Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:7011866.5                       8 END     1           7       12                (no blast hit)

 This cluster: approximate FL confidence score = 95%

 1012777917 Xl3.1-IMAGE:6859100.5 - 13 ESTs
                                                                       ......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6859100.5                                                                                                                                                                                                                                                                                                                                                                               GGCGTCTCACTGTGTTACACCAGCGCTCGGGGAGGAGTCAGACCGACGCCCTTGTCGCGCCACTTCCTGGTACCGCCGGTGTCAGTGACAGAGAGGAGCAAGATGGCGGCGGCAGCAGCATCAGACTCCCGGGAGAGGACTGAGCGGAGGAGAAGGTGTCAGTGTCGCGGGGCAGGGCTGCTGTTTGTGTCCCTAGTGTTACTGGCGGTGCCTCGGGGTGTGAGGAGCTCAGAGGTCTCGTCTGACACTTCAGTCACATCTGTCACTTCCACTGACTGGTCTCAAGTGCTGCGCGGACACTCGATGATTCTATTTTATGCTCCGTGGTGTCCAGCCTGCCAGCAAATTCAGTCGGCGTGGGAGAGTTTTGGAGAAAAGAGCGAAGCGCTTGGTGTAAAGGTTGTCAAAGTGGATGTCACTCAGGAACCAGGGCTGAGTGGACGCTTCTTTGTCACAACACTTCCAACAATCTTTCATGCCAAGGATGGAGTGTTTCGTAGATATCATGGATCAAGAATGGTGGAAGACCTCCAGACCTTTATCTCAGAGAAGAAGTGGGAAGTTATTGAGCCAGTGGCTGGGTGGAGATCCCCATCTTCCATTGTGATGTCTGGGATGGCGAGTCTTTTTCAGCTGTCGGGATGGATGCGGCAACTTCACAACTACTTTACTGGACCTCTGGAAATTCCATCTTGGGGCTCCTACATCATCTTTATTGTGGCCACGTTGCTTGTCGGCCTCCTGCTGGGACTGATGCTGGTGTTAATCATTGATTGCTGTTGTCCTTCAAAATCAAAGTATGAAGTGATGAGAGAAGAAGTTAATGAAGAGAATTTGGCAAATTTGGAGGCACAAGTGGTCCTGGTCCCTGTGGAAAGGAAACCAGATTGTGCTGCCAATGAAGGAGGCAGTGACGATGACAATGAAGAAGAAGATGAAGAAGAAAGTGGCAATAGCAGTGAAGGTGACAATGAAAAAGAAAATAGCAATGAGGATGACAGTGAAGACAGTGATGAAGAAGAAGATGATGATGACGATGAAGAAGAAGGTGAAGCAAGCAATGCTCAGAATGTTGCTAAGGATTCAGATGAGGATTCTGCCGTTGCTGGGTCTGAAGCTGAAGAAGACAATGTCCCTGAAGTGAGTCCAGTGAGTCCAGCAGAGAGTGAGAGTGAGAGTGCCTTGAGACAGCGCAGAGTGGAGGCCACCGAGGGTAGCGGCCACTAGTCCTGACTATGGACCACAGGTGTGGCTGGACTTTTCTCTCTCAATGCCATTGAAGCATGTTCAGCTCGATTGTGCATGGGTGCCTGTCCTTGTACAGCAGCGTTATTCATGAAGCAGCATTTTAACACTTTTAAAGCTACTGCCATTTAGCGGAATCTTTTATTTGCAGTGTTTATTTAAGAGAAGCTTTAGTAAAGAGTTACTATAGTGACCACTATCAGTATTCACACAATATATCATTCTAGATCTGTCATTATTGTGCCTCCTTCATAAACGTTCCCCTGGGAGACATAAGGG
                                                  Xl3.1-CHK-1012692972                                                                                                                                                                                                                                                                                                                                                                                     TCACTGTGTTACACCAGCGCTCGGGGAGGAGTCAGACCGACGCCCTTGTCGCGCCACTTCCTGGTACCGCCGGTGTCAGTGACAGAGAGGAGCAAGATGGCGGCGGCAGCAGCATCAGACTCCCGGGAGAGGACTGAGCGGAGGAGAAGGTGTCAGTGTCGCGGGGCAGGGCTGCTGTTTGTGTCCCTAGTGTTACTGGCGGTGCCTCGGGGTGTGAGGAGCTCAGAGGTCTCGTCTGACACTTCAGTCACATCTGTCACTTCCACTGACTGGTCTCAAGTGCTGCGCGGACACTCGATGATTCTATTTTATGCTCCGTGGTGTCCAGCCTGCCAGCAAATTCAGTCGGCGTGGGAGAGTTTTGGAGAAAAGAGCGAAGCGCTTGGTGTAAAGGTTGTCAAAGTGGATGTCACTCAGGAACCAGGGCTGAGTGGACGCTTCTTTGTCACAACACTTCCAACAATCTTTCATGCCAAGGATGGAGTGTTTCGTAGATATCATGGATCAAGAATGGTGGAAGACCTCCAGACCTTTATCTCAGAGAAGAAGTGGGAAGTTATTGAGCCAGTGGCTGGGTGGAGATCCCCATCTTCCATTGTGATGTCTGGGATGGCGAGTCTTTTTCAGCTGTCGGGATGGATGCGGCAACTTCACAACTACTTTACTGGACCTCTGGAAATTCCATCTTGGGGCTCCTACATCATCTTTATTGTGGCCACGTTGCTTGTCGGCCTCCTGCTGGGACTGATGCTGGTGTTAATCATTGATTGCTGTTGTCCTTCAAAATCAAAGTATGAAGTGATGAGAGAAGAAGTTAATGAAGAGAATTTGGCAAATTTGGAGGCAxAxGxxxxxxTGGTCCCTGTGGAAAGGAAACCAGATTGTGCTGCCAATGAAGGAGGCAGTGACGATGACAATGAAGAAGAAGATGAAGAAGAAAGTGGCAATAGCAGTGAAGGTGACAATGAAAAAGAAAATAGCAATGAGGATGACAGTGAAGACAGTGATGAAGAAGAAGATGATGATGACGATGAAGAAGAAGGTGAAGCAAGCAATGCTCAGAATGTTGCTAAGGATTCAGATGAGGATTCTGCCGTTGCTGGGTCTGAAGCTGAAGAAGACAATGTCCCTGAAGTGAGTCCAGTGAGTCCAGCAGAGAGTGAGAGTGAGAGTGCCTTGAGACAGCGCAGAGTGGAGGCCACCGAGGGTAGCGGCCACTAGTCCTGACTATGGACCACAGGTGTGGCTGGACTTTTCTCTCTCAATGCCATTGAAGCATGTTCAGCTCGATTGTGCATGGGTGCCTGTCCTTGTACAGCAGCGTTATTCATGAAGCAGCATTTTAACACTTTTAAAGCTACTGCCATTTAGCGGAATCTTTTATTTGCAGTGTTTATTTAAGAGAAGCTTTAGTAAAGAGTTACTATAGTGACCACTATCAGTATTCACACAATATATCATTCTAGATCTGTCATTATTGTGCCTCCTTCATAAACGTTCCCCTGGGAGACATAAGGGTCAGGC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                    2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     4     5     5     5     5     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     8     9     8     9     7     8     8     8     7     8     7     8     7     8     7     8     6     8     6     8     5     8     6     8     5     8     5     8     5     8     5     8     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     4     7     4     7     4     7     3     7     3     6     2     6     2     6     2     4     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4
                                               BLH ATG     102     599                                                                                                                                                                                                                                                                                                                                                                               
                                               BLH MIN      99     115                                                                                                                                                                                                                                                                                                                                                                               
                                               BLH OVR     102     210                                                                                                                                                                                                                                                                                                                                                                               
                                               CDS MIN     102       1                                                                                                                                                                                                                                                                                                                                                                               
                                               EST CLI      92       1                                                                                                                                                                                                                                                                                                                                                                               
                                               ORF LNG     102      17                                                                                                                                                                                                                                                                                                                                                                               
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ci ---- 8e-010     NP_001027962.1 nucleolin like protein CiRGG1 [Ciona intestinalis] --------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Sp ---= 7e-038     XP_001195539.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ===========================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ce ==== 2e-045     NP_504655.1 Short DumPY body and abnormal sensory rays DPY-11, membrane associatedthioredoxin-like protein (27.4 kD) (dpy-11) [Caenorhabditis elegans] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Dm ---- 2e-052     NP_611838.1 CG5554-PA [Drosophila melanogaster] -----------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ag ---- 5e-055     XP_321485.4 AGAP001613-PA [Anopheles gambiae str. PEST] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Cf ==== 2e-063     XP_534350.2 PREDICTED: similar to Thioredoxin-like protein KIAA1162 precursor [Canis familiaris] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Bt ---- 7e-069     NP_001092640.1 thioredoxin domain containing 13 [Bos taurus] -------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Dr ---= 3e-070     NP_001025330.1 hypothetical protein LOC561444 [Danio rerio] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Mm ---- 2e-070     NP_083424.1 thioredoxin domain containing 13 [Mus musculus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Hs ==== 3e-071     NP_066979.2 hypothetical protein DJ971N18.2 [Homo sapiens] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Gg ---- 1e-077     XP_415026.2 PREDICTED: similar to Txndc13-prov protein [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Xt ==== 2e-150     AAI18715.1 Thioredoxin domain containing 13 [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xl ==== 0          AAI08771.1 Unknown (protein for IMAGE:6859100) [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6859100.5                                                                                                                                                                                                                                                                                                                                                                            TGA------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG------ATG---------------------------ATG---------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---TGA---------------------------------------------------------------------ATG------------------------------ATG------------------------------------TAG---------------------------TAA---------TAGTAA---------------------------------------------------------------------------TAA------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  5   1   2       bld Ov1  5g                         IMAGE:5074374.5p                                                                                                                                                                                                                                                       ACCCACGCGTCCGATTAATGACACACCTAGGCCCAGTTTGTCTcacacacacacacacaGAGACAGACCAGTAGATACCCAGCCTGACACTGCCAACCGCAGGCGCCGAGAGTTGTGTGAGGCGTCTCACTGTGTTACACCAGCGCTCGGGGAGGAGTCAGACCGACGCCCTTGTCGCGCCACTTCCTGGTACCGCCGGTGTCAGTGACAGAGAGGAGCAAGATGGCGGCTGCAGCAGCATCAGACTCCCGGGAGAGGACTGAGCGGAGGAGAAGGTGTCAGTGTCGCGGGGCAGGGCTGCTGTTTGTGTCCCTAGTGTTACTGGCGGTGCCTCGGGGTGTGAGGAGCTCAGAGGTCTCGTCTGACACTTCAGTCACATCTGTCACTTCCACTGACTGGTCTCAAGTGCTGCGCGGACACTCGATGATTCTATTTTATGCTCCGTGGTGTCCAGCCTGCCAGCAAATTCAGTCGGCGTGGGAGAGTTTTGGAGAAAAGAGCGAAGCGCTTGGTGTAAAGGTTGTCAAAGTGGATGTCACTCAGGAACCAGGGCTGAGTGGACGCTTCTTTGTCACAACACTTCCAACAATCTTTCATGCCAAGGATGGAGTGTTTCGTA
  5   1   2       bld Egg3 5g                         IMAGE:6326574.5p                                                                                                                                                                                                                                                                   GATTCCCGGGATAATGACCACCTCCGCCCAGGTGTCCTCTcacacacacactcacacacacacacCAGTAGATGCCCAGCCTGACACTGCCAACCGAGAGTTGTATGAGGCGTCTCACTGTGTTACACCAGCGCTCGGGGAGGAGTCAGACCGACGCCCTTGTCGCGCCACTTCCTGGTACCGCCGGTGTCAGTGACAGAGAGGAGCAAGATGGCGGCGGCAGCAGCATCAGACTCCCGGGAGAGGACTGAGCGGAGGAGAAGGTGTCAGTGTCGCGGGGCACGGCTGCTGTTTGTGTCCCTAGTGTTACTGGCGGTGCCTCGGGGTGTGAGGAGCTCAGAGGTCTCGTCTGACACTTCAGTCACATCTGTCACTTCCACTGACTGGTCTCAAGTGCTGCGCGGACACTCGATGATTCTATTTTATGCTCCGTGGTGTGCAGCCTGCCAGCAAATTCAGTCGGCGTGGGAGAGTTTTGGAGAAAAGAGCGAAGCGCTTGGTGTAAAGGTTGTCAAAGTGGATGTCACTCAGGAACCAGGGCTGAGTGGACGCTTCTTTGTCACAACACTTCCAACAGTCTTTCATGCCAAGGATGGAGTGTTTCGTAGATATCATGGATCAAGAATGGTGGAAGACCTCCAGACGTTTATCTCAGACAAGAAGTGGGAAGCTATTGAAGCAAGTGGCTGGGTGGAGATCCCCATCTTCCATTGTGATGTCTGGGATGGCAAGGGCTTTTTCAACTGGCAGGACGGATGCCCGCGACTTCACCGACTACCTTACCGGGACCTCAAGGGAAATTCCCTTCGTGGGGGGCTCGCTGGGTACATGGTATTAAAGCGGGCCGACACGTGACCTTGAACGGGCACTTCCCTAGACTGGAAACACTGAAAGGGCTCCACACGGGATCAGCCGCGTCCACAGGTAAGAACGGGGTTAAACCCAC
  5   1   2       bld Oo1  5g                         IMAGE:6859100.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGGATGCAAGATGGCGGCGGCAGCAGCATCAGACTCCCGGGAGAGGACTGAGCGGAGGAGAAGGTGTCAGTGTCGCGGGGCAGGGCTGCTGTTTGTGTCCCTAGTGTTACTGGCGGTGCCTCGGGGTGTGAGGAGCTCAGAGGTCTCGTCTGACACTTCAGTCACATCTGTCACTTCCACTGACTGGTCTCAAGTGCTGCGCGGACACTCGATGATTCTATTTTATGCTCCGTGGTGTCCAGCCTGCCAGCAAATTCAGTCGGCGTGGGAGAGTTTTGGAGAAAAGAGCGAAGCGCTTGGTGTAAAGGTTGTCAAAGTGGATGTCACTCAGGAACCAGGGCTGAGTGGACGCTTCTTTGTCACAACACTTCCAACAATCTTTCATGCCAAGGATGGAGTGTTTCGTAGATATCATGGATCAAGAATGGTGGAAGACCTCCAGACCTTTATCTCAGAGAAGAAGTGGGAAGTTATTGAGCCAGTGGCTGGGTGGAGATCCCCATCTTCCATTGTGATGTCTGGGATGGCGAGTCTTTTTCAGCTGTCGGGATGGATGCGGCAACTTCACAACTACTTTACTGGACCTCTGGAAATTCCATCTTGGGGCTCCTACATCATCTTTATTGTGGCCACGTTGCTTGTCGGCCTCCTGCTGGGACTGATGCTGGTGTTAATCATTGATTGCTGTTGCCCTTCAAAATCAAAGTATGAAGTGATGAGAGAAGAAGTAAATGAAGAGAATTTGGGCAATTTTGGAGGCAGAGGGCCAAAGTGGTCCCTGTGGGAAAAGGAAACCAGATTGTGCTGCCCATGAAAGGAGGCAGTGACGATGGACATTtgaagaagaagaatgaaagaagaaaggtgggcaataagccagtgaagggtggacatggaaaaaagaaaaaTAGCCAATGGAAGGATGGAAAGGTGAAAAACCAGGGATTGG
  5   1   2       bld Emb4 5g                         IMAGE:5514921.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAGATGGCGGCGGCATCAGCATCAGACTCCCGGGAGAGGACTGAGCGGAGGAGAAGGTGTCAGTGTCGCGGGGCAGGGCTGCTGTTTGTGTCCCTAGTGTTACTGGCGGTGCCTCGGGGTGTGAGGAGCTCAGAGGTCTCGTCTGACACTTCAGTCACATCTGTCACTTCCACTGACTGGTCTCAAGTGCTGCGCGGACACTCGATGATTCTATTTTATGCTCCGTGGTGTCCAGCCTGCCAGCAAATTCAGTCGGCGTGGGAGAGTTTTGGAGAAAAGAGCGAAGCGCTTGGTGTAAAGGTTGTCAAAGTGGATGTCACTCAGGAACCAGGGCTGAGTGGACGCTTCTTTGTCACAACACTTCCAACAATCTTTCATGCCAAGGATGGAGTGTTTCGTAGATATCATGGATCAAGAATGGTGGAAGACCTCCAGACCTTTATCTCAGAGAAGAAGTGGGAAGTTATTGAGCCAGTGGCTGGGTGGAGATCCCCATCTTCCATTGTGATGTCTGGGATGGCGAGTCTTTTTCAGCTGTCGGGATGGATGCGGCAACTTCACAACTACTTTACTGGACCTCTGGAAATTCCATCTTGGGGCTCCTACATCATCTTTATTGTGGCCACGTTGCTTGTCGGCCTCCTGCTGGGACTGATGCTGGTGTTAATCATTGATTGCTGTTGTCCTTCAAATCAAAGTATGAAGTGATGAGAGAAGAAGTTAATGAGAGATTTTGCAATTTGGAGCAGAGGCCAAGTGGTCCTGTGAANNGAACAGATG
  5   1   2       bld Te2                             IMAGE:7208428.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGCATCAGACTCCCGGGAGAGGACTGAGCGGAGGAGAAGGTGTCAGTGTCGCGGGGCAGGGCTGCTGTTTGTGTCCCTAGTGTTACTGGCGGTGCCTCGGGGTGTGAGGAGCTCAGAGGTCTCGTCTGACACTTCAGTCACATCTGTCACTTCCACTGACTGGTCTCAAGTGCTGCGCGGACACTCGATGATTCTATTTTATGCTCCGTGGTGTCCAGCCTGCCAGCAAATTCAGTCGGCGTGGGAGAGTTTTGGAGAAAAGAGCGAAGCGCTTGGTGTAAAGGTTGTCAAAGTGGATGTCACTCAGGAACCAGGGCTGAGTGGACGCTTCTTTGTCACAACACTTCCAACAATCTTTCATGCCAAGGATGGAGTGTTTCGTAGATATCATGGATCAAGAATGGTGGAAGACCTCCAGACCTTTATCTCAGAGAAGAAGTGGGAAGTTATTGAGCCAGTGGCTGGGTGGAGATCCCCATCTTCCATTGTGATGTCTGGGATGGCGAGTCTTTTTCAGCTGTCGGGATGGATGCGGCAACTTCACAACTACTTTACTGGACCTCTGGAAATTCCATCTTGGGGCTCCTACATCATCTTTATTGTGGCCACGTTGCTTGTCGGCCTCCTGCTGGGACTGATGCTGGTGTTAATCATTGATTGCTGTTGTCCTTCAAATCAAAGTATGAAGTGATGAGAGAAGAAGTTATGAAGAGATTTGGCAATTTGGAGGCGAGGCCAAGTGGTCCTGTGA
  5   1   2      seed Oo1       out                   IMAGE:3404602.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGACTGAGCGGAGGAGAAGGTGTCAGTGTCGCGGGGCAGGGCTGCTGTTTGTGTCCCTAGTGTTACTGGCGGTGCCTCGGGGTGTGAGGAGCTCAGAGGTCTCGTCTGACACTTCAGTCACATCTGTCACTTCCACTGACTGGTCTCAAGTGCTGCGCGGACACTCGATGATTCTATTTTATGCTCCGTGGTGTCCAGCCTGCCAGCAAATTCAGTCGGCGTGGGAGAGTTTTGGAGAAAAGAGCGAAGCGCTTGGTGTAAAGGTTGTCAAAGTGGATGTCACTCAGGAACCAGGGCTGAGTGGACGCTTCTTTGTCACAACACTTCCAACAATCTTTCATGCCAAGGATGGAGTGTTTCGTAGATATCATGGATCAAGAATGGTGGAAGACCTCCAGACCTTTATCTCAGAGAAGAAGTGGGAAGTTATTGAGCCAGTGGCTGGGTGGGAGATCCCCATCTTCCATTGTGATGTCTGGGATGGCGAGTCTTTTTCAGCTGTCGGGATGGATGCGGCAACTTCACAACTACTT
  5   1   2       bld Te2       in                    IMAGE:7208037.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGGAGGAGAAGGTGTCAGTGTCGCGGGGCAGGGCTGCTGTTTGTGTCCCTAGTGTTACTGGCGGTGCCTCGGGGTGTGAGGAGCTCAGAGGTCTCGTCTGACACTTCAGTCACATCTGTCACTTCCACTGACTGGTCTCAAGTGCTGCGCGGACACTCGATGATTCTATTTTATGCTCCGTGGTGTCCAGCCTGCCAGCAAATTCAGTCGGCGTGGGAGAGTTTTGGAGAAAAGAGCGAAGCGCTTGGTGTAAAGGTTGTCAAAGTGGATGTCACTCAGGAACCAGGGCTGAGTGGACGCTTCTTTGTCACAACACTTCCAACAATCTTTCATGCCAAGGATGGAGTGTTTCGTAGATATCATGGATCAAGAATGGTGGAAGACCTCCAGACCTTTATCTCAGAGAAGAAGTGGGAAGTTATTGAGCCAGTGGCTGGGTGGAGATCCCCATCTTCCATTGTGATGTCTGGGATGGCGAGTCTTTTTCAGCTGTCGGGATGGATGCGGCAACTTCACAACTACTTTACTGGACCTCTGGAAATTCCATCTTGGGGCTCCTACATCATCTTTATTGTGGCCACGTTGCTTGTCGGCCTCCTGCTGGGACTGATGCTGGTGTTAATCATTGATTGCTGTTGTCCTTCAAAATCAAAGTATGAAGTGATGAGAGAAGAAGTTAATGAAGAGAATTTGGCAAATTTGGAGGCAGAGGCCNAAGTGGTCCCTGTGGGAAGGAAC
  5   1   2       bld Te2                             IMAGE:7207990.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGGAGGAGAAGGTGTCAGTGTCGCGGGGCAGGGCTGCTGTTTGTGTCCCTAGTGTTACTGGCGGTGCCTCGGGGTGTGAGGAGCTCAGAGGTCTCGTCTGACACTTCAGTCACATCTGTCACTTCCACTGACTGGTCTCAAGTGCTGCGCGGACACTCGATGATTCTATTTTATGCTCCGTGGTGTCCAGCCTGCCAGCAAATTCAGTCGGCGTGGGAGAGTTTTGGAGAAAAGAGCGAAGCGCTTGGTGTAAAGGTTGTCAAAGTGGATGTCACTCAGGAACCAGGGCTGAGTGGACGCTTCTTTGTCACAACACTTCCAACAATCTTTCATGCCAAGGATGGAGTGTTTCGTAGATATCATGGATCAAGAATGGTGGAAGACCTCCAGACCTTTATCTCAGAGAAGAAGTGGGAAGTTATTGAGCCAGTGGCTGGGTGGAGATCCCCATCTTCCATTGTGATGTCTTGGGATGGCGAGTCTTTTTCAGCTGTCGGGATGGATGCGGCAACTTCACAACTACTTTACTGGACCTCTGGAAATTCCATCTTGGGGCTCCTACATCATCTTTATTGTGGCCACGTAGCTTGTCGGCCTCCTGCTGGGACTGATGCTGGTGTTAATCGTTGATTGCTGTTGTCCTTCAAAATCAAGTATGAAGTGATGAGAAAAAAGTTAATGAAGAAATTTGGCAAATGTGGAGGCGAAGGCCAAAGGGTCCCTTGTGGAA
  3   1   2       bld Te2       in                    IMAGE:7208037.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AACCTTCTCAAACAATTTTTTTTATGCCAAGGGATGAGTGTTTTGTAGATATTCATGGATCAGGAATGGTTGGAAGACCTCCCAGACCTTAATCTCAGAGAGAAGTGGGAAGTTATTGAGCCAGTGGCTGGGTGGAGATCCCCATCTTCCATGTGATGTCTGGGATGGCGAGTCTTTTTCAGCTGTCGGGATGGATGCGGCAACTTCACAACTACTTTACTGGACCTCTGGAAATTCCATCTTGGGGCTCCTACATCATCTTTATTGTGGCCACGTTGCTTGTCGGCCTCCTGCTGGGACTGATGCTGGTGTTAATCATTGATTGCTGTTGTCCTTCAAAATCAAAGTATGAAGTGATGAGAGAAGAAGTTAATGAAGAGAATTTGGCAAATTTGGAGGCAGAGGCCAAAGTGGTCCCTGTGGAAAGGAAACCAGATTGTGCTGCCAATGAAGGAGGCAGTGACGATGACAATGAAGAAGAAGATGAAGAAGAAAGTGGCAATAGCAGTGAAGGTGACAATGAAAAAGAAAATAGCAATGAGGATGACAGTGAAGACAGTGATGAAGAAGAAGATGATGATGACGATGAAGAAGAAGGTGAAGCAAGCAATGCTCAGAATGTTGCTAAGGATTCAGATGAGGATTCTGCCGTTGCTGGGTCTGAAGCTGAAGAAGACAATGTCCCTGAAGTGAGTCCAGTGAGTCCAGCAGAGAGTGAGAGTGAGAGTGCCTTGAGACAGCGCAGAGTGGAGGCCACCGAGGGTAGTGGCCACTAGTCCTGACTATGGACCACAGGTGTGGCTGGACTTTTCTCTCTCAATGCCATTGAAGCATGTTCAGCTCGATTGTGCATGGGTGCCTGTCCTTGTACAGCAGCGTTATTCATGAAGCAGCATTTTAACACTTTAAAGCTACGTCCC
  5   1   2      skin Te2N                            IMAGE:7767570.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGAGAGTGAGAGTGCCTTGAGACAGCGCAGAGTGGAGGCCACCGAGGGTAGCGGCCACTAGTCCTGACTATGGACCACAGGTGTGGCTGGACTTTTCTCTCTCAATGCCATTGAAGCATGTTCAGCTCGATTGTGCATGGGTGCCTGTCCTTGTACAGCAGCGTTATTCATGAAGCAGCATTTTAACACTTTTAAAGCTACTGCCATTTAGCGGAATCTTTTATTTGCAGTGTTTATTTAAGAGAAGCTTTAGTAAAGAGTTACTATAGTGACCACTATCAGTATTCACACAATATATCATTCTAGACCTGTCATTATTGTGCCTCCTTCATAAACGTTCCCCTGGGAGACATAAGGGTCAGGNC
  5   1   2       bld Te2                             IMAGE:7393195.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACAGCGCAGAGTGGAGGCCACCGAGGGTAGCGGCCACTAGTCCTGACTATGGACCACAGGTGTGGCTGGACTTTTCTCTCTCAATGCCATTGAAGCATGTTCAGCTCGATTGTGCATGGGTGCCTGTCCTTGTACAGCAGCGTTATTCATGAAGCAGCATTTTAACACTTTTAAAGCTACTGCCATTTAGCGGAATCTTTTATTTGCAGTGTTTATTTAAGAGAAGCTTTAGTAAAGAGTTACTATAGTGACCACTATCAGTATTCACACAATATATCATTCTAGATCTGTCATTATTGTGCCTCCTTCATAAACGTTCCCCTGGGAGACATAAGGGTCAGGCCACACNTGCNNATTCNAGGAAATTANTCCCCCANTGACAAATCTCCTCTTCTTTGGGGCGATTAATCTCCCCAAACTGCCCTCCGTCGTCTAAAATGAAAATCACCTGGGGGAAGGTACACGCGGCGCTTCGTTTTCCGAAGTCGCCAGAAGTTTCCTCGTGAGGCAACTAATCTCCCCAAATCTGCTCGTGTGGCCAGACCCTAAGATAATATCATGCAATTCTCTCCCCTGTACTCTAGGAGGTTAAATCTACAGTCTGAAAAATACCCTCAATCGACAAGGAAGAGCGATTTGCTATAATTGGGGAGCCTAAACATTTATCGTTGTTTAATAAAAATGAAAGTGTTCACTTAGATCTTAATTGTGTAAAAGGCTATCAACACTTCAGGCTTCTAGAATAATAACTTTTAATGCA
  5   1   2       bld Tad1                            IMAGE:6937129.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCACAGGTGTGGCTGGACTTTTCTCTCTCAATGCCATTGAAGCATGTTCAGCTCGATTGTGCATGGGTGCCTGTCCTTGTACAGCAGCGTTATTCATGAAGCAGCATTTTAACACTTTTAAAGCTACTGCCATTTAGCGGAATCTTTTATTTGCAGTGTTTATTTAAGAGAAGCTTTAGTAAAGAGTTACTATAGTGACCACTATCAGTATTCACACAATATATCATTCTAGATCTGTCATTATTGTGCCTCCTTCATAAACGTTCCCCTGGGAGACATAACGGTCAGATCCCCCCTCCTATCATGCCCGGGCGATCTGGTCCGCACCCGCACGGACTTACTGGCATGCGTCGTACAGACCACCCCCAGTTCCTTCGACCTCCCGCCCACGCCCGCACCTCGCCTACCCGGCCAACTCGTCAGTGCCACCCTCCTCGTTTCCGACAATACCATATCACGATCCAATTTGCCCCCCACCACTCGTTCTGTGTTGTGCATAAGCTAGGTTTACATCAGTCGTGGTGCTCCAACCTAGTAGTTACATTCGTGTCGGGCCACAACACTGCCGCTACACCCACTTGGTTGNTGTTAATCTCTATACTTCCATAATATCTTATTCTATTTTATTACATGTCCCGCGTCTTCACTAGCTTGCGCTCACACCCCACCAACCCANACTAGTNTTAGATAATATATCCAAATACACTCGCGGTACCCATACTATAACTCCTCCCTCGTCCCTGCTAGTATAACTTGCAACCATTATGGCGTGTNTAAACTTCGGTGTTAAACAGAAAACCCATACCCTCACCCATCCTTTCCAAAAATTAGCCGCATCAGccccccccccACCTTCCTCCCAGACTAATGCCCCTCCTCCGTACCGCCCCCGTTTAATTGGNATNGAGTAAACCCagagaagaagaaaaagagagagCCTCAGCCACCGTCCGCGAGATTGATATTGTTGACGACCCACGCGACCTCTTTGTCGTTTAGCTCGAATACAAAACCTTAGGCCCCTTATGTACCCGCCCAAATATCATTAATCTCACATCGTCCCACCTCGCATCAGATACCAAATTTATTGAAAAGAGGTNTATATATTACATCGACGTCCCCTAGACTANAGAAATCCATCTCTACCTCCGCGCCACGATGCGCGCTCGAACATAACAAGAAAAACGATTGCCCGTCCGAAAACGTTGAGCCTCGTACCTGGACCAAAGGCGAGCCGCCTACGCGCCGCGATTATANTTCCCCACACCACCCGTACCTTATTCGCTCGATACCCCACAACCGTGCGATATGTCACAGN
  5   1   2       bld Egg1                               PBX0050F09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAATCTTTTATTTGCAGTGTTTATTTAAGAGAAGCTTTAGTAAAGAGTTACTATAGTGACCACTATCAGTATTCACACAATATATCATTCTAGATCTGTCATTATTGTGCCTCCTTCATAAACGTTCCCCTGGGAGACATAAGGGTCAGGCCACACGTGCAGATTTGGGGAGATTAGTCCCCCAGTGACGAATCTCCTTCTTCAGGGCGATTAATCTCCCCAAACTGCCTTCGCCCTGCCCTCCGCCGGCTAAAATGAAAATCACCTGGGGGAAGGTACACGTGGCGCTTCGTTTTCCAAAGTCACCAGAAGTTTCCTCGTGAGGCAACTAATCTCCCCGAATCTGCTCGTGTGGCCAGACCCTAAGAATAATATGATGCAAAGTCTCGCCCCTGTGCTCTTAGGAGGTTCTAATCTACAGTCTGATAAAATACCTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)