Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:7009683.5                      10 END     5          45       50                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012778211 Xl3.1-IMAGE:8070152.3 - 11 ESTs
                                                                       ......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8070152.3       TGTGGGGAACCTGATCCTATTGACAATGGTATTGTCACCCTCAACCGTTCTTCAACCACTTATGGCTCAAAAATCGAATACAGCTGCCCAACTGAATACTACACCCTAACTCTACCTGCCGGTGAAGATGGAACCTATCGCTGCTCATCAGATGGATATTGGGTCAACAAGAAAGGAGAGAAGGAACTTCCTACATGTACCCCAGTTTGTGGAGTCCATCATTCTGTAGACGGTGCACGGATATTTGGCGGCGCTCAAGCTAAACTTGGTCAATTTCCATGGCTGATCCAGTTCACTGTGCCAGAACTAGGCGGCGGTTCCCTAATATCTGATCGGTGGGTCCTGACAGCTGCTCACGTGCTCAAGAATGAATTCCCAGAAATGTATGGGGGCGTGATGAAGCTTTTTCCAAATGTTAATTCACGACCCAAGCAAAACAAACTGCAGTTCAAGAAAATTATTGTTCATCCTCTGTATCGTGGAGGAGAAAACTATGACAATGACATTGCTCTGATCCAACTGAGTAAGAAAGTCAAAATGGACAAATGTATCTCTCCCATCTGTCTTCCAAGGAGGGGACTTGCCCCTGTGGTTAATGAGGTTGCCCTTATTGCAGGATGGGGTAGGACTAAAAAGAGAGACTATGCAATAAATTTGCAGTTTGCCAAGATCTTTCTCAGCTCCATGGATAAATGTAAGCAGGCAACTGCTGGCGGTGGTTATATCACTGCAAACATGCTGTGTGCTGGATCAGAAGATGGACAGGACAGTTGCCAGGGTGATAGCGGGGGGCCACTCATGTTCAAGGACCCCCAAGACAGCAGTAAAATATATATGGCAGGCATTGTGTCCTGGGGCCCACAGGAATGTGGATCCTATGGCTTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGAAGACCATAGCAGCGACGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGCTGTGTGCGTGAGTGTTGCGCTCTAGAGAGACAGTGATGCTCAGCGTCCGACACAAGTTACTTACGACATCAAATCAGAGCAAGTTGTATCCTACAGAAATGTCATTAAAAAACACTATTCCCCTTCTGTGCCCAGATAGATTGGGAAATTCTACTATATATACTGCTATAATGCAAATTCCTCATTGAGCATCATAATATAGCTAATGAACTCATTGTTTTTCCATTTTCTGGTTATATTTTTCTAATGGAACTATAAAAGGTGAATATAGAATTGTATTCCTGTTTCCTTCTCCTCTAGGCAGCTCCTGTGAAGTGCCCCATTTTCACGCATATTCAAATTTA
                                                  Xl3.1-CHK-1012694836             GAACCTGATCCTATTGACAATGGTATTGTCACCCTCAACCGTTCTTCAACCACTTATGGCTCAAAAATCGAATACAGCTGCCCAACTGAATACTACACCCTAACTCTACCTGCCGGTGAAGATGGAACCTATCGCTGCTCATCAGATGGATATTGGGTCAACAAGAAAGGAGAGAAGGAACTTCCTACATGTACCCCAGTTTGTGGAGTCCATCATTCTGTAGACGGTGCACGGATATTTGGCGGCGCTCAAGCTAAACTTGGTCAATTTCCATGGCTGATCCAGTTCACTGTGCCAGAACTAGGCGGCGGTTCCCTAATATCTGATCGGTGGGTCCTGACAGCTGCTCACGTGCTCAAGAATGAATTCCCAGAAATGTATGGGGGCGTGATGAAGCTTTTTCCAAATGTTAATTCACGACCCAAGCAAAACAAACTGCAGTTCAAGAAAATTATTGTTCATCCTCTGTATCGTGGAGGAGAAAACTATGACAATGACATTGCTCTGATCCAACTGAGTAAGAAAGTCAAAATGGACAAATGTATCTCTCCCATCTGTCTTCCAAGGAGGGGACTTGCCCCTGTGGTTAATGAGGTTGCCCTTATTGCAGGATGGGGTAGGACTAAAAAGAGAGACTATGCAATAAATTTGCAGTTTGCCAAGATCTTTCTCAGCTCCATGGATAAATGTAAGCAGGCAACTGCTGGCGGTGGTTATATCACTGCAAACATGCTGTGTGCTGGATCAGAAGATGGACAGGACAGTTGCCAGGGTGATAGCGGGGGGCCACTCATGTTCAAGGACCCCCAAGACAGCAGTAAAATATATATGGCAGGCATTGTGTCCTGGGGCCCACAGGAATGTGGATCCTATGGCTTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGAAGACCATAGCAGCGACGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGCTGTGTGCGTGAGTGTTGCGCTCTAGAGAGACAGTGATGCTCAGCGTCCGACACAAGTTACTTACGACATCAAATCAGAGCAAGTTGTATCCTACAGAAATGTCATTAAAAAACACTATTCCCCTTCTGTGCCCAGATAGATTGGGAAATTCTACTATATATACTGCTATAATGCAAATTCCTCATTGAGCATCATAATATAGCTAATGAACTCATTGTTTTTCCATTTTCTGGTTATATTTTTCTAATGGAACTATAAAAGGTGAATATAGAATTGTATTCCTGTTTCCTTCTCCTCTAGGCAGCTCCTGTGAAGTGCCCCATTTTCACGCATATTCA
                                                      consensus depths            2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     7     7     8     8     8     8     8     8     8     8     8     8     6     8     7     9     7     9     7     9     8    10     8    10     8    10     8    10     8    10     8    10     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     7     7     7     7     7     7     7     5     6     6     6     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     3     6     3     6     3     6     3     4     3     4     3     4     3     4     3     3     2     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -------G----
  5   1   2       bld Te2N      in                    IMAGE:7764036.5p GTGAATTGTGGGGAACCTGATCCTATTGACAATGGTATTGTCACCCTCAACCGTTCTTCAACCACTTATGGCTCAAAAATCGAATACAGCTGCCCAACTGAATACTACACCCTAACTCTACCTGCCGGTGAAGATGGAACCTATCGCTGCTCATCAGATGGATATTGGGTCAACAAGAAAGGAGAGAAGGAACTTCCTACATGTACCCCAGTTTGTGGAGTCGATCATTCTGTAGACGGTGCACGGATATTTGGCGGCGCTCAAGCTAAACTTGGTCAATTTCCATGGCTGATCCAGTTCACTGTGCCAGAACTAGGCGGCGGTTCCCTAATATCTGATCGGTGGGTCCTGACAGCTGCTCACGTGCTCAAGAATGAATTCCCAGAAATGTATGGGGGCGTGATGAAGCTTTTTCCAAATGTTAATTCACGACCCAAGCAAAACAAACTGCAGTTCAAGAAAATTATTGTTCATCCTCTGTATCGTGGAGGAGAAAACTATGACAATGACATTGCTCTGATCCAACTGAGTAAGAAAGTCAAAATGGACAAATGTATCTCTCCCATCTGTCTTCCAAGGAGGGGACTTGCCCCTGTGGTTAATGAGGTTGCCCTTATTGCAGGATGGGGTAGGACTAANAAGAGAGACTATGCAATANATTTGCAGTTTGCCAAGATCTTTCTCAGCTCCATGGATAAATGTAGCAGGCACTGCTGGGCGTGGTATATCACTGCAACATGCTGTGTGCTGATCAGAGATGACGGACAGTGCAGGTGATACGGGGGCCTCATGTCAGACCCAGAACATAATAAATGCAGATGTGTCTGGCC
  5   1   2       bld Lmb1                            IMAGE:8533577.5p       TGTGGGGAACCTGATCCTATTGACAATGGTATTGTCACCCTCAACCGTTCTTCAACCACTTATGGCTCAAAAATCGAATACAGCTGCCCAACTGAATACTACACCCTAACTCTACCTGCCGGTGAAGATGGAACCTATCGCTGCTCATCAGATGGATATTGGGTCAACAAGAAAGGAGAGAAGGAACTTCCTACATGTACCCCAGTTTGTGGAGTCCATCATTCTGTAGACGGTGCACGGATATTTGGCGGCGCTCAAGCTAAACTTGGTCAATTTCCATGGCTGATCCAGTTCACTGTGCCAGAACTAGGCGGCGGTTCCCTAATATCTGATCGGTGGGTCCTGACAGCTGCTCACGTGCTCAAGAATGAATTCCCAGAAATGTATGGGGGCGTGATGAAGCTTTCTCCAAATGTTAATTCACGACCCAAGCAAAACAAACTGCAGTTCAAGAAAATTATTGTTCATCCTCTGTATCGTGGAGGAGAAAACTATGACAATGACATTGCTCTGATCCAACTGAGTAAGAAAGTCAAAATGGACAAATGTATCTCTCCCATCTGTCTTCCAAGGAGGGGACTTGCCCCTGTGGTTAATGAGGTTGCCCTTATTGCAGGATGGGGTAGGACTAAAAAGAGAGACTATGCAATAAATTTGCAGTTTGCCAAGATCTTTCTCAGCTCCATGGATAAATGTAGCAGGCACTGCTGGCGGTGGTATTCACTGCAACATCTGTGTGCTGATCAAAGATGACGGACAGTGCAGGTGATACGGGGGCCTCATGTCAGACCCAGACGCATAATATATGCAGCATGGCTGGCCACGA
  5   1   2       bld Skin                            IMAGE:8642647.5p                                                                                                                                                                                  AAAGGAGAGAAGGAACTTCCTACATGTACCCCAGTTTGTGGAGTCCATCATTCTGTAGACGGTGCACGGATATTTGGCGGCGCTCAAGCTAAACTTGGTCAATTTCCATGGCTGATCCAGTTCACTGTGCCAGAACTAGGCGGCGGTTCCCTAATATCTGATCGGTGGGTCCTGACAGCTGCTCACGTGCTCAAGAATGAATTCCCAGAAATGTATGGGGGCGTGATGAAGCTTTTTCCAAATGTTAATTCACGACCCAAGCAAAACAAACTGCAGTTCAAGAAAATTATTGTTCATCCTCTGTATCGTGGAGGAGAAAACTATGACAATGACATTGCTCTGATCCAACTGAGTAAGAAAGTCAAAATGGACAAATGTATCTCTCCCATCTGTCTTCCAAGGAGGGGACTTGCCCCTGTGGTTAATGAGGTTGCCCTTATTGCAGGATGGGGTAGGACTAAAAAGAGAGACTATGCAATAAATTTGCAGTTTGCCAAGATCTTTCTCAGCTCCATGGATAAATGTAAGCAGGCAACTGCTGGCGGTGGTTATATCACTGCAAACATGCTGTGTGCTGGATCAGAAGATGGACAGGACAGTTGCCAGGGTGATAGCGGGGGGCCACTCATGTTCAGGGACCCCAAGAAGCAGTAAAAATTATGGCACGCTTGTGTCTGGGGCCACACGATGGGATTCATGGCTTTAACCAAGTGGATAATACTTGACTGATGAGAAACTATCACACCGAAGGAAACAGAGAGTGAAACAGTCGTGTCTGAGTTGCCTGAGACTGAGCCCTCGACCATC
  5   1   2       bld FaB                             IMAGE:8072581.5p                                                                                                                                                                                                                                                                                                                  GCCAGAACTAGGCGGCGGTTCCCTAATATCTGATCGGTGGGTCCTGACAGCTGCTCACGTGCTCAAGAATGAATTCCCAGAAATGTATGGGGGCGTGATGAAGCTTTTTCCAAATGTTAATTCACGACCCAAGCAAAACAAACTGCAGTTCAAGAAAATTATTGTTCATCCTCTGTATCGTGGAGGAGAAAACTATGACAATGACATTGCTCTGATCCAACTGAGTAAGAAAGTCAAAATGGACAAATGTATCTCTCCCATCTGTCTTCCAAGGAGGGGACTTGCCCCTGTGGTTAATGAGGTTGCCCTTATTGCAGGATGGGGTAGGACTAAAAAGAGAGACTATGCAATAAATTTGCAGTTTGCCAAGATCTTTCTCAGCTCCATGGATAAATGTAAGCAGGCAACTGCTGGCGGTGGTTATATCACTGCAAACATGCTGTGTGCTGGATCAGAAGATGGACGGGACAGTTGCCAGGGTGATAGCGGGGGGCCACTCATGTTCAAGGACCCCCAAGACAGCAGTAAAATATATATGGCAGGCATTGTGTCCTGGGGCCCACAGGAATGTGGATCCTATGGCTTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGAAGACCATAGCAGCGACGGAGAGAGAAGAGCAGGAGGAGGTGGAGACACANGTGCTGTGTGCGTGAGTGTTGCGCTCTAGAGAGACAGTGATGCTCAGCGTCCGAACACAGTTACTTACGACATNCAATCAGAGCAA
  5   1   2       bld Lmb2                            IMAGE:8639356.5p                                                                                                                                                                                                                                                                                                                                               CTGATCGGTGGGTCCTGACAGCTGCTCACGTGCTCAAGAATGAATTCCCAGAAATGTATGGGGGCGTGATGAAGCTTTCTCCAAATGTTAATTCACGACCCAAGCAAAACAAACTGCAGTTCAAGAAAATTATTGTTCATCCTCTGTATCGTGGAGGAGAAAACTATGACAATGACATTGCTCTGATCCAACTGAGTAAGAAAGTCAAAATGGACAAATGTATCTCTCCCATCTGTCTTCCAAGGAGGGGACTTGCCCCTGTGGTTAATGAGGTTGCCCTTATTGCAGGATGGGGTAGGACTAAAAAGAGAGACTATGCAATAAATTTGCAGTTTGCCAAGATCTTTCTCAGCTCCATGGATAAATGTAAGCAGGCAACTGCTGGCGGTGGTTATATCACTGCAAACATGCTGTGTGCTGGATCAGAAGATGGACAGGACAGTTGCCAGGGTGATAGCGGGGGGCCACTCATGTTCAAGGACCCCCAAGACAGCAGTAAAATATATATGGCAGGCATTGTGTCCTGGGGCCCACAGGAATGTGGATCCTATGGCTTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGAAGACCATAGCAGCGACGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGCTGTGTGCGTGAGTGTTGCGCTCTAGAGAGACAGTGATGCTCAGCGTCCGACACA
  3   1   2       bld Brn1      out                   IMAGE:6950965.3p                                                                                                                                                                                                                                                                                                                                                                                                                                          NAACAAAACTGCCGTTCCAGGAAAAATAATGGTTCATCCCTCGGAATCGGGGAGGGAGAAAAATTATGAACAATGAACATTGTTCTGATCCAAATGAAGGTAAGAAAAGTCAAAAATGGACAAAATGTATCTCTCCCCATCTGTCTCCAAGGGAGGGGACTTGCCCCTGTGTTTAATGAGGTTGCCCTTATTGCAGGATGGGGGTAGGACTAAAAAGAGAGACTATGCAATAAATTTGCAGTTTGCCAAGATCTTTCTCAGCTCCATGGATAAATGTAAGCAGGCAACTGCTGGCGGTGGTTATATCACTGCAAACATGCTGTGTGCTGGATCAGAAGATGGACAGGACAGTTGCCAGGGTGATAGCGGGGGGCCACTCATGTTCAAGGACCCCCAAGACAGCAGTAAAATATATATGGCAGGCATTGTGTCCTGGGGCCCACAGGAATGTGGATCCTATGGCTTTTACACCAAGGTGGATAATTCCCTTGACTGGATTGAGAAGACCATAGCAGCGACGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGCTGTGTGCGTGAGTGTTGCGCTCTAGAGAGACAGTGATGCTCAGCGTCCGACACAAGTTACTTACGACATCAAATCAGAGCAAGTTGTATCCTACAGAAATGTCATTAAACAACACTATTCCCCTTCTGTGCCCAGATAGATTGGGAAATTCTACTATATATACTGCTATAATGCAAATTCCTCATTGAGCATCATGATATAGCTAATGAACTCATTGTTTTTCCATTTTCTGGTTATATTTTTTCTAATGGAAGTATAAAAGGTGAATATAGAATTGTATTCCTGTTTCCTTCTCCTCTAGGCAGCTCCTGTGAAGTCCC
  3   1   2      seed FaB  5g3  out                   IMAGE:8070152.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACTGAGTAAGAAAGTCAAAATGGACAAATGTATCTCTCCCATCTGTCTTCCAAGGAGGGGACTTGCCCCTGTGGTTAATGAGGTTGCCTTTATTGCAGGATGGGGTAGGACTAAAAAGAGAGACTATGCAATAAATTTGCAGTTTGCCAAGATCTTTCTCAGCTCCATGGATAAATGTAAGCAGGCAACTGCTGGCGGTGGTTATATCACTGCAAACATGCTGTGTGCTGGATCAGAAGATGGACGGGACAGTTGCCAGGGTGATAGCGGGGGGCCACTCATGTTCAAGGACCCCCAAGACAGCAGTAAAATATATATGGCAGGCATTGTGTCCTGGGGCCCACAGGAATGTGGATCCTATGGCTTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGAAGACCATAGCAGCGACGGAGAGAGAAGAGCAGGAGGAGGTGGAGACACAGGTGCTGTGTGCGTGAGTGTTGCGCTCTAGAGAGACAGTGATGCTCAGCGTCCGACACAAGTTACTTACGACATCAAATCAGAGCAAGTTGTATCCTACAGAAATGTCATTAAAAAACACTATTCCCCTTCTGTGCCCAGATAGATTGGGAAATTCTACTATATATACTGCTATAATGCAAATTCCTCATTGAGCATCATAATATAGCTAATGAACTCATTGTTTTTCCATTTTCTGGTTATATTTTTCTAATGGAACTATAAAAGGTGAATATAGAATTGTATTCCTGTTTCCTTCTCCTCTAGGCAGCTCCTGTGAAGTGCCCCATTTGCACGCTTTATTGATAGTTAAAGAAAGAGCAAATAGCATAAA
  3   1   2       bld Te2N      in                    IMAGE:7764036.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAGAGAGACTATGCAATAAATTTGCAGTTTGCCAAGATCTTTCTCAGCTCCATGGATAAATGTAAGCAGGCAACTGCTGGCGGTGGTTATATCACTGCAAACATGCTGTGTGCTGGATCAGAAGATGGACGGGACAGTTGCCAGGGTGATAGCGGGGGGCCACTCATGTTCAAGGACCCCCAAGACAGCAGTAAAATATATATGGCAGGCATTGTGTCCTGGGGCCCACAGGAATGTGGATCCTATGGCTTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGAAGACCATAGCAGCGACGGAGAGAGAAGAGCAGGAGGAGGTGGAGACACAGGTGCTGTGTGCGTGAGTGTTGCGCTCTAGAGAGACAGTGATGCTCAGCGTCCGACACAAGTTACTTACGACATCAAATCAGAGCAAGTTGTATCCTACAGAAATGTCATTAAAAAACACTATTCCCCTTCTGTGCCCAGATAGATTGGGAAATTCTACTATATATACTGCTATAATGCAAATTCCTCATTGAGCATCATAATATAGCTAATGAACTCATTGTTTTTCCATTTTCTGGTTATATTTTTCTAATGGAACTATAAAAGGTGAATATAGAATTGTATTCCTGTTTCCTTCTCCTCTAGGCAGCTCCTGTGAAGTGCCCCATTTTCACGCATATTCAAATTTAAGACAAAATAAAAAAAAAAAGATCAGTGAAAAAAAAAAA
  3   1   2       bld Li1  5g3  out                   IMAGE:3397399.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGGCAACTGCTGGCGGTGGTAATATCACTGCAAACATGCTGTGTGCTGGATCAGAAGATGGACAGGACAGTGGCCAGGGTGATAGCGGGGGGCCACTCATGTTCAAGGACCCCCAAGACAGCAGTANAATATATATGGCAGGCATTGTGTCCTGGGGCCCACAGGAATGTGGATCCTATGGCTTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGAAGACCATAGCAGCGACGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGCTGTGTGCGTGAGTGTTGCGCTCTAGAGAGACAGTGATGCTCAGCGTCCGACACAAGTTACTTACGACATCAAATCAGAGCAAGTTGTATCCTACAGAAATGTCATTAAACAACACTATTCCCCTTCTGTGCCCAGATAGATTGGGAAATTCTACTATATATACTGCTATAATGCAAATTCCTCATTGAGCATCATGATATAGCTAATGAACTCATTGTTTTTCCATTTTCTGGTTATATTTTTTCTAATGGAAGTATAAAAGGTGAATATAGA
  3   1   2       bld Brn1      out                   IMAGE:4740512.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATGCTGTGTGCTGGATCAGAAGATGGACAGGACAGTTGCCAGGGTGATAGCGGGGGGCCACTCATGTTCAAGGACCCCCAAGACAGCAGTAAAATATATATGGCAGGCATTGTGTCCTGGGGCCCACAGGAATGTGGATCCTATGGCTTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGAAGACCATAGCAGCGACGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGCTGTGTGCGTGAGTGTTGCGCTCTAGAGAGACAGTGATGCTCAGCGTCCGACACAAGTTACTTACGACATCAAATCAGAGCAAGTTGTATCCTACAGAAATGTCATTAAACAACACTATTCCCCTTCTGTGCCCAGATAGATTGGGAAATTCTACTATATATACTGCTATAATGCAAATTCCTCATTGAGCATCATGATATAGCTAATGAACTCATTGTTTTTCCATTTTCTGGTTATATTTTTTCTAATGGAAGTATAAAAGGTGAATATAGAAAAAAAAAAAAAA
  3   1   2       bld Sp1       out                   IMAGE:4174655.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATCAAATCAGAGCAAGTTGTATCCTACAGAAATGTCATTAAAAAACACTATTCCCCTTCTGTGCCCAGATAGATTGGGAAATTCTACTATATATACTGCTATAATGCAAATTCCTCATTGAGCATCATAATATAGCTAATGAACTCATTGTTTTTCCATTTTCTGGTTATATTTTTCTAATGGAACTATAAAAGGTGAATATAGAATTGTATTCCTGTTTCCTTCTCCTCTAGGCAGCTCCTGTGAAGTGCCCCATTTTCACGCATATTCAAATTTAAGAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)