Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:3402349-IMAGp.5.5              27 PI      78        396      680                forkhead box I1 [Xenopus tropicalis]
     2   0.0    0Xl3.1-XL504h24ex.5.5                       18 PI      78        395      683                forkhead box I1 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 95%

 1012777984 Xl3.1-IMAGE:4682602-IMAGp.5 - 6 ESTs
                                                                       ......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:4682602-IMAGp.5                                                                                                                                                                                                                                                                                                                   TACAGGTGTATTTGTGACCTGCTAGCTTTTACTATGAGTGCATTTGATCCACAAGCACATTCTCCACCACGCTGTGGGCCACAATTTCCCAGTATTGGGCAGGAGCCTCCAGAGATGAATATCTACTGTGAAAGCTTCTTACATCCCCAGACAATGCCTAGTCCTCAGCGACCTTCAAACTTTGAAACAGGTGACTACAGCACCACTGCAAATCCCTATCTGTGGTTGAATGGACCTTCCATCACACCTCCTCCATATCTGCCAGGATCCAACTCAAGCCACTTCATGCCTCAGGCATATGGGATGCAGAGGCAGCTACTGCCTAACATGCATGGTTTGGGAAGTTCTGAATTAGGTTGGCTTCCTATTCCTTCACAAGAAGAACTTATGAAACTGGTGAGACCTCCATACTCTTACTCTGCATTAATAGCAATGGCAATACATGGAGCCCCAGATAAAAGACTGACACTGAGCCAGATCTACCAGTATGTTGCTGATAACTTTCCTTTCTACAACAAGAGCAAAGCTGGGTGGCAGAATTCAATTCGACACAACCTGTCTCTAAATGATTGCTTCAAGAAAGTACCAAGAGATGAAGATGATCCAGGCAAGGGCAATTATTGGACCTTGGACCCAAACTGTGAAAAAATGTTTGACAACGGAAACTTCCGCAGAAAGAGGAAAAGAAAGTCTGATGTCAGCCCAAATGGACAGCTATCTTCTGACAAGCCTGAAGGGAGCCCGTAAGTGAGAGCCCCTACGAATGGAGAGCATCAGGACATGTTGGGAAAT
                                                  Xl3.1-CHK-1012702508                                                                                                                                                                                                                                                                                                                         TGTATTTGTGACCTGCTAGCTTTTACTATGAGTGCATTTGATCCACAAGCACATTCTCCACCACGCTGTGGGCCACAATTTCCCAGTATTGGGCAGGAGCCTCCAGAGATGAATATCTACTGTGAAAGCTTCTTACATCCCCAGACAATGCCTAGTCCTCAGCGACCTTCAAACTTTGAAACAGGTGACTACAGCACCACTGCAAATCCCTATCTGTGGTTGAATGGACCTTCCATCACACCTCCTCCATATCTGCCAGGATCCAACTCAAGCCACTTCATGCCTCAGGCATATGGGATGCAGAGGCAGCTACTGCCTAACATGCATGGTTTGGGAAGTTCTGAATTAGGTTGGCTTCCTATTCCTTCACAAGAAGAACTTATGAAACTGGTGAGACCTCCATACTCTTACTCTGCATTAATAGCAATGGCAATACATGGAGCCCCAGATAAAAGACTGACACTGAGCCAGATCTACCAGTATGTTGCTGATAACTTTCCTTTCTACAACAAGAGCAAAGCTGGGTGGCAGAATTCAATTCGACACAACCTGTCTCTAAATGATTGCTTCAAGAAAGTACCAAGAGATGAAGATGATCCAGGCAAGGGCAATTATTGGACCTTGGACCCAAACTGTGAAAAAATGTTTGACAACGGAAACTTCCGCAGAAAGAGGAAAAGAAAGTCTGATGTCAGCCCAAATGGACAGTTATCTTCTGACAAGCCTGAAGGGAGCCCGxxAxxxxxxxxCCCTACGAATGGAGAGCATCAGGACATGTTGGGAAATTCTTCA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                        2     3     4     4     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     4     4     3     4     4     4     4     4     2     4     3     4     3     4     2     4     2     4     2     4     2     3     2     3     3     3
                                               BLH ATG      33     979                                                                                                                                                                                                                                                                                                                   
                                               BLH MIN      33     134                                                                                                                                                                                                                                                                                                                   
                                               BLH OVR      33     243                                                                                                                                                                                                                                                                                                                   
                                               EST CLI     -20       1                                                                                                                                                                                                                                                                                                                   
                                               ORF LNG      33      10                                                                                                                                                                                                                                                                                                                   
                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ce ---- 2e-033     NP_496411.1 UNCoordinated locomotion UNC-130, forkhead box D1 (37.3 kD) (unc-130)[Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Dm ---- 5e-036     NP_524202.1 crocodile CG5069-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Ag ---- 2e-036     XP_315933.3 AGAP005902-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Sp ---- 2e-050     XP_001181648.1 PREDICTED: similar to forkhead transcription factor I [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Ci ---- 5e-061     NP_001071713.1 transcription factor protein [Ciona intestinalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Dr ==== 3e-095     NP_944600.1 forkhead box I3b [Danio rerio] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED = Bt ==== 2e-113     XP_587178.2 PREDICTED: similar to forkhead box I1 isoform 1 [Bos taurus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Mm ==== 3e-115     NP_076396.2 forkhead box I1; forkhead homolog 10 (Drosophila) [Mus musculus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Hs ==== 3e-118     NP_036320.2 forkhead box I1 isoform a; forkhead (Drosophila)-like 10; Forkhead, drosophila,homolog-like 10; forkhead-related activator 6; hepatocyte nuclear factor 3forkhead homolog 3; HNF-3/fork-head homolog-3 [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED = Cf ==== 1e-118     XP_546245.2 PREDICTED: similar to forkhead box I1 isoform a isoform 1 [Canis familiaris] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED = Gg ==== 9e-129     XP_425185.1 PREDICTED: similar to Hypothetical protein MGC75815 [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xt ==== 3e-147     Q6P8A3 Forkhead box protein I1-ema (FoxI1-ema) (Ectodermally-expressed mesendoderm antagonist) (FoxI3) [Xenopus tropicalis]  ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xl ==== 1e-152     NP_001080367.1 forkhead box I1 [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                           Xl3.1-IMAGE:4682602-IMAGp.5                                                                                                                                                                                                                                                                                                                TAG---------------------------------ATG------------------------------------------------------------------------------ATG------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG---------------------ATG---------------------------------------------------------ATG------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                    [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ...
  5   1   2       add Kid  5g                         IMAGE:7007822.5p                                                                                                                                                                                                                                                                                               CAAGACATTAGCTAGTACAGGTGCATTTGCTTTGTGACCTGCTAGCTTTAACTATGAGTGCCTTTGATCCACAGGCACATTCTCCACCACGCTGTGGGCCACAATTTCCCAGTATTGGGCAGGAGCCTCCAGAGATGAATATCTACTGTGACACCATCTTCCATCCCCAGACAATGCCTAGTCCTCAGCGACCTTCAAACTTTGAAACAGGCGATTACAGCACCACTGCAAATCCTTACCTGTGGCTGAATGGACCTTCCATCACACCTCCTCCATATCTTCCAGGATCCAACTCAAGCCACTTTATGCCTCAGGCATATGGAATGCAGAGACAGCTACTGCCTAACATGCATGGCTTGGGAAGTTCTGACTTAGGTTGGCTTTCTATTCCTTCTCAAGAAGAACTTATGAAACTGGTGAGACCTCCATACTCTTACTCTGCATTAATAGCAATGGCAATACATGGAGCCCCAGATAAAAGACTGACACTGAGCCAGATCTACCAGTATGTTGCTGATAACTTTCCTTTCTACAACAAGAGCAAAGCTGGATGGCAGAATTCAATTCGACACAACCTGTCTCTAAACGATTGCTTCAAGAAAGTACCAAGAGACGAAGATGATCCAGGAAAGGGCAATTATTGGACCTTGGACCCAAACTGTGAAAAAATGTTTGAACATGGAAACTTCCGCAGAAAAGAGAAAAGAAAAGTCGACGTCAGCCCAAATGGACAGCTATCTTTCTGATAACCTGAAGGGAGTCACCTAGTGAGATCC
  5   1   2       bld Emb4 5g                IMAGE:4682602-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                       GACATTAGCTAGTACAGGTGTATTTGTGACCTGCTAGCTTTTACTATGAGTGCATTTGATCCACAAGCACATTCTCCACCACGCTGTGGGCCACAATTTCCCAGTATTGGGCAGGAGCCTCCAGAGATGAATATCTACTGTGAAAGCTTCTTACATCCCCAGACAATGCCTAGTCCTCAGCGACCTTCAAACTTTGAAACAGGTGACTACAGCACCACTGCAAATCCCTATCTGTGGTTGAATGGACCTTCCATCACACCTCCTCCATATCTGCCAGGATCCAACTCAAGCCACTTCATGCCTCAGGCATATGGGATGCAGAGGCAGCTACTGCCTAACATGCATGGTTTGGGAAGTTCTGAATTAGGTTGGCTTCCTATTCCTTCACAAGAAGAACTTATGAAACTGGTGAGACCTCCATACTCTTACTCTGCATTAATAGCAATGGCAATACATGGAGCCCCAGATAAAAGACTGACACTGAGCCAGATCTACCAGTATGTTGCTGATAACTTTCCTTTCTACAACAAGAGCAAAGCTGGGTGGCAGAATTCAATTCGACACAACCTGTCTCTAAATGATTGCTTCAAGAAAGTACCAAGAGATGAAGATGATCCAGGCAAGGGCAATTATTGGACCTTGGACCCAAACTGTGAAAAAATGTTTGACAACGGAAACTTCCGCAGAAAGAGGAAAAGAAAGTCTGATGTCAGCCCCAATGGACAGTTATCTTCTGACAAGCCTGAAGGGAGCCCGCTAAGTGAGAGCCCTACGAATGGAGAGCATCAGGACATGTTGGGAAATTCTTCACCAGGGAACAGATGACTCCC
  5   1   2       bld Emb4 5g                         IMAGE:4682602.5p                                                                                                                                                                                                                                                                                                          ATTAGCTAGTACAGGTGTATTTGTGACCTGCTAGCTTTTACTATGAGTGCATTTGATCCACAAGCACATTCTCCACCACGCTGTGGGCCACAATTTCCCAGTATTGGGCAGGAGCCTCCAGAGATGAATATCTACTGTGAAAGCTTCTTACATCCCCAGACAATGCCTAGTCCTCAGCGACCTTCAAACTTTGAAACAGGTGACTACAGCACCACTGCAAATCCCTATCTGTGGTTGAATGGACCTTCCATCACACCTCCTCCATATCTGCCAGGATCCAACTCAAGCCACTTCATGCCTCAGGCATATGGGATGCAGAGGCAGCTACTGCCTAACATGCATGGTTTGGGAAGTTCTGAATTAGGTTGGCTTCCTATTCCTTCACAAGAAGAACTTATGAAACTGGTGAGACCTCCATACTCTTACTCTGCATTAATAGCAATGGCAATACATGGAGCCCCAGATAAAAGACTGACACTGAGCCAGATCTACCAGTATGTTGCTGATAACTTTCCTTTCTACAACAAGAGCAAAGCTGGGTGGCAGAATTCAATTCGACACAACCTGTCTCTAAATGATTGCTTCAAGAAAGTACCAAGAGATGAAGATGATCCAGGCAAGGGCAATTATTGGACCTTGGACCCAAACTGTGAAAAAATGTTTGACAACGGAAACTTCCGCAGAAAGAGGAAAGAAAGTCTGATGTCAGCCCCCATGGACAGTTATCTTCTGACAAGCCTGAAGGGAGCCCGCTAAGTGAGAGCCCTACGAATGGAGAGCATCAGGACATGGTGGGGAAATTCTTCACCAGGAACAGATGACTCCCCTGGAAAAAGGTCACCTCCCTCCATCTATAACCCCATGGCCTTAATAACTTTCTCTTCAGNATGC
  5   1   2      seed Neu7 5x3  out                        XL048b04.5p                                                                                                                                                                                                                                                                                                                               GGTGACCTGCTAGCTTTTACTATGAGTGCATTTGATCCACAAGCACATTCTCCACCACGCTGTGGGCCACAATTTCCCAGTATTGGGCAGGAGCCTCCAGAGATGAATATCTACTGTGAAAGCTTCTTACATCCCCAGACAATGCCTAGTCCTCAGCGACCTTCAAACTTTGAAACAGGTGACTACAGCACCACTGCAAATCCCTATCTGTGGTTGAATGGACCTTCCATCACACCTCCTCCATATCTGCCAGGATCCAACTCAAGCCACTTCATGCCTCAGGCATATGGGATGCAGAGGCAGCTACTGCCTAACATGCATGGTTTGGGAAGTTCTGAATTAGGTTGGCTTCCTATTCCTTCACAAGAAGAACTTATGAAACTGGTGAGACCTCCATACTCTTACTCTGCATTAATAGCAATGGCAATACATGGAGCCCCAGATAAAAGACTGACACTGAGCCAGATCTACCAGTATGTTGCTGATAACTTTCCTTTCTACAACAAGAGCAAAGCTGGGTGGCAGAATTCAATTCGACACAACCTGTCTCTAAATGATTGCTTCAAGAAAGTACCAAGAGATGAAGATGATCCAGGCAAGGGCAATTATTGGACCTTGGACCCAAACTGTGAA
  5   1   2       bld Neu7 5x3  out                        XL016g24.5p                                                                                                                                                                                                                                                                                                                                       GCTAGCTTTTACTATGAGTGCATTTGATCCACAAGCACATTCTCCACCACGCTGTGGGCCACAATTTCCCAGTATTGGGCAGGAGCCTCCAGAGATGAATATCTACTGTGAAAGCTTCTTACATCCCCAGACAATGCCTAGTCCTCAGCGACCTTCAAACTTTGAAACAGGTGACTACAGCACCACTGCAAATCCCTATCTGTGGTTGAATGGACCTTCCATCACACCTCCTCCATATCTGCCAGGATCCAACTCAAGCCACTTCATGCCTCAGGCATATGGGATGCAGAGGCAGCTACTGCCTAACATGCATGGTTTGGGAAGTTCTGAATTAGGTTGGCTTCCTATTCCTTCACAAGAAGAACTTATGAAACTGGTGAGACCTCCATACTCTTACTCTGCATTAATAGCAATGGCAATACATGGAGCCCCAGATAAAAGACTGACACTGAGCCAGATCTACCAGTATGTTGCTGATAACTTTCCTTTCTACAACAAGAGCAAAGCTGGGTGGCAGAATTCAATTCGACACAACCTGTCTCTAAATGATTGCTTCAAGAAAGTACCAAGAGATGAAGATGATCCAGGCAAGGGCAATTATTGGAC
  5   1   2       add Kid                             IMAGE:7009923.5p                                                                                                                                                                                                                                                                                                                                                                                          CTGTGGGCCACAATTTCCCAGTATTGGGCAGGAGCCTCCAGAGATGAATATCTACTGTGACACCATCTTCCATCCCCAGACAATGCCTAGTCCTCAGCGACCTTCAAACTTTGAAACAGGCGATTACAGCACCACTGCAAATCCTTACCTGTGGCTGAATGGACCTTCCATCACACCTCCTCCATATCTTCCAGGATCCAACTCAAGCCACTTTATGCCTCAGGCATATGGAATGCAGAGACAGCTACTGCCTAACATGCATGGCTTGGGAAGTTCTGACTTAGGTTGGCTTTCTATTCCTTCTCAAGAAGAACTTATGAAACTGGTGAGACCTCCATACTCTTACTCTGCATTAATAGCAATGGCAATACATGGAGCCCCAGATAAAAGACTGACACTGAGCCAGATCTACCAGTATGTTGCTGATAACTTTCCTTTCTACAACAAGAGCAAAGCTGGATGGCAGAATTCAATTCGACACAACCTGTCTCTAAACGATTGCTTCAAGAAAGTACCAAGAGACGAAGATGATCCAGGAAAGGGCAATTATTGGACCTTGGACCCAAACTGTGAAAAAATGTTTGACAATGGAAACTTCCGCAGAAAGAGGAAAAGAAAGTCCGACGTCAGCCCAAATGGACAGCTATCTTCTGATAAACCTGAAGGGAGTCCACTAAGTGAGAGTCCTAAGAATGGAGAGCATCAGGACATGTTGGGAAATTCAN

In case of problems mail me! (mike.gilchrist@crick.ac.uk)