGAGTGCGGGGACACTGGACACTTGAGTTATGCATGTCCCAAAAACATGCTAGGTGAACGGGAACCACCTCaaaaaaaagaaanaaataaaagaaaaaggcttgttgaanaagaagaagaagaagaagttgtggaagaggaagaaagtgaagatgaaggagaagaCCCAGCTCTGGATAGCCTTAGCCAGGCCATAGCTTNTCAGCAAGCAAGAATTGATGAAGAGAAAAACAAATACC
  3   1   2      seed Ga12      in                         XL194i13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTCAAAATATGGAAAAGTAGTCAAAGTCACTATATTGAAGGACAAAGATTCTCGAAAGAGCAAAGGAGTCTCATTTGTGTTATTTCTAGATAAGGAATCTGCACAGAACTGTGTTAGAGGCTTAAACAACAAACAATTGTTTGGCAGAGCAATTAAAGCAAGCATTGCTAAAGACAACGGCAGAGCAACAGAATTCATCCGGAGGCGGAATTACACAGATAAGTCCAGATGTTATGAGTGCGGGGACACTGGACACTTGAGTTATGCATGTCCCAAAAACATGCTAGGTGAACGGGAACCACCTCAAAAAAAAGAAAAAAAGAAAAGAAAAAGGCTTGTTGAAGAAGAAGAAGAAGAAGAAGTTGTGGAAGAGGAAGAAAGTGAAGATGAAGGAGAAGACCCAGCTCTGGATAGCCTTAGCCAGGCCATAGCTTTTCAGCAAGCAAGAATTGATGAAGAGAAAAACAAATACAGACATGATCCAGCTGAAGCTTCTACTTCAGAAGATTCAAGACGTCCTAGAATTAAGAAAAGTACCTACTTTAGCGATGAAGATGAACTCAGCGACTGAACACTGACTTTATTTCATTAAATTCGGGAATAGTTCAATTCTCCTGTTGGAATATTTGACTATATACAGTGAATGTAGAATAATAATCATATATCATAATTCTAAACCTAAATTTTTAATATCCGTATAACATTTCCACTGGAAACAAGCTTTTGTTTTGTACCATAATATAATTTACTAGCAGGAATTGAATATAAAAA
  3   1   2       add Ga12      in                         XL194h07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCAAAAAAAAGAAAAAAAGAAAAGAAAAAGGCTTGTTGAAGAAGAAGAAGAAGAAGAAGTTGTGGAAGAGGAAGAnAGTNAAGATGAAGGAGAAGACCCAGCTCTGGATANCCTTAGCCAGGCCATAGCTTTTCAGCAAGCAAGAATTGATGAAGAGAAAAACAAATACAGNCATGATCCAGNTGAAGNTTCTACTTCAGAAGATTCAAGACGTCCTAGAATTAAGAAAAGTACCTANTTTAGCGATGAAGATGAACTCAGCGANTGAACACTGACTTTATTTCATTAAATTCGGGAATAGTTCAATTCTCCNGTTGGAATATTTGACTATATACAGTGAATGTAGAATAATAATCATATATCATAATTCTAAACCTAAATTTTTAATANCCGTATAACATTTCCGCTGGANACAAGCTTTTGTTTTGTACATAATA
  3   1   1       add Ga18      in                        xlk1n07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GANGANGAAGAAGNTGTGGAAGAGGAAGAANGTNNAGATGANNNAGAAGNCCCANCTCTGNATANCCTTANNNNGGCCATANCTTTTCAGNAAGCAAGAATTGATGAAGAGAAAAACANATACAGACATGATNCANCTGAAGCTTCTACTTCAGNAGATTCAAGNCGTCCTAGAATTAAGAAAAGTNCCTACTTTAGCGATGAAGATGAACTCAGCGNCTGAACACTGNCTTTATTTCATTAAATTCGGGAATAGTTCAATTCTCCTGTTGGAATATTTGACTATATACAGTGAATGTAGAATAATAATCATATATCATANTTCTAAACCTAAATTTTTNATATCCGTATAACATTTCCACTGGAAACAAGCTTTTGTTTTGTACATAATATAATTTACTAGCAGGAATTGAATATATAAAAAAACTTGTTTTAAAACAAAATATGTAGCATTTATAAAGCATCAGTTATGGTAATAATTACAGGCTGAGGAGCACTCAACAATCACACGTGTTGGCATTTCTTGGTACAGATGATAACGAAGCTTATGCCANCANAGGGTCNATATATGCTNTNNNAGGGC
  3   1   1       add Egg1                            IMAGE:4678007.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTAGCGATGAAGATGAACTCAGCGACTGAACACTGACTTTATTTCATTAAATTCGGGAATAGTTCAATTCTCCTGTTGGAATATTTGACTATATACAGTGAATGTAGAATAATAATCATATATCATAATTCTAAACCTAAATTTTTAATATCCGTATAACATTTCCACTGGAAACAAGCTTTTGTTTTGTACATAATATAATTTACTAGTAGGAATTGAATATATAAAAAAACTTGTTTTAAAACAAAATATGTAGCATTTATAAAGCATCAGTTATGGTAATAATTACAGGCTGAGGAGCACTCAACAATCACACGTGTTGGCATTTCTTGGTACAGATGATAACGAAGCTTATGCCATCAAAGGGTCAATATATGCTGTTTTAGGGCTGCCATGTGTAAAGGTTTTAATCTGCAATATTTTTCAGGTTTGTATGCAAACAGTGTTTTACGGTGTGCTGACAGATGCAAATTTATGTAATGAATGTAACTTTATAGAATAGGCCAATATCCTTGTATTGATACCATTCAATGCATTTGTGTATAAAGTATTTTTGTTTTTTTTAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)