Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012778217 Xl3.1-PBX0097C11.5 - 13 ESTs
                                                                       ....-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-PBX0097C11.5                                                                                                         GGCTGCAGTGATCGTGTTGCCGCGCTTAGAACAACTGTCCTCCCGGGTAGTGCGGGTGTTGGGGTGCAACCCGGGGCCCATGACTCTGCAGGGTACGAACACCTATTTGGTGGGCACCGGCTCGAGGCGGATTCTAATAGATACCGGGGAGCCGGCTGTTCCGGAATACATTAGCTGTTTGAAGCAAGCCCTGATTGAGTTCAACACTTCCATCCAGGAAATCATAGTGACACACTGGCATGTTGACCATGTGGGTGGAATAGCTGACATTAGCAGGGATATCATGAAGGGGTGCAATTTCTCCATCAACAAACTCCCTCGCAATCCCCATCAAGAAGAGGTCATAGCTGATCATAAGTACAACTATTTAAAAGATGGCGATATAATAACCACAGAAGGTGCCACCCTCAGAGTTCTCTATACACCAGGACATACAGATGACCACATGGCACTAGAGTTACTGGAGGAAAATGCTATCTTTTCTGGTGACTGCATCCTGGGGGAGGGGACTGCTGTTTTTGAGGACCTCTATGATTACATGAAATCTTTAGAAAAACTTCTGGAAATGAAAGCTGACAAAATATATCCAGGTCATGGCCCCGTGGTGCTGGGTGCAAGAGCCAAAATCCAAGAGTACATTTCCCATAGGCATGCCCGAGAACAACAGATACTTCAAGCTTTGCAAGAAAACCGTGGCAAATCCTTTACTTCAATGGATCTTGTCAAAATTGTGTACAAGGATACCCCTGAGTATTTACATAAAGCAGCAGAGTTTAACCTCACTCATCATTTACAGAAACTAAAAAAGGAAGGGAAAATATCAGAAGAACAATCCCCCACTGTCAGATGGAGAAGTAACTTATGAATAAGCATCAAAAACAAAATATCTTCACCAGACACTCTGTGTGTGTTGTGCAAGAACAGAAGAAGAGATGTGGGAGTATGGATGTTTGTTTCCAAAGCATTTAACAGTCACTGTTAATTTATTTTAATTTAATATAGATCTTTGCTTGATCCATAAATAATCATGTAACAAATATTGGTATAAACTTATATGCTGCATGTATTTGCCTCTTCACTACAGTCATTTGTCACAGTTATCCGCAGCATGTACATAAGAAACAGGGTGTGTTTTAATATTCTAATAAAATCCTTGTTTAGTTTTTACTGAGCGCTAGTTAGATATCCTGTTTATATTCCTTCCCATGAATTAGAACATATAAATATCAAACTGATTATGTTTTACTCAAGATTTAGGTCTATATATTTTGAATCTTTCTAACTCCTTTCCCTAATCAATCCACAGTCCTGATCTAGGACAGTCCCGCTATATTTATATAGGAAATTTATCCCTACAGTCTCAGTCTGCATATTTTTCCTGAGGTTTTACCT
                                                  Xl3.1-CHK-1012693269                                                                                                               TxTxxxCGTGTTGCCGCGCTTAGAACAACTGTCCTCCCGGGTAGTGCGGGTGTTGGGGTGCAACCCGGGGCCCATGACTCTGCAGGGTACGAACACCTATTTGGTGGGCACCGGCTCGAGGCGGATTCTAATAGATACCGGGGAGCCGGCTGTTCCGGAATACATTAGCTGTTTGAAGCAAGCCCTGATTGAGTTCAACACTTCCATCCAGGAAATCATAGTGACACACTGGCATGTTGACCATGTGGGTGGAATAGCTGACATTAGCAGGGATATCATGAAGGGGTGCAATTTCTCCATCAACAAACTCCCTCGCAATCCCCATCAAGAAGAGGTCATAGCTGATCATAAGTACAACTATTTAAAAGATGGCGATATAATAACCACAGAAGGTGCCACCCTCAGAGTTCTCTATACACCAGGACATACAGATGACCACATGGCACTAGAGTTACTGGAGGAAAATGCTATCTTTTCTGGTGACTGCATCCTGGGGGAGGGGACTGCTGTTTTTGAGGACCTCTATGATTACATGAAATCTTTAGAAAAACTTCTGGAAATGAAAGCTGACAAAATATATCCAGGTCATGGCCCCGTGGTGCTGGGTGCAAGAGCCAAAATCCAAGAGTACATTTCCCATAGGCATGCCCGAGAACAACAGATACTTCAAGCTTTGCAAGAAAACCGTGGCAAATCCTTTACTTCAATGGATCTTGTCAAAATTGTGTACAAGGATACCCCTGAGTATTTACATAAAGCAGCAGAGTTTAACCTCACTCATCATTTACAGAAACTAAAAAAGGAAGGGAAAATATCAGAAGAACAATCCCCCACTGTCAGATGGAGAAGTAACTTATGAATAAGCATCAAAAACAAAATATCTTCACCAGACACTCTGTGTGTGTTGTGCAAGAACAGAAGAAGAGATGTGGGAGTATGGATGTTTGTTTCCAAAGCATTTAACAGTCACTGTTAATTTATTTTAATTTAATATAGATCTTTGCTTGATCCATAAATAATCATGTAACAAATATTGGTATAAACTTATATGCTGCATGTATTTGCCTCTTCACTACAGTCATTTGTCACAGTTATCCGCAGCATGTACATAAGAAACAGGGTGTGTTTTAATATTCTAATAAAATCCTTGTTTAGTTTTTACTGAGCGCTAGTTAGATATCCTGTTTATATTCCTTCCCATGAATTAGAACATATAAATATCAAACTGATTATGTTTTACTCAAGATTTAGGTCTATATATTTTGAATCTTTCTAACTCCTTTCCCTAATCAATCCACAGTCCTGATCTAGGACAGTCCCGCTATATTTATATAGGAAATTTATCCCTACAGTCTCAGTCTGCATATTTTTCCTGAGGTTTTACCTGCATTT
                                                      consensus depths                                                                                                              2     4     2     5     2     5     3     5     3     5     3     5     4     6     4     6     4     6     4     6     4     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     8     8    10    10    10    10    10    10    10    10    10    10    11    10    11    10    11     9    11     8    11     8    10     8    10     7    10     6     9     5     9     5     9     4     9     4     9     4     9     4     8     4     8     4     7     4     7     4     7     4     7     4     7     4     8     4     8     4     7     4     7     4     7     4     7     4     7     5     7     5     7     5     7     5     7     5     7     5     6     5     6     6     7     6     7     6     7     6     7     6     7     5     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     1     3     2     3     2     3     2     3     2     3     2     3     3     3     2     3
                                                                       PROTEIN --- Ce ---- 8e-073     NP_001122663.1 Y53F4B.39b [Caenorhabditis elegans] -----------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                      PROTEIN === Dm ==== 2e-075     NP_609183.1 CG12375-PA [Drosophila melanogaster] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                      PROTEIN -== Ag ==== 9e-080     XP_313152.3 AGAP004236-PA [Anopheles gambiae str. PEST] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                   PREDICTED = Sp ==== 3e-098     XP_001177319.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                   PROTEIN --- Mm ==== 3e-109     NP_663356.1 lactamase, beta 2; CGI-83 protein [Mus musculus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                   PREDICTED = Dr ==== 1e-111     NP_998049.1 hypothetical protein zgc:77065 [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                   PREDICTED = Cf ==== 1e-112     XP_544119.2 PREDICTED: similar to lactamase, beta 2 isoform 1 [Canis familiaris] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                   PROTEIN --- Bt ==== 3e-114     NP_001069513.1 lactamase, beta 2 [Bos taurus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                   PROTEIN -== Hs ==== 4e-116     NP_057111.1 lactamase, beta 2 [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                   PREDICTED = Gg ==== 8e-119     XP_418292.2 PREDICTED: similar to CGI-83 protein [Gallus gallus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                PROTEIN === Xt ==== 8e-157     Q0V9A9.1 Beta-lactamase-like protein 2 [Xenopus tropicalis]  =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                PREDICTED - Xl ==== 5e-164     NP_001088412.1 hypothetical protein LOC495268 [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xl3.1-PBX0097C11.5                                                                                                                                                                                        ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------ATG------------------------------TAA------------TAA---------------------TAA------ATGTAA------------TAA------ATG---------------------------------------------------ATG---------------------------------------------------------TGA------------------------------------------------------------------ATG---------------------------------------TAA---------------------------TGA
                                                                   ORF                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
  5   1   2       bld Brn1                            IMAGE:6953531.5p                                                                         TCCGGATCTTCCGTCTACTCCACCGTCCTTGAGATGTCTCTCTCCGTGTTGCCGCGCTTAGAACAACTGTCCTCCCGGGTAGTGCGGGTGTTGGGGTGCAACCCGGGGCCCATGACTCTGCAGGGTACGAACACCTATTTGGTGGGCACCGGCTCGAGGCGGATTCTAATAGATACCGGGGAGCCGGCTGTTCCGGAATACATTAGCTGTTTGAAGCAAGCCCTGATTGAGTTCAACACTTCCATCCAGGAAATCATAGTGACACACTGGCATGTTGATCATGTGGGTGGAATAGCTGACATTAGCAGGGATATCATGAAGGGGTGCAATTTCTCCATCAACAAACTCCCTCGCAATCCCCATCAAGAAGAGGTCATAGCTGATCATAAGTACAACTATTTAAAAGATGGCGATATAATAACCACAGAAGGTGCCACCCTCAGAGTTCTCTATACACCAGGACATACAGATGACCACATGGCACTAGAGTTACTGGAGGAAAATGCTATCTTTTCTGGTGACTGCATCCTGGGGGAGGGGACTGCTGTTTTTGAGGACCTCTATGATTACATGAAATCTTTAGAAAAACTTCTGGAAATGAAAGCTGACAAAAAATATCCAGGTCATGGCCCCCGTGGTGGCTGGGTTGCAAGAACCCAAAATCCCAGGAGTACCTTTTCCCCAATAAGGCCTTGGCCCCGGAGAAACCTACCAGAATTACCTTTCCAAGGCCTTTTGGCCCGAGAAAAAAACCCGTGGGGCCAAAAATCCCTTTTTACCCCTCCAATTGGGAATACTTTTGTACCAAAACTTGGTTGTATAAAATGGAAATACCCCCCCTGGAGGTTATTGTAACCATAAAAAGCCCAACCCAGAATTTTTTAACCCTTCACCCCCTTATCATTTTTACAGGCAAACCTAACAATCCAGGGAATGGGGAAAAAATTACTCCCAAGAAACCAATACCCCCCCAACTGGTTCTCGATTGGGTAAAAAAATAAACCTTTATCTAAAATAACCCCATTTAAAGAACCAAAATATACGTCTTCTCCCACATAAAACACTTTGTGGGGGCCCC
  5   1   2       bld Tail                            IMAGE:8544831.5p                                                                                 AAAAANGNNCCATTGTTNNNNGCGNGTCATACAACTATTCGTCCCCGCCCTTAGAACACTGTCCTCCCGGGTAGTGCGGGTGTTGGGGTGCAACCCGGGACCCATGACTCTGCAGGGTACGAACACCTATTTGGTGGGCACCGGCTCGAGGCGGATTCTAATAGATACCGGGGAGCCGGCTGTTCCGGAATACATTAGCTGTTTGAAGCAAGCCCTGGTTGAGTTCAAGACTTCCATCCAGGAAATCATAGTGACACACTGGCATGTTGACCATGTGGGTGGAATAGCCGACATTAGCAGGGATATCATGAAGGGGTGCAATTTCTCCATCAACAAACTCCCTCGCAATCCCCATCAAGAAGAGGTCATAGCTGATCATAAGTACAACTATTTAAAAGATGGCGATATAATAACCACAGAAGGTGCCACCCTCAGAGTTCTCTATACACCAGGACATACAGATGACCACATGGCACTAGAGTTACTGGAGGAAAATGCTATCTTTTCTGGTGACTGCATCCTGGGGGAGGGGACTGCTGTTTTCGAGGACCTCTATGATTACATGAAATCTTTAGAAAAACTTCTGGAAATGAAAGCTGACAAAATATATCCAGGTCATGGCCCCGTGGTGCTGGGTGCAAGAGCCAAAATCCAAGAGTACATTTCCCATAGGCATGCCCGAGACAACAGATACTTCAAGCTTTGCAAGAAACCGTGACAAATCCTTTACTTCATGGATCTTGTCAAAATGTGTACAGGATACCCTGAGTATTAC
  5   1   2      seed Ga12      in                         XL213h21.5p                                                                                                     ACGAGGCTGCAGTGATCACATGCCCTGATTTGGACATTAGAAATGAAGCCGATCCAGTTCTTTGAGATGAATGCTGTTTTGACATTTGGCATGGATTATTGCTGAACACAATGCAAGTACAGACATTTAAGCGGATTCTAATAGATACCGGGGAGCCGGCTGTTCCGGAATACATTAGCTGTTTGAAGCAAGCCCTGATTGAGTTCAACACTTCCATCCAGGAAATCATAGTGACACACTGGCATGTTGACCATGTGGGTGGAATAGCTGACATTAGCAGGGATATCATGAAGGGGTGCAATTTCTCCATCAACAAACTCCCTCGCAATCCCCATCAAGAAGAGGTCATAGCTGATCATAAGTACAACTATTTAAAAGATGGCGATATAATAACCACAGAAGGTGCCACCCTCAGAGTTCTCTATACACCAGGACATACAGATGACCACATGGCACTAGAGTTACTGGAGGAAAATGCTATCTTTTCTGGTGACTGCATCCTGGGGGAGGGGACTGCTGTTTTTGAGGACCTCTATGATTACATGAAATCTTTAGAAAAACTTCTGGAAATGAAAGCTGACAAAATATATCCAGGTCATGGCCCCGTGGTGCTGGGTGCAAGAGCCAAAATCCAAGAGTACATTTCCCATAGGCATGCCCGAG
  5   1   2       bld Ga12      in                         XL213h20.5p                                                                                                      CGAGGCTGCAGTGATCACATGCCCTGATTTGGACATTAGAAATGAAGCCGATCCAGTTCTTTGAGATGAATGCTGTTTTGACATTTGGCATGGATTATTGCTGAACACAATGCAAGTACAGACATTTAAGCGGATTCTAATAGATACCGGGGAGCCGGCTGTTCCGGAATACATTAGCTGTTTGAAGCAAGCCCTGATTGAGTTCAACACTTCCATCCAGGAAATCATAGTGACACACTGGCATGTTGACCATGTGGGTGGAATAGCTGACATTAGCAGGGATATCATGAAGGGGTGCAATTTCTCCATCAACAAACTCCCTCGCAATCCCCATCAAGAAGAGGTCATAGCTGATCATAAGTACAACTATTTAAAAGATGGCGATATAATAACCACAGAAGGTGCCACCCTCAGAGTTCTCTATACACCAGGACATACAGATGACCACATGGCACTAGAGTTACTGGAGGAAAATGCTATCTTTTCTGGTGACTGCATCCTGGGGGAGGGGACTGCTGTTTTTGAGGACCTCTATGATTACATGAAATCTTTAGAAAAACTTCTGGAAATGAAAGCTGACAAAATATATCCAGGGTCATGGCCCCGTGGTGCTGG
  5   1   2       bld Te2N                            IMAGE:7768762.5p                                                                                                             TCTCTCTCCGTGTTGCCGCGCTTAGAACAACTGTCCTCCCGGGTAGTGCGGGTGTTGGGGTGCAACCCGGGGCCCATGACTCTGCAGGGTACGAACACCTATTTGGTGGGCACCGGCTCGAGGCGGATTCTAATAGATACCGGGGAGCCGGCTGTTCCGGAATACATTAGCTGTTTGAAGCAAGCCCTGATTGAGTTCAACACTTCCATCCAGGAAATCATAGTGACACACTGGCATGTTGATCATGTGGGTGGAATAGCTGACATTAGCAGGGATATCATGAAGGGGTGCAATTTCTCCATCAACAAACTCCCTCGCAATCCCCATCAAGAAGAGGTCATAGCTGATCATAGGTACAACTATTTAAAAGATGGCGATATAATAACCACAGAAGGTGCCACCCTCAGAGTTCTCTATACACCAGGACATACAGATGACCACATGGCACTAGAGTTACTGGAGGAAAATGCTATCTTTTCTGGTGACTGCATCCTGGGGGAGGGGACTGCTGTTTTTGAGGACCTCTATGATTACATGAAATCTTTAGAAAAACTTCTGGAAATGAAAGCTGACAAAATATATCCAGGTCATGGCCCCGTGGTGCTGGGTGGCAGAGCCAAAATCCAAGAGTACATTTCCATAGGCATGCCCGAGAACACAGATACTTCAGCTTTGCAGAAAGCGTGGCAATCTTTACTCATGGATCTGTCAATGTGACAGATCCCTGAGTATACTAAGCGCGAGTGACTCACATCTTTACGACTAAGAGAGGAATTCAAGACATCCCCTGCGATGGATATATATACTCAACATCTCCGACCGTGTGTGTG
  5   1   2       bld Egg1                               PBX0097C11.5p                                                                                                                                                                         TGCAACCCGGGGCCCATGACTCTGCAGGGTACGAACACCTATTTGGTGGGCACCGGCTCGAGGCGGATTCTAATAGATACCGGGGAGCCGGCTGTTCCGGAATACATTAGCTGTTTGAAGCAAGCCCTGATTGAGTTCAACACTTCCATCCAGGAAATCATAGTGACACACTGGCATGTTGACCATGTGGGTGGAATAGCTGACATTAGCAGGGATATCATGAAGGGGTGCAATTTCTCCATCAACAAACTCCCTCGCAATCCCCACCAAGAAGAGGTCATAGCTGATCATAAGTACAACTATTTAAAAGATGGCGATATAATAACCACAGAAGGAGCCACCCTCAGAGTTCTCTATACACCAGGACATACAGATGACCACATGGCACTAGAGTTACTGGAGGAAAATGCTATCTTTTCTGGTGACTGCATCCTGGGGGAGGGGACTGCTGTTTTTGAGGACCTCTATGATTACATGAAATCTTTAGAAAAACTTCTGGAAATGAAAGCTGACAAAATATATCCAGGTCATGGCCCCGTGGTGCTGGGTGCAAGAGCCAAAATCCAAGAGTACATTTCCCATAAGCATGCCCGAGAACAACAGATACTTCAAGCTTTTGCAAGAAAACCGTGGCAAATCCTTTACCTCAATGGATCTTGTCAAAAT
  5   1   2       bld Ooc1                              xlnoc002f13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAAATGCTATCTTTTCTGGTGACTGCATCCTGGGGGAGGGGACTGCTGTTTTTGAGGACCTCTATGATTACATGAAATCTTTAGAAAAACTTCTGGAAATGAAAGCTGACAAAATATATCCAGGTCATGGCCCCGTGGTGCTGGGTGCAAGAGCCAAAATCCAAGAGTACATTTCCCATAGGCATGCCCGAGAACAACAGATACTTCAAGCTTTGCAAGAAAACCGTGGCAAATCCTTTACTTCAATGGATCTTGTCAAAATTGTGTACAAGGATACCCCTGAGTATTTACATAAAGCAGCAGAGTTTAACCTCACTCATCATTTACAGAAACTAAAAAAGGAAGGGAAAATATCAGAAGAACAATCCCCCACTGTCAGATGGAGAAGTAACTTATGAATAAGCATCAAAAACAAAATATCTTCACCAGACACTCtgtgtgtgtgttgtgCAAGAACAGAAGAAGAGATGTGGGAGTAATGATGTT
  5   1   2       bld Ov1                             IMAGE:5047746.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATGAAATGTGTGAATGTTGCACATGCGAAAGAAAAGGGGACTGCTGTTTTTGAGGACCTCTATGATTACATGAAATCTTTAGAAAAACTTCTGGAAATGAAAGCTGACAAAATATATCCAGGTCATGGCCCCGTGGTGCTGGGTGCAAGAGCCAAAATCCAAGAGTACATTTCCCATAGGCATGCCCGAGAACAACAGATACTTCAAGCTTTGCAAGAAAACCGTGGCAAATCCTTTACTTCAATGGATCTTGTCAAAATTGTGTACAAGGATACCCCTGAGTATTTACATAAAGCAGCAGAGTTTAACCTCACTCATCATTTACAGAAACTAAAAAAGGAAGGGAAAATATCAGAAGAACAATCCCCCACTGTCAGATGGAGAAGTAACTTATGAATAAGCATCAAAAACAAAATATCTTCACCAGACACTCTGTGTGTGTTGTGCAAGAACAGAAGAAGAGATGTGGNAGTATGGATGTTTGTTTCCAAAGCATTTAACAGTCACTGTTAATTTATTTTAATTTAATATAGATCTTTGCTTGATCCATAAATAATCATGTAACAAATATTGG
  3   1   2       bld Ga12      in                         XL213h20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTGACTGCATCCTGGGGGAGGGGACTGCTGTTTTTGAGGACCTCTATGATTACATGAAATCTTTAGAAAAACTTCTGGAAATGAAAGCTGACAAAATATATCCAGGTCATGGCCCCGTGGTGCTGGGTGCAAGAGCCAAAATCCAAGAGTACATTTCCCATAGGCATGCCCGAGAACAACAGATACTTCAAGCTTTGCAAGAAAACCGTGGCAAATCCTTTACTTCAATGGATCTTGTCAAAATTGTGTACAAGGATACCCCTGAGTATTTACATAAAGCAGCAGAGTTTAACCTCACTCATCATTTACAGAAACTAAAAAAGGAAGGGAAAATATCAGAAGAACAATCCCCCACTGTCAGATGGAGAAGTAACTTATGAATAAGCATCAAAAACAAAATATCTTCACCAGACACTCTGTGTGTGTTGTGCAAGAACAGAAGAAGAGATGTGGGAGTATGGATGTTTGTTTCCAAAGCATTTAACAGTCACTGTTAATTTATTTTAATTTAATATAGATCTTTGCTTGATCCATAAATAATCATGTAACAAATATTGGTATAAACTTATATGCTGCATGTATTTGCCTCTTCACTACAGTCATTTGTCACAGTTATCCGCAGCATGTACATAAGAAACAGGGTGTGTTTTAATATTCTAATAAAATC
  3   1   2       bld Ga12      in                         XL213h21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GACTGCATCCTGGGGGGAGGGGACTGCTGTTTTTGAGGACCTCTATGATTACATGAAATCTTTAGAAAAACTTCTGGAAATGAAAGCTGACAAAATATATCCAGGTCATGGCCCCGTGGTGCTGGGTGCAAGAGCCAAAATCCAAGAGTACATTTCCCATAGGCATGCCCGAGAACAACAGATACTTCAAGCTTTGCAAGAAAACCGTGGCAAATCCTTTACTTCAATGGATCTTGTCAAAATTGTGTACAAGGATACCCCTGAGTATTTACATAAAGCAGCAGAGTTTAACCTCACTCATCATTTACAGAAACTAAAAAAGGAAGGGAAAATATCAGAAGAACAATCCCCCACTGTCAGATGGAGAAGTAACTTATGAATAAGCATCAAAAACAAAATATCTTCACCAGACACTCTGTGTGTGTTGTGCAAGAACAGAAGAAGAGATGTGGGAGTATGGATGTTTGTTTCCAAAGCATTTAACAGTCACTGTTAATTTATTTTAATTTAATATAGATCTTTGCTTGATCCATAAATAATCATGTAACAAATATTGGTATAAACTTATATGCTGCATGTATTTGCCTCTTCACTACAGTCATTTGTCACAGTTATCCGCAGCATGTACATAAGAAACAGGGTG
  3   1   2       bld Ga18                             rxlk107i12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAANNTNNGNAAATNAAGCTGNNAAAANNNNNNNANNTCANNNCCGNGNGCNNNNGNAGANCNAAAATCNANNNAGTANNTTTNCCATAGGNATNNCCGAGNNNAANAGATNCTTCAANNTTTGNAAGAAANCCGTGGNAANTCCTTTACTTCAATGGATCTTGTCAAAATTGTGTACAAGGATNCCCCTGAGTATTNACATAAAGCAGCAGAGTTTANCCTCACCCATCATTTACAGAAACTAAAAAAGGAAGGGAAAATATAAGAACANTCCCCCACTGTCAGATGGAGAAGTAACTTATGAATAAGCATCAAAAACAAAATATCTTCACCAGACACTCTGTGTGTGTGTGTGTGTTGTGCAAGAACAGAAGAAGAGATGTGGGAGTATGGATGTTTGTTTCCAAAGCATTTAACAGTCACTGTTAATTTATTTTAATTTAATATAGATCTTTGCTTGATCCATAAATAATCATGTAACAAATATTGGTATAAACTTATATGCTGCATTTATTTGCCTCTTCACTACAGTCATTTGTCACAGTTATCTGCAGCATGTACATAAGAAACAGGGTGTGTTTTAATATTCTAATAAAATCCTTGTTTAGTTTTTACTGAGCGCTAGTTAGATATCCTGTTTATATTTCTTCCCATGAATTAGAACATATAAATATCAAACTGATTATGTTTTACTCAAGATTTAGGTCTATATATTTGTGAATTTTTCTAAGTCCTTTCCAAAATAAAGCAAAAGTCCTGAGCTAGGAGAGTCCCACTATATTTATATAGGAAATTAACCCTACAGTCTCAGTCTGCATATTTTTCCTGAGGTTTTACCTNCATTTTNCCATTTCTATTGAGAATATTAACAAAGATATGTAATATAA
  5   1   2       bld Emb1                            IMAGE:6631402.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TATACAACACACCCCTACAAACCGAGGTTGAAAAAGAGGCTGGTACCGGNCCGGAAANTTACAAAAGTGAGGGACCCACGCGTCCGTTTCCACAGACACTCTGTGTGTGTTGTGCAAGAACAGAAGAAGAGATGTGGGAGTATGGATGTTTGTTTCCAAAGCATTTAACAGTCACTGTTAATTTATTTTAATTTAATATAGATCTTTGCTTGATCCATAAATAATCATGTAACAAATATTGGTATAAACTTATATGCTGCATGTATTTGCCTCTTCACTACAGTCATTTGTCACAGTTATCCGCAGCATGTACATAAGAAACAGGGTGTGTTTTAATATTCTAATAAAATCCTTGTTTACCCTCTACTGAGCGCTAGTTAGATATCCTGTTTATATTCCTTCCCATGAATTAGAACATATAAATATCAAACTGATTATGTCTTACTCAAGATTTATGCCTATATATTTTGAATCTTTCTAACTCCTTTCCCTAATCAATCCACAGTCCTGATCTAGGACAGTCCCGCTATATTTATATAGGAAATTTATCCCTACAGCCCGCCGCTGTATATTTTTCCCTGAGGACCACACCCTGCATTCTGGCCATTATCCCATTGTAGAACGCGCCGCGGGCGATTCTGTAGCTACTCCTCATCACCTGCCGTGACGGACCCGCTGGACCGATTGCCGTGCGCACATCCCTTATTCCCGTTGAGTACAATTGGCCAGTACTAAATGACGGAATTTTCCCTATCCTGAGCGCTACTTGGAACGTGCGACCTCCGTCTCAAGACAGCAACTGGGCCGCCACTCACCTCCGCTGTCCGCACCCGCGTCTGGGGAAGATATCCCCACCCTGTGCAAAGCAATCACATTTGGGCCCGTCCCTGACTCTCCCACACATGACCCTATACACCCTAACGTCCGTGCTGNCTACAGTCGAGTTCGATAATGTGCGGTGGAACATTCGACAATGACGCCACCCGCACGCGATTGTAGACGGCGATATTACGCGCTCTATACCCACCTTTGTTCACCCACNTCCCGCACTTGGAATTTAGCCCCGCCGATGACGACGGGTTGTTCTACGACTTTAACACTGCCTTAATCAACAACGCGACATTCTCATGTAGCGACTCCAGAGTGTACAGCTGACGCTCGTACACTTATCACTGCCTCCGGTTGTTCTCGACGCAACACACCCGTAACTTTTNCACCTCCTCATACACGGCCGGCAGCCTAAATATTCCCAACCGCGCCCGTGGGCGGGNGACCACAGTACAGCTTACGGGGCGGCGANGGGACTATAATGGGCTTACATGATGCATATTCCGCACTTCCCGCCGCGCG
  5   1   2       bld Emb1                   IMAGE:6631402-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTAACAGTCACTGTTAATTTATTTTAATTTAATATAGATCTTTGCTTGATCCATAAATAATCATGTAACAAATATTGGTATAAACTTATATGCTGCATGTATTTGCCTCTTCACTACAGTCATTTGTCACAGTTATCCGCAGCATGTACATAAGAAACAGGGTGTGTTTTAATATTCTAATAAAATCCTTGTTTAGTTTTTACTGAGCGCTAGTTAGATATCCTGTTTATATTCCTTCCCATGAATTAGAACATATAAATATCAAACTGATTATGTTTTACTCAAGATTTAGGTCTATATATTTTGAATTTTTCTAAGTCCTTTCCAAAATAAAGCAAAAGTCCTGAGCTAGGAGAGTCCCACTATATTTATATAGGAAATTTAACCCTACAGTCTCAGTCTGCATATTTTTCCTGAGGTTTTACCTGCATTTTGCCATTATCTATTGAGAATATGAACAAAGATTTATAATATAATACAATACACAAGAGTCATGAATATGCTGTAAATCATATCCTTATAAATGGTGCTTAGTGATTTCATCGGTTATAATTGGAGCTTAGTGATGGCATTTCTGTCACATGACTCACTGAAACTTGTGTATTATAATAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)