Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 21 Sep 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL102p06.3                            5 END     1          12       20                enhancer of split related 2 [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL102p06.3                            5 PI      78        372     1015                enhancer of split related 2 [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012778289 Xl3.1-IMAGE:3548249-IMAGp.5 - 8 ESTs
                                                                       .........-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:3548249-IMAGp.5                                                                                                                                                                                                                                      TGGCTGTCAACGGTGAAACCAATCTCATCTCCAGAGAATATGCTGCAGATAAACTAACTACTAAACAGAAAACCAAGATAAGGAAACCAATGGTGGAGAAGATGCGCAGGGACCGTATCAACAGCAGCATTAACCAGCTCCGGAATCTCTTGGAGCAGGAATTCCAGCTCCTCCAGCCTGACTCCAAGCCAGAGAAAGCCGACATCCTGGAATTAGCTGTGAAGTTCCTCAAGCAACAGATCTGCAGCCAACCACAAAATAATAAATCATATCAAAGAAAAGACTATCGAGACTTTAGTCAAGGCTACTCCAAATGCCTCCACGAGACGCTTGCCTTCCTCTCTTTTCACCGTGTTGAGGAGCACATGCAACTTAAACTGATTAATCATTTCCATTGTTTGGATACCCAGCCCACAAGCACTCCAGTCTCTTCTCCTCATTCCAAGGGGCCTGGGCCACTGGCTAGCACAAAGATTCTTTGGAGGCCATGGTAAAGGACAGTACTAAACACCTTCACAGTGATGCAAAGAGTTATGTGCAACTTGATCTGTGCTACCACTCTTTTGGATGGTTACCTTCATGTAATTACTGACTGCTTCATAATGAAGAATATATACTCAGTACAAAGGATCATACTTTTATATGGTTGGACTCAATTATGCTCTGTATATTTTTTTTTTATATGAAAGTTTATTTGAAGAGATATATTGGTTACCCTAGGCTGAATGCAGGCAGGCCGGACTTGCAACCCTCTGACAATTTGGCCCTGAGGAAACTTGCAAATTCTGCAATGGTTAATCCATGGCACTTAAGAAACAGAATTGAAATAACAGATTACATTATATTATATAGAGTGTGACAATCATGATAAAATGAATGTGTATATCAGATATGTCTTTTGACTATTTTCAGGACTTCTATAGTTAGCAAAGCGCTTACATTGTTCTACAATATTTGTAGCATGTCCCTTAGTTATGGTTATAATAACCACGTATAAAATGAACGGTTCATTGTTTATACCCTTGCAAAACA
                                                  Xl3.1-CHK-1012698404                                                                                                                                                                                                                                            TCAACGGTGAAACCAATCTCATCTCCAGAGAATATGCTGCAGATAAACTAACTACTAAACAGAAAACCAAGATAAGGAAACCAATGGTGGAGAAGATGCGCAGGGACCGTATCAACAGCAGCATTAACCAGCTCCGGAATCTCTTGGAGCAGGAATTCCAGCTCCTCCAGCCTGACTCCAAGCCAGAGAAAGCCGACATCCTGGAATTAGCTGTGAAGTTCCTCAAGCAACAGATCTGCAGCCAACCACAAAATAATAAATCATATCAAAGAAAAGACTATCGAGACTTTAGTCAAGGCTACTCCAAATGCCTCCACGAGACGCTTGCCTTCCTCTCTTTTCACCGTGTTGAGGAGCACATGCAACTTAAACTGATTAATCATTTCCATTGTTTGGATACCCAGCCCACAAGCACTCCAGTCTCTTCTCCTCATTCCAAGGGGCCTGGGCCACTGGCTAGCACAAAGATTCTTTGGAGGCCATGGTAAAGGACAGTACTAAACACCTTCACAGTGATGCAAAGAGTTATGTGCAACTTGATCTGTGCTACCACTCTTTTGGATGGTTACCTTCATGTAATTACTGACTGCTTCATAATGAAGAATATATACTCAGTACAAAGGATCATACTTTTATATGGTTGGACTCAATTATGCTCTGTATATTTTTTTTTTATATGAAAGTTTATTTGAAGAGATATATTGGTTACCCTAGGCTGAATGCAGGCAGGCCGGACTTGCAACCCTCTGACAATTTGGCCCTGAGGAAACTTGCAAATTCTGCAATGGTTAATCCATGGCACTTAAGAAACAGAATTGAAATAACAGATTACATTATATTATATAGAGTGTGACAATCATGATAAAATGAATGTGTATATCAGATATGTCTTTTGACTATTTTCAGGACTTCTATAGTTAGCAAAGCGCTTACATTGTTCTACAATATTTGTAGCATGTCCCTTAGTTATGGTTATAATAACCACGTATAAAATGAACGGTTCATTGTTTATACCCTTGCAAAACAAGTAAG
                                                      consensus depths                                                                                                                                                                                                                                           2     2     3     4     3     4     3     4     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     4     5     5     6     6     7     6     7     6     7     6     7     5     7     5     7     5     7     5     7     5     6     4     6     4     6     4     6     4     6     3     6     3     6     3     5     3     5     3     5     3     5     3     5     3     4     3     4     3     4     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ce ---- 2e-007     NP_500281.1 abnormal cell LINeage LIN-22, Helix Loop Helix containing protein,antero-posterior patterning factor, hairy and enhancer of split homolog (19.5kD) (lin-22) [Caenorhabditis elegans] ======================
                                                                       PROTEIN --- Dm ---- 7e-008     NP_523657.1 Hairy/E(spl)-related with YRPW motif CG11194-PA [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                       PROTEIN --- Ag ---- 4e-009     XP_564803.3 AGAP007450-PA [Anopheles gambiae str. PEST] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                         PROTEIN --- Ci ---- 2e-012     NP_001071685.1 transcription factor protein [Ciona intestinalis] ========================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                   PROTEIN -== Sp ==== 1e-012     NP_001001768.1 hairy and enhancer of split [Strongylocentrotus purpuratus] ===================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                    PROTEIN --- Dr ---- 8e-025     NP_991182.1 bHLH transcription factor [Danio rerio] ================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Mm ---= 9e-026     NP_034549.1 hairy and enhancer of split 5, (Drosophila) [Mus musculus] ==============================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                   PREDICTED - Cf ---= 6e-027     XP_546734.2 PREDICTED: similar to hairy and enhancer of split 5 [Canis familiaris] ==================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Bt ---= 4e-027     NP_001098937.1 hairy and enhancer of split 5 [Bos taurus] ===========================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Hs ---= 4e-027     NP_001010926.1 hairy and enhancer of split 5 [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                             PROTEIN --- Xt ---- 9e-029     AAI35289.1 Hairy and enhancer of split 5, gene 2 [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                          PREDICTED - Gg ---- 5e-033     XP_417552.2 PREDICTED: similar to hairy and enhancer of split 5 isoform 2 [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                  PROTEIN --- Xl ---- 6e-092     NP_001082163.1 enhancer of split related 2 [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                           Xl3.1-IMAGE:3548249-IMAGp.5                                                                                                                                                                                                                                     ATG---------------------------------------------------------------------------------------ATG---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------TAA---------------------------ATG---------ATG------------------------------------------------------------------ATG------------------------------------------------------------------------------TGA---------TGA------------------------TGAATG---------------------------------------TGA---------------------------------------TAA---------------TAA------------------------------------------ATG------------------------TGA------------------TAG---------------------------------------------------ATG---------------------ATG---------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                     ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
  5   1   2      seed Tbd3                   IMAGE:3548249-IMAGp.IMAGp                                                                                                                                                                                                   TTTGAAATTCCCCCGGGAAGCAAGAGCCCATAACATGGCTGTCAACGGTGAAACCAATCTCATCTCCAGAGAATATGCTGCAGATAAACTAACTACTAAACAGAAAACCAAGATAAGGAAACCAATGGTGGAGAAGATGCGCAGGGACCGTATCAACAGCAGCATTAACCAGCTCCGGAATCTCTTGGAGCAGGAATTCCAGCTCCTCCAGCCTGACTCCAAGCCAGAGAAAGCCGACATCCTGGAATTAGCTGTGAAGTTCCTCAAGCAACAGATCTGCAGCCAACCACAAAATAATAAATCATATCAAAGAAAAGACTATCGAGACTTTAGTCAAGGCTACTCCAAATGCCTCCACGAGACGCTTGCCTTCCTCTCTTTTCACCGTGTTGAGGAGCACATGCAACTTAAACTGATTAATCATTTCCATTGTTTGGATACCCAGCCCACAAGCACTCCAGTCTCTTCTCCTCATTCCAAGGGGCCTGGGCCACTGGCTAGCACAAAGATTCTTTGGAGGCCATGGTAAAGGACAGTACTAAACACCTTCACAGTGATGCAAAGAGTTATGTGCAACTTGATCTGTGCTACCACTCTTTTGGATGGTTACCTTCATGTAATTACTGACTGCTTCATAATGAAGAATATATACTCAGTACAAAGGATCATACTTTTATATGGTTGGACTCAATTATGCTCTGTATAttttttttttATATGAAAGTTTATTTGAAGAGATATATTGGTTACCCTAGGCTGAATGCAGGCAGGCCGGACTTGCAACCCTCTGACAATTTGGCCCTGAGGAAACTTGCAAATTCTGCAATGGTTAATCCATGGCACTTAAGAAACAGAATTGAAATAACAGATTACATTATATTATATAGAG
  5   1   2       bld Brn1                            IMAGE:6955664.5p                                                                                                                                                                                                                          AGAGCCATAACATGGCTGTCAACGGTGAAACCAATCTCATCTCCAGAGAATATGCTGCAGATAAACTAACTACTAAACAGAAAACCAAGATAAGGAAACCAATGGTGGAGAAGATGCGCAGGGACCGTATCAACAGCAGCATTAACCAGCTCCGGAATCTCTTGGAGCAGGAATTCCAGCTCCTCCAGCCTGACTCCAAGCCAGAGAAAGCCGACATCCTGGAATTAGCTGTGAAGTTCCTCAAGCAACAGATCTGCAGCCAACCACAAAATAATAAATCATATCAAAGAAAAGACTATCGAGACTTTAGTCAAGGCTACTCCAAATGCCTCCACGAGACGCTTGCCTTCCTCTCTTTTCACCGTGTTGAGGAGCACATGCAACTTAAACTGATTAATCATTTCCATTGTTTGGATACCCAGCCCACAAGCACTCCAGTCTCTTCTCCTCATTCCAAGGGGCCTGGGCCACTGGCTAGCACAAAGATTCTTTGGAGGCCATGGTAAAGGACAGTACTAAACACCTTCACAGTGATGCAAAGAGTTATGTGCAACTTGATCTGTGCTACCACTCTTTTGGATGGTTACCTTCATGTAATTACTGACTGCTTCATAATGAAGAATATATACTCAGTACAAAGGATCATACTTTTATATGGTTGGACTCAATTATGCTCTGTATAttttttttttATATGAAAGTTTATTTGAAGAGATATATTGGTTACCCTAGGCTGAATGCAGGCAAGCCGGGAACTTGCAACCCTCTGACAATTTTGGCCCTGAAGGAAACTTGCAAATTTCGGCAAGGGTTTAATCCAGGGCACTT
  5   1   2       bld Tbd3                            IMAGE:3548249.5p                                                                                                                                                                                                                                        CTGTCAACGGTGAAACCAATCTCATCTCCAGAGAATATGCTGCAGATTTTACTAACTACTAAACAGAAAACCAAGATAAGGAAACCAATGGTGGAGAAGATGCGCAGGGACCGTATCAACAGCAGCATTAACCAGCTCCGGAATCTCTTGGAGCAGGAATTCCAGCTCCTCCAGCCTGACTCCAAGCCAGAGAAAGCCGACATCCTGGAATTAGCTGTGAAGTTCCTCAAGCAACAGATCTGCAGCCAACCACAAAATAATAAATCATATCAAAGAAAAGACTATCGAGACTTTAGTCAAGGCTACTCCAAATGCCTCCACGAGACGCTTGCCTTCCTCTCTTTTCACCGTGTTGAGGAGCACATGCAACTTAAACTGATTAATCATTTCCATTGTTTGGATACCCAGCCCACAAGCACTCCAGTCTCTTCTCCTCATTCCAAGGGGCCTGCGCCACTGGCTAGCACAAAGATTCTTTGGAGGCCATGGTAAAGGACAGTACTAAACACCTTCACAGTGATGCAAAGAGTTATGTGCAACTTGATCTGTGCTACCACTCT
  5   1   2       bld Brn1                            IMAGE:6954845.5p                                                                                                                                                                                                                                        GCTGTCAACGGTGAAACCAATCTCATCTCCAGAGAATATGCTGCAGATAAACTAACTACTAAACAGAAAACCAAGATAAGGAAACCAATGGTGGAGAAGATGCGCAGGGACCGTATCAACAGCAGCATTAACCAGCTCCGGAATCTCTTGGAGCAGGAATTCCAGCTCCTCCAGCCTGACTCCAAGCCAGAGAAAGCCGACATCCTGGAATTAGCTGTGAAGTTCCTCAAGCAACAGATCTGCAGCCAACCACAAAATAATAAATCATATCAAAGAAAAGACTATCGAGACTTTAGTCAAGGCTACTCCAAATGCCTCCACGAGACGCTTGCCTTCCTCTCTTTTCACCGTGTTGAGGAGCACATGCAACTTAAACTGATTAATCATTTCCATTGTTTGGATACCCAGCCCACAAGCACTCCAGTCTCTTCTCCTCATTCCAAGGGGCCTGGGCCACTGGCTAGCACAAAGATTCTTTGGAGGCCATGGTAAAGGACAGTACTAAACACCTTCACAGTGATGCAAAGAGTTATGTGCAACTTGATCTGTGCTACCACTCTTTTGGAAGGTTACCTTCATGTAATTACTGACTGCTTCATAATGAAGAATATATACTCAGTACAAAGGGATCATACTTTTTATATGGGTTGGACTCAATTATGCCTCTGTATAtttttttttttAATAGGAAAGTTTTATTTGAAAGAAGAAAATTGGGTTTACCCCTAAGGCTGAATTGCAAGGCAGGCCCGGGAACTTTGCAAACCCCTCCTGAAAAATTTTGGGCCCCTGAAAGAAAACTTGGCAAAATTTCTGCCAATGGGTTAAAAATCCATGGGCCACCTTTAAGAAAAACCGGAAATTGGAAAATTACCCGGAATTT
  5   1   2       bld Neu7      in                         XL031a05.5p                                                                                                                                                                                                                                                                              TGCTGCAGATAAACTAACTACTAAACAGAAAACCAAGATAAGGAAACCAATGGTGGAGAAGATGCGCAGGGACCGTATCAACAGCAGCATTAACCAGCTCCGGAATCTCTTGGAGCAGGAATTCCAGCTCCTCCAGCCTGACTCCAAGCCAGAGAAAGCCGACATCCTGGAATTAGCTGTGAAGTTCCTCAAGCAACAGATCTGCAGCCAACCACAAAATAATAAATCATATCAAAGAAAAGACTATCGAGACTTTAGTCAAGGCTACTCCAAATGCCTCCACGAGACGCTTGCCTTCCTCTCTTTTCACCGTGTTGAGGAGCACATGCAACTTAAACTGATTAATCATTTCCATTGTTTGGATACCCAGCCCACAAGCACTCCAGTCTCTTCTCCTCATTCCAAGGGGCCTGGGCCACTGGCTAGCACAAAGATTCTTTGGAGGCCATGGTAAAGGACAGTACTAAACACCTTCACAGTGATGCAAAGAGTTATGTGCAACTTGATCTGTGCTACCACTCTTTTGGATGGTTACCTTCATGTAATTACTGACTGCTTCATAATGAAGAATATATACTCAGTACAAAGGATCATACTTTTATATGGTTGGACTCAATTATGCTCTGTATAtttttttttt
  5   1   2       add Tbd7      out                        XL102p06.5p                                                                                                                                                                                                                                                                                                                                    GAGAAGATGCGCAGGGNACCGCATCAACAGCAGCATTAACCAGCTCCGAAATCTCTTTGAGCAGGAATTCCAGCTCCTCCAACCTGACTCCAAACCAGAGAAAGCAGACNTCCTGGAATTAGCTGTAAAGTTCCTCCAGCAAAAGATTTGCAGCCAACCGCAAAGTAAGATTTTTACTATAAATATCAATGGTGCTCAGGATAAAGAAACATGTGGCTCTCTAAATGCCACAAATCCTATTATAATTTGTTATTAGTAAGGATGGTGTAATTATCAAAGCCCTTTTAGGAAGAATCACAGCAACCATCTCCAATAACAGCAGCTTCACAGTGCCCCTGCCAGTCTATAGAGCTGTCACAGAATTGCAGCACATTTTCTCCTTGTGTAAATATGATCATCGCCAGTATCTATGAGGTCTAGGCCTAAAGTGAAGGGAAGAAGTGGTCACAATATTATTATTTCATGAGCGAAACAAATCCAAAATTAGCAGTTTTAATTTGATATGTATTAGTTATATAATATAAATTTCAGATTGGGAATTCTGGTAATTTTCTTGGATGATTGTAATGTGTTTAACCTATGCAGTATAAAATATACAGTAATAAAACTTATTCAAATGGCACATTTATAGGGTTGTCATATCTaaaaaaaaaCCTCAAATGTCATGGATTC
  3   1   2       bld Tbd7                                 XL063b14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTTGGATGGTTACCTTCATGTAATTACTGACTGCTTCATAATGAAGAATATATACTCAGTACAAAGGATCATACTTTTATATGGTTGGACTCAATTATGCTCTGTATATTTTTTTTTTATATGAAAGTTTATTTGAAGAGATATATTGGTTACCCTAGGCTGAATGCAGGCAGGCCGGACTTGCAACCCTCTGACAATTTGGCCCTGAGGAAACTTGCAAATTCTGCAATGGTTAATCCATGGCACTTAAGAAACAGAATTGAAATAACAGATTACATTATATTATATAGAGTGTGACAATCATGATAAAATGAATGTGTATATCAGATATGTCTTTTGACTATTTTCAGGACTTCTATAGTTAGCAAAGCGCTTACATTGTTCTACAATATTTGTAGCATGTCCCTTAGTTATGGTTATAATAACCACGTATAAAATGAACGGTTCATTGTTTATACCCTTGCAAAACAAGTAAGAGGAAATCAG
  3   1   2       bld Neu7      in                         XL031a05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGATGGTTACCTTCATGTAATTACTGACTGCTTCATAATGAAGAATATATACTCAGTACAAAGGATCATACTTTTATATGGTTGGACTCAATTATGCTCTGTATATTTTTTTTTTATATGAAAGTTTATTTGAAGAGATATATTGGTTACCCTAGGCTGAATGCAGGCAGGCCGGACTTGCAACCCTCTGACAATTTGGCCCTGAGGAAACTTGCAAATTCTGCAATGGTTAATCCATGGCACTTAAGAAACAGAATTGAAATAACAGATTACATTATATTATATAGAGTGTGACAATCATGATAAAATGAATGTGTATATCAGATATGTCTTTTGACTATTTTCAGGACTTCTATAGTTAGCAAAGCGCTTACATTGTTCTACAATATTTGTAGCATGTCCCTTAGTTATGGTTATAATAACCACGTATAAAATGAACGGTTCATTGTTTATACCCTTGCAAAACAAGTAAGANGAAATCAGATAGGAAATTAGCTTCCTAGTCAAAAATAAAGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)