Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Oct 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     11.3300000000000001    0Xl3.1-rxlk71l07ex.3.5                      47 END     3          25        6                Fibroblast growth factor receptor 4 [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-rxlk71l07ex.3.5                      47 PI      89          1     1560                Fibroblast growth factor receptor 4 [Xenopus tropicalis]
     3   0.0    0Xl3.1-IMAGE:6954990.5.5                    35 PI      74         62      915                (no blast hit)
     4   0.0    0Xl3.1-IMAGE:8528261.5                      18 PI      75        443      916                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012778246 Xl3.1-xl229p03.5 - 12 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl229p03.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCAAGCTGTGCCCCCATGCTGCCTGGTGTCATGGAGGTCGAGTTACCACTGGACGCTAAATGGGAGTTCCCAAGAGACAGGCTTGTTCTGGGGAAGCCGCTTGGAGAGGGCTGCTTTGGACAAGTGGTAAGAGCAGAGGGATATGGAATTGAGAAAGACCGGCCTGAGAAACCAGTTACTGTTGCAGTTAAGATGCTCAAAGATAATGGCACAGACAAGGACTTATCAGATCTGATTTCTGAAATGGAGTTGATGAAGGTCATTGGAAAACACAAAAATATAATTAACTTGCTTGGAGTCTGCACTCAAGAGGGACCATTATTTGTTGTAGTTGAATATGCTTCTAAGGGGAATCTGCGTGAATTTCTACGTGCCAGGCGCCCTCCCACACCAGAAGATGCCTTTGATATCACCAAGGTTCCAGAGGAACTTTTGTCATTTAAAGATCTAGTGTCTTGCGCTTATCAAGTTGCCCGTGGCATGGAATACCTTGAATCTAAGAGGTGCATACACCGGGATCTGGCAGCCAGAAATGTTCTTGTTGCAGAAGATAATGTAATGAAAATTGCAGATTTTGGTTTAGCAAGAGGGGTTCATGACATTGATTATTACAAGAAAACTAGTAACGGTCGACTGCCTGTTAAATGGATGGCTCCAGAAGCTTTATTTGATAGAGTTTACACCCACCAGAGTGACATTTGGTCATTTGGAGTATTGACATGGGAAATCTTTACTCTTGGAGGGTCTCCATATCCTGGAATACCTGTAGAAGAATTATTTAAACTTTTACGGGAAGGTCATCGAATGGACAAACCATCCAACTGTACTCATGAATTGTATATGTTGATGAGGGAGTGCTGGCATGCGGTTCCAACTCAGAGACCAACATTTAAACAGCTGGTTGAACATCTGGACAGGATCCTTACAGCTGTTTCTGAAGAGTATCTGGACTTATCTATGCCATTTGAACAGTATTCTCCTTCCTGCGAAGATTCTGCAAGCACCTGTTCTTCATCCGATGATTCTGTTTTTGCCCCTGATCCTGTGCCATCCTCTCCGTGTGTCTTTAATTACCACAATATTCACAGTCAACTTGGGACTTGAAAACAATGAAGACTGCCCAAATTGGGAGATATGGACAATGAAAAACAGTGTTATTTCCTTTCCTAATAGGAAACGTATTTATATAAAAGGCGCCATATGTGGTATTATGGGGAATCGCTGTGCTGTTTCTCTGCTGTTCTGGAAGAATAAAGAAATGCCAAGCCAGTTTCAAATCGCGGATGCATAGCACTGAAAGCCAAAGCCACCCCATTCCGTGACAAGATGTCGTCACTTTGCTCTGGATTCTAAGGACTAGAGATGGCAGGGATTTATTTCCCCGGCCCCAAGAGATGGGCAAAAGTAGCACTGTGATCCCACTTGCCAGGGCACATGAACTTCTTAGCAACGGAGATAAGTTCACAGCTAAGGGTACTCTTACATTTGTACCCTGTAATCAAAGTGCCTAGAGTTTGTCATTATCTGTAAATATTTTCAGAAAATAAATTTTATTTATG
                                                  Xl3.1-CHK-1012693663                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGTGCCCCCATGCTGCCTGGTGTCATGGAGGTCGAGTTACCACTGGACGCTAAATGGGAGTTCCCAAGAGACAGGCTTGTTCTGGGGAAGCCGCTTGGAGAGGGCTGCTTTGGACAAGTGGTAAGAGCAGAGGGATATGGAATTGAGAAAGACCGGCCTGAGAAACCAGTTACTGTTGCAGTTAAGATGCTCAAAGATAATGGCACAGACAAGGACTTATCAGATCTGATTTCTGAAATGGAGTTGATGAAGGTCATTGGAAAACACAAAAATATAATTAACTTGCTTGGAGTCTGCACTCAAGAGGGACCATTATTTGTTGTAGTTGAATATGCTTCTAAGGGGAATCTGCGTGAATTTCTACGTGCCAGGCGCCCTCCCACACCAGAAGATGCCTTTGATATCACCAAGGTTCCAGAGGAACTTTTGTCATTTAAAGATCTAGTGTCTTGCGCTTATCAAGTTGCCCGTGGCATGGAATACCTTGAATCTAAGAGGTGCATACACCGGGATCTGGCAGCCAGAAATGTTCTTGTTGCAGAAGATAATGTAATGAAAATTGCAGATTTTGGTTTAGCAAGAGGGGTTCATGACATTGATTATTACAAGAAAACTAGTAACGGTCGACTGCCTGTTAAATGGATGGCTCCAGAAGCTTTATTTGATAGAGTTTACACCCACCAGAGTGACATTTGGTCATTTGGAGTATTGACATGGGAAATCTTTACTCTTGGAGGGTCTCCATATCCTGGAATACCTGTAGAAGAATTATTTAAACTTTTACGGGAAGGTCATCGAATGGACAAACCATCCAACTGTACTCATGAATTGTATATGTTGATGAGGGAGTGCTGGCATGCGGTTCCAACTCAGAGACCAACATTTAAACAGCTGGTTGAACATCTGGACAGGATCCTTACAGCTGTTTCTGAAGAGTATCTGGACTTATCTATGCCATTTGAACAGTATTCTCCTTCCTGCGAAGATTCTGCAAGCACCTGTTCTTCATCCGATGATTCTGTTTTTGCCCCTGATCCTGTGCCATCCTCTCCGTGTGTCTTTAATTACCACAATATTCACAGTCAACTTGGGACTTGAAAACAATGAAGACTGCCCAAATTGGGAGATATGGACAATGAAAAACAGTGTTATTTCCTTTCCTAATAGGAAACGTATTTATATAAAAGGCGCCATATGTGGTATTATGGGGAATCGCTGTGCTGTTTCTCTGCTGTTCTGGAAGAATAAAGAAATGCCAAGCCAGTTTCAAATCGCGGATGCATAGCACTGAAAGCCAAAGCCACCCCATTCCGTGACAAGATGTCGTCACTTTGCTCTGGATTCTAAGGACTAGAGATGGCAGGGATTTATTTCCCCGGCCCCAAGAGATGGGCAAAAGTAGCACTGTGATCCCACTTGCCAGGGCACATGAACTTCTTAGCAACGGAGATAAGTTCACAGCTAAGGGTACTCTTACATTTGTACCCTGTAATCAAAGTGCCTAGAGTTTGTCATTATCTGTAAATATTTTCAGAAAATAAATTTTATTTATGTACGTT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     5     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     6     6     5     6     4     6     5     6     5     6     5     6     6     7     6     7     6     7     6     7     6     7     5     6     5     6     5     6     5     6     4     6     4     6     4     5     4     5     4     5     4     5     3     5     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     3     2     3     2     3     2     3     2     3
                                                                       ...PROTEIN --- Ce ---- 2e-081     NP_001024723.1 EGg Laying defective family member (egl-15) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ci ---- 3e-097     Q4H3K6 Fibroblast growth factor receptor precursor (Ci-FGFR) [Ciona intestinalis]  -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 4e-097     NP_001014583.1 CG32134-PB, isoform B [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                           PROTEIN --- Ag ---- 3e-107     XP_562866.3 AGAP003108-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Sp ---- 2e-108     NP_999702.1 fibroblast growth factor receptor [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Bt ---- 4e-164     NP_776743.1 fibroblast growth factor receptor 3 [Bos taurus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 5e-168     XP_001789758.1 PREDICTED: fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome) [Bos taurus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Cf ---- 1e-169     NP_001003336.1 fibroblast growth factor receptor 2 [Canis familiaris] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 5e-170     NP_963895.2 fibroblast growth factor receptor 2 isoform IIIb [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 3e-170     NP_000132.2 fibroblast growth factor receptor 2 isoform 1 precursor [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 2e-170     NP_990650.1 fibroblast growth factor receptor 2 homolog [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 7e-180     NP_571505.1 fibroblast growth factor receptor 4 [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 0          AAI61582.1 Fibroblast growth factor receptor 4 [Xenopus tropicalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 0          NP_001082019.1 fibroblast growth factor receptor 4c [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-xl229p03.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATG------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG---ATG------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------TGA------TGA---------------------ATG------------------------------TAATAG---------------------------ATG------------------------------------------------TAA------------------------------------------------------------------------ATG---------------------TAA---------ATG------------------------------------------------TGA------------------ATG------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  5   1   2       bld Tbd7                                 XL070o16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTGATAGTGATTCTGTGCCGAATGCAGACACCCCACAGCAAGCAGACTCTGCAAACGCCAACTGTCCATAAACTGGCAAAGTTCCCCCTCATACGGCAGTTCTCTTTGGAGTCCAGCTCATCTGGAAAGTCTAGTGCTCCACTGATTCGCATAACTCGTCTCTCCTCAAGCTGTGCCCCCATGCTGCCTGGTGTCATGGAGGTCGAGTTACCACTGGACGCTAAATGGGAGTTCCCAAGAGACAGGCTTGTTCTGGGGAAGCCGCTTGGAGAGGGCTGCTTTGGACAAGTGGTAAGAGCAGAGGGATATGGAATTGAGAAAGACCGGCCTGAGAAACCAGTTACTGTTGCAGTTAAGATGCTCAAAGATAATGGCACAGACAAGGACTTATCAGATCTGATTTCTGAAATGGAGTTGATGAAGGTCATTGGAAAACACAAAAATATAATTAACTTGCTTGGAGTCTGCACTCAAGAGGGACCATTATTTGTTGTAGTTGAATATGCTTCTAAGGGGAATCTGCGTGAATTTCTACGTGCCAGGCGCCCTCCCACACCAGAAGATGCCTTTGATATCACC
  5   1   2       bld Ga15      out                      XL445j05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCAAGCTGTGCCCCCATGCTGCCTGGTGTCATGGAGGTCGAGTTACCACTGGACGCTAAATGGGAGTTCCCAAGAGACAGGCTTGTTCTGGGGAAGCCGCTTGGAGAGGGCTGCTTTGGACAAGTGGTAAGAGCAGAGGGATATGGAATTGAGAAAGACCGGCCTGAGAAACCAGTTACTGTTGCAGTTAAGATGCTCAAAGATAATGGCACAGACAAGGACTTATCAGATCTGATTTCTGAAATGGAGTTGATGAAAGTCATTGGAAAACACAAGAATATAATTAACTTGCTTGGAGTCTGCACTCAAGAGGGACCATTATTTGTTGTAGTTGAATATGCTTCTAAGGGGAATCTGCGTGAGTTTCTACGTGCCAGGCGCCCTCCCACACCAGAAGATGCCTTTGATATCACCAAGGTTCCAGAGGAACTTTTGTCATTTAAAGATCTAGTGTCTTGCGCTTATCAAGTTGCCCGTGGCATGGAATACCTTGAATCTAAGAGGTGCATACACCGGGATCTGGCAGCCAGAAATGTTCTTGTTGCAGAAGATAATGTAATGAAAATTGCAGATTTTGGTTTAGCAAGAGGGGTTCATGACATTGATTATTACAAGAAAACTAGTAACGGTCGACTGCCTGTTAAATGGATGGCTCCAGAAGCTTTATTTGATAGAGTTTACACCCACCAGAGTGACATTTGGTCATTTGGAGTATTGACATGGGAAATCTTTACTCTTGGAGGGTCTCCATATCCTGGAATACCTGTANAAGAATTATTTAAACTTTTACGGGAAGGTCATCGAA
  5   1   2      seed DMZ                                  xl229p03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCTGATTTCTGAAATGGAGTTGATGAAGGTCATTGGAAAACACAAAAATATAATTAACTTGCTTGGAGTCTGCACTCAAGAGGGACCATTATTTGTTGTAGTTGAATATGCTTCTAAGGGGAATCTGCGTGAATTTCTACGTGCCAGGCGCCCTCCCACACCAGAAGATGCCTTTGATATCACCAAGGTTCCAGAGGAACTTTTGTCATTTAAAGATCTAGTGTCTTGCGCTTATCAAGTTGCCCGTGGCATGGAATACCTTGAATCTAAGAGGTGCATACACCGGGATCTGGCAGCCAGAAATGTTCTTGTTGCAGAAGATAATGTAATGAAAATTGCAGATTTTGGTTTAGCAAGAGGGGTTCATGACATTGATTATTACAAGAAAACTAGTAACGGTCGACTGCCTGTTAAATGGATGGCTCCAGAAGCTTTATTTGATAGAGTTTACACCCACCAGAGTGACATTTGGTCATTTGGAGTATTGACATGGGAAATCTTTACTCTTGGAGGGTCTCCATATCCTGGAATACCTGTAGAAGAATTATTTAAACTTTTACGGGAAGGTCATCGAATGGACAAACCATCCAACTGTACTCATGAATTGTATATGTTGATGAGGGAGTGCTGGCATGCGGTTCCAACTCAGAGACCAACATTTAAACAGCTGGTTGAACATCTGGACAGGATCCTTACAGCTGTTTCTGAAGAGTATCTGGACTTATC
  5   1   2       bld Ga15                               XL414o21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTTGAATCTAAGAGGTGCATACACCGGGATCTGGCAGCCAGAAATGTTCTTGTTGCAGAAGATAATGTAATGAAAATTGCAGATTTTGGTTTAGCAAGAGGGGTTCATGACATTGATTATTACAAGAAAACTAGTAACGGTCGACTGCCTGTTAAATGGATGGCTCCAGAAGCTTTATTTGATAGAGTTTACACCCACCAGAGTGACATTTGGTCATTTGGAGTATTGACATGGGAAATCTTTACTCTTGGAGGGTCTCCATATCCTGGAATACCTGTAGAAGAATTATTTAAACTTTTACGGGAAGGTCATCGAATGGACAAACCATCCAACTGTACTCATGAATTGTATATGTTGATGAGGGAGTGCTGGCATGCGATTCCAACTCAGAGACCAACATTTAAACAGCTGGTTGAACATCTGGACAGGATCCTTACAGCTGTTTCTGAAGAGTATCTGGACTTATCTATGCCATTTGAACAGTATTCTCCTTCCTGCGAAGATTCTGCAAGCACCTGTTCTTCATCCGATGATTCTGTTTTTGCCCCTGATCCTGTGCCATCCTCTCCGTGTGTCTTTAATTACCACAATATTCACAGTCAACTTGGGACTTGAAAACAATGAAGACTGCCCAAATTGGGAGATATGGACAATGAAAAACAGTGTTATTTCCTTTCCTAATAGGAAACATATTTATATAAAAGGCGCCATATGTGGTATTATGGGGGAATCGCTGTGCTGTTTCTCTGCTGT
  5   1   2       bld Ga15                               XL481m05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCGGGATCTGGCAGCCANAAATGTTCTTGTTGCAGAAGATAATGTAATGAAAATTGCAGATTTTGGTTTAGCAAGAGGGGTTCATGACATTGATTATTACAAGAAAACTAGTAACGGTCGACTGCCTGTTAAATGGATGGCTCCAGAAGCTTTATTTGATAGAGTTTACACCCACCAGAGTGACATTTGGTCATTTGGAGTATTGACATGGGAAATCTTTACTCTTGGAGGGTCTCCATATCCTGGAATACCTGTANAAGAATTATTTACACTTTTACGGGAAGGTCNTCGAATGGACAAACCATCCAACTGTCCNCATGAATTGNAT
  5   1   2       bld Tbd7                                 XL096d08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATAGAGTTTACACCCACCAGNAGTGACATTTGGTCATTTGGAGTATTGACATGGGAAATCTTTACTCTTGGAGGGTCTCCATATCCTGGAATACCTGTAGAAGAATTATTTAAACTTTTACGGGAAGGTCATCGAATGGACAAACCATCCAACTGTACTCATGAATTGTATATGTTGATGAGGGAGTGCTGGCATGCGGTTCCAACTCAGAGACCAACATTTAAACAGCTGGTTGAACATCTGGACAGGATCCTTACAGCTGTTTCTGAAGAGTATCTGGACTTATCTATGCCATTTGAACAGTATTCTCCTTCCTGCGAAGATTCTGCAAGCACCTGTTCTTCATCCGATGATTCTGTTTTTGCCCCTGATCCTGTGATCCTCTCCGTGTGTCTTTAATTACCACAATATTCACAGTCAACTTGGGACTTGAAAACAATGAAGACTGCCCAAATTGGGAGATATGGACAATGAAAAACAGTGTTATTTGCTTTCCTAATAGGAAACGTATTTATATAAAAGGCGCCATATGTGGTATTATGGGGAATCGCTGTGCTGTTTCTCTGCTGTTCTGGAAGAATAAAGAAATGCCAAGCCAGTTTCAAATCGCGGATGCATAGCACTGAAAGCC
  5   1   2       bld Ga15                               XL499n03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTTACNGGAAGGNCATCGAATGGACAAACCATCCAACTGTACTCATGAATTGTATATGTTGATGAGGGAGTGCTGGCATGCGGTTCCAACTCAGAGACCAACATTTAAACAGCTGGTTGAACATCTGGACAGGATCCTTACAGCTGTTTCTGAAGAGTATCTGGACTTATCTATGCCATTTGAACAGTATTCTCCTTCCTGCGAAGATTCTGCAAGCACCTGTTCTTCATCCGATGATTCTGTTTTTGCCCCTGATCCTGTGCCATCCTCTCCGTGTGTCTTTAATTACCACAATATTCACAGTCAACTTGGGACTTGAAAACAATGAANACTGCCCAAATTGGGAGATATGGACAATGAAAAACAGTGTTATTTCCTTTCCTAATA
  5   1   2       bld Ga15      in                       XL515o01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAATGGACAAACCATCCAACTGTACTCATGAATTGTATATGTTGATGAGGGAGTGCTGGCATGCGGTTCCAACTCAGAGACCAACATTTAAACAGCTGGTTGAACATCTGGACAGGATCCTTACAGCTGTTTCTGAAGAGTATCTGGACTTATCTATGCCATTTGAACAGTATTCTCCTTCCTGCGAAGATTCTGCAAGCACCTGTTCTTCATCCGATGATTCTGTTTTTGCCCCTGATCCTGTGCCATCCTCTCCGTGTGTCTTTAATTACCACAATATTCACAGTCAACTTGGGACTTGAAAACAATGAAGACTGCCCAAATTGGGAGATATGGACAATGAAAAACAGTGTTATTTCCTTTCCTAATAGGAAACGTATTTATATAAAAGGCGCCATATGTGGTATTATGGGGAATCGCTGTGCTGTTTCTCTGCTGTTCTGGAAGAATAAAGAAATGCCAAGCCAGTTTCAAATCGCGGATGCATAGCACTGAAAGCCAAAGCCACCCCATTCCGTGACAAGATGTCGTCACTTTGCTCTGGATTCTAAGGACTAGAGATGGCAGGGATTTATTTCCCCGGCCCCAAGAGATGGGCAAAAGTAGCACTGTGATCCCACTTGCCAGGGCACATGAACTTCTTAGCAACGGAGATAAGTTCACAGCTAAGGGTACTCTTACATTTGTACCCTGTAATCAAAGTGCCTAGAGTTTGTCATTATCTGTAAATATTTTCAGAAAATAAATTTTATTTATGTACGTTTTATA
  5   1   2       bld Ga18      out                     xlk140l09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATTCTGTTTTTGCCCCTGATCCTGTGCCATCCTCTCCGTGTGTCTTTAATTACCACAATATTCACAGTCAACTTGGGACTTGAAAACAATGAAGACTGCCCAAATTGGGAGATATGGACAATGAAAAACAGTGTTATTTCCTTTCCTAATAGGAAACGTATTTATATAAAAGGCGCCATATGTGGTATTATGGGGAATCGCTGTGCTGTTTCTCTGCTGTTCTGGAAGAATAAAGAAATGCCAAGCCAGTTTCAAATCGCGNNNNNTAGCACTGAAAGCCAAAGCCACCCCATTCCGTGACAAGATGTCGTCACTTTGCTCTGGATTCTAAGGACTAGAGATGGCAGGGATTTATTTCCCCGGCCCCAAGAGATGGGCAAAAGTAGCACTGTGATCCCACTTGCCAGGNCACATGAACTTCTTAGCAACGGAGATAAGTTCACAGCTAAGGGTACTCTTACATTTGTACCCTGTAATCAAAGTGCCTAGAGTTTGTCATTATCTGTAAATATTTTCAGAAAATAAATTTTATTTATGTACGTTTTATATGAAGCAGACAATAGGTCAGTTGCCAGGTTAGAAAAGAAGATTTCAtttttttacactttttttttttttttttAATTAATTGAATTTGGATAATACCAGACACATAANTTATCTCCTTTGTGTTTATAGATATATGTACCTTGAACCTGGACAAACATTTTAAAATGAATTGGCCATAAATGCTTTTNTACATTATAGATCTATTTAANACAGAGAANNNNTNNTCTTTTNCAANNNNCAAAGNTTCATATTTCNNNTGATTNTTT
  3   1   2       bld Ga15      out                      XL488e11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTNGCCCCTGATCCTGNGCCATCCTCTCCGNGNGTCTTTAATTACCACAATATTCACAGTCAACTTGGGACTTGAAAACAATGAAGACTGCCCAAATTGGGAGATATGGACAATGAAAAACAGTGTTATTTCCTTTCCTAATAGGAAACGTATTTATATAAAAGGCGCCATATGNGGTATTATGGGGAATCGCTGTGCTGTTTCTCTGCTGTTCTGGAAGAATAAAGAAATGCCAAGCCAGTTTCAAATCGCGGATGCATAGCACTGAAAGCCAAAGCCACCCCATTCCGTGACAAGATGTCGTCACTTTGCTCTGGATTNTAAGGACTAGAGATGGCAGGGATTTATTTCCCCGGCCCCAAGAGATGGGCAAAAATAGCACTGTGATCCCACTTGCCAGGGCACATGAACTTCTTAGCAACGGAGATAAGTTCACAGCTAAGGGTACTCTTACATTTGTACCCTGTAATCAAAGTGCCT
  5   1   2       bld Ga15                               XL469d06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTGAAAACAATGAAGACTGCCCAAATTGGGAGATATGGACAATGAAAAACAGTGTTATTTCCTTTCCTAATAGGAAACGTATTTATATAAAAGGCGCCATATGTGGTATTATGGGGAATCGCTGTGCTGTTTCTCTGCTGTTCTGGAAGAATAAAGAAATGCCAAGCCAGTTTCAAATCGCGGATGCATAGCACTGAAAGCCAAAGCCACCCCATTCCGTGACAAGATGTCGTCACTTTGCTCTGGATTCTAAGGACTAGAGATGGCAGGGATTTATTTCCCCGGCCCCAAGAGATGGGCAAAAGTAGCACTGTGATCCCACTTGCCAGGGCACATGAACTTCTTAGCAACGGAGATAAGTTCACAGCTAAGGGTACTCTTACATTTGTACCCTGTAATCAAAGTGCCTAGAGTTTGTCATTATCTGTAAATATTTTCAGAAAATAAATTTTATTTATGTACGTTTTATATGAAGCAGACAATAGGTCA
  3   1   0       add Ga15      in                       XL515o01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAGAAAAGNAGNTTTCNTTTTTTTnCCCnTTTTTTTTTTTTTTTTTAATTAATTGAATTTGGATAATACCAGACACATAATTTATCTCCTTTGTGTTTATAGATATATGTACCTTGAACCTGGACAAACATTTTAAAATGAANTGGCCATAAATGCTTTTATACATTATAGATCTATTTAATACAGAGAAATGTTGCTCTTTCGCAAANNNCCAAAAGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)