Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:7976360.3                      92 END     4          28        4                (no blast hit)
     2   2.0    0Xl3.1-xl328e01.3                            7 END     1           7       14                hypothetical protein LOC734413 [Xenopus laevis]
     3   2.0    0Xl3.1-IMAGE:4202001-IMAGp.5                 3 END     1           7       33                hypothetical protein LOC734413 [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     4   0.0    0Xl3.1-IMAGE:7976360.3                      92 PI      83        609     1364                (no blast hit)
     5   0.0    0Xl3.1-IMAGE:7203366.5                      17 PI      76         15      385                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012778422 Xl3.1-XL468i09ex.3 - 14 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL468i09ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AACGGCTGGGCATTGGCCAGTCTCAGGAGATGAACACCCTCTTCCGTTTCTGGTCCTTTTTTCTCCGAGATCATTTCAATAAGAAAATGTATGAGGAGTTCAGACAACTGGCTGTGGAGGATAGCAAAGAGGGATACAGGTACGGGTTGGAGTGCCTATTCAGATACTACAGCTACGGGCTGGAAAAGAAGTTCCGAGTTGATATATTCCGAGATTTCCAGGAAGAAACTAGAAGGGACTACGAAACAGGTCAGCTGTACGGGCTGGAGAAGTTTTGGGCCTTCTTAAAATATTCCAAAGCCAAAAATCTTGACATAGACCCCACATTGCAGGACTGTCTGAGCAAGTTCCGCAGACTAGAGGATTTCAGGGTTGATCCTCCAATGGGAGAAGATGGAGGATCAAAGAGGCGTCACTCATTCTCAACGGGGGAGGGCAGGAGAAGGTACCCATCCCAGTCTTCCAGTAGAGGATCTGGTCATCCGTCTCAGAATTCAACTCAAAATTCAGCCAAGGAAGAGGCCAAAGCCCAAAGCCAACCTTCCACTGCTGCACCGGATTCCCAGTTCCCTGGAGGAGGGAAGTAGACGGAATACAAATTGGAGTTGGAACGAAGGACTTGGCAAAGGGAACATTGTTTCTTGGATATGAAAGGTGGATATATCACACAATAGATTCCGCCTTCTTCCTGCAGGAAACTTCAATTAGCAGAGACTCCAGGTGCTGGAGGCAAAGACTGATTGTTCCCATGCCCTTTGCACCTATAGGGGCAGCTGCTCGTGCTAAAGAGGAGGATGATCTTTGGTTAGGGGTATGACATTTAGTTTCATTTGTTTTAGCAGAAACCTGGAGGAAAGCTCTCGCTATGTTCAGTGTGAGAAAAATCTTTTCTTTTATTTTTTTTTTCCCTTGTTTTTAAATTATTGAATTTGTGCCCTCCCCTTTGAGCAGCAATTCCCCGGTGTGGAATGAAAGACTCGCGTCTGCCGTGAGATGGCCACAAGCAGAGCTTTGCTGTTACAGGCTCACAATGCGATACACAGGGCCTTTCTATGGCTTCTGTCTCTTGCATGAGACAAATCAGTTTTCTTCGAAGCAAAGATTGGGTTCTGCAGCTTCTCAAATCTAGGACGTTGTCTTTTAAACAATGCCTCTTCCTCGTGATGGAGGGTCCAGGGATTGTCCACACGATGGAGCTGCTTCTTCTTGCTTCTTACTTTCTTCCCCCAGTTATTGGTTCCTCGGCATGCAGCTCATGGCTTCAAGACAACCCTGCAGTGGTATTCCCCCCTCCCCTTTTCAGAGAGATATATATAAATATATTTTTATTTTTTCTTTTGTTTTATTATTTCAGACCTGTGAATAAGA
                                                  Xl3.1-CHK-1012692497                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGGCATTGGCCAGTCTCAGGAGATGAACACCCTCTTCCGTTTCTGGTCCTTTTTTCTCCGAGATCATTTCAATAAGAAAATGTATGAGGAGTTCAGACAACTGGCTGTGGAGGATAGCAAAGAGGGATACAGGTACGGGTTGGAGTGCCTATTCAGATACTACAGCTACGGGCTGGAAAAGAAGTTCCGAGTTGATATATTCCGAGATTTCCAGGAAGAAACTAGAAGGGACTACGAAACAGGTCAGCTGTACGGGCTGGAGAAGTTTTGGGCCTTCTTAAAATATTCCAAAGCCAAAAATCTTGACATAGACCCCACATTGCAGGACTGTCTGAGCAAGTTCCGCAGACTAGAGGATTTCAGGGTTGATCCTCCAATGGGAGAAGATGGAGGATCAAAGAGGCGTCACTCATTCTCAACGGGGGAGGGCAGGAGAAGGTACCCATCCCAGTCTTCCAGTAGAGGATCTGGTCATCCGTCTCAGAATTCAACTCAAAATTCAGCCAAGGAAGAGGCCAAAGCCCAAAGCCAACCTTCCACTGCTGCACCGGATTCCCAGTTCCCTGGAGGAGGGAAGTAGACGGAATACAAATTGGAGTTGGAACGAAGGACTTGGCAAAGGGAACATTGTTTCTTGGATATGAAAGGTGGATATATCACACAATAGATTCCGCCTTCTTCCTGCAGGAAACTTCAATTAGCAGAGACTCCAGGTGCTGGAGGCAAAGACTGATTGTTCCCATGCCCTTTGCACCTATAGGGGCAGCTGCTCGTGCTAAAGAGGAGGATGATCTTTGGTTAGGGGTATGACATTTAGTTTCATTTGTTTTAGCAGAAACCTGGAGGAAAGCTCTCGCTATGTTCAGTGTGAGAAAAATCTTTTCTTTTATTTTTTTTTTCCCTTGTTTTTAAATTATTGAATTTGTGCCCTCCCCTTTGAGCAGCAATTCCCCGGTGTGGAATGAAAGACTCGCGTCTGCCGTGAGATGGCCACAAGCAGAGCTTTGCTGTTACAGGCTCACAATGCGATACACAGGGCCTTTCTATGGCTTCTGTCTCTTGCATGAGACAAATCAGTTTTCTTCGAAGCAAAGATTGGGTTCTGCAGCTTCTCAAATCTAGGACGTTGTCTTTTAAACAATGCCTCTTCCTCGTGATGGAGGGTCCAGGGATTGTCCACACGATGGAGCTGCTTCTTCTTGCTTCTTACTTTCTTCCCCCAGTTATTGGTTCCTCGGCATGCAGCTCATGGCTTCAAGACAACCCTGCAGTGGTATTCCCCCCTCCCCTTTTCAGAGAGATATATATAAATATATTTTTATTTTTTCTTTTGTTTTATTATTTCAGACxxxxxAxxAxxATCCCAG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     4     4     4     4     3     4     3     4     4     4     4     4     3     4     4     4     4     4     4     5     5     5     5     5     5     5     4     4     4     4     3     3     3     3     4     4     4     5     4     5     4     5     4     5     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     7     6     7     6     7     5     6     5     6     5     6     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     6     7     7     6     7     7     7     6     7     6     7     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     6     8     7     8     6     8     8     8     8     8     8     8     9     9     9     9     9     9     8     8     8     8     8     8     8     8     7     8     7     8     7     8     7     8     6     8     7     8     5     7     4     6     4     6     3     5     3     5     3     5
                                                                       ...PROTEIN --- Ce ---- 2e-035     NP_001040868.1 LARP (RNA binding La related protein) homolog family member (larp-1) [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 6e-042     XP_642918.1 hypothetical protein DDBDRAFT_0217890 [Dictyostelium discoideum AX4] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 2e-048     NP_733244.4 La related protein CG14066-PC, isoform C [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ag ---- 3e-049     XP_309080.4 AGAP005291-PB [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 7e-052     XP_001191109.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 1e-063     NP_001121461.1 La ribonucleoprotein domain family, member 2 [Xenopus tropicalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 9e-072     XP_001920902.1 PREDICTED: La ribonucleoprotein domain family, member 1 [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 1e-075     XP_853394.1 PREDICTED: similar to la related protein isoform 1 [Canis familiaris] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 7e-076     NP_291029.2 KIAA0731 protein [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 1e-076     XP_582017.4 PREDICTED: similar to la related protein [Bos taurus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Mm ---- 3e-077     XP_126172.6 PREDICTED: la related protein [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 2e-077     XP_414577.2 PREDICTED: hypothetical protein [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Xl ---- 2e-112     NP_001089363.1 hypothetical protein LOC734413 [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xl3.1-XL468i09ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATG------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------ATG---------------------TAG---------------------------------------------------------------TGA------------------------TAG---------------------------ATG---------TAG------------TAG------------TAG------------------------------------TGA------------------------------------------------------------------TGA---------------------ATG------------------TGA------------------------------------------------------------ATG---------------ATG------------------------------------------------------------------------------------------ATG------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  5   1   2       bld Tbd7      out                        XL052n02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTGCCTTAATGAAGGAAACGGCTGGGCATTGGCCAGTCTCAGGAGATGAACACCCTCTTCCGTTTCTGGTCCTTTTTTCTCCGAGATCATTTCAATAAGAAAATGTATGAGGAGTTCAGACAACTGGCTGTGGAGGATAGCAAAGAGGGATACAGGTACGGGTTGGAGTGCCTATTCAGATACTACAGCTACGGGCTGGAAAAGAAGTTCCGAGTTGATATATTCCGAGATTTCCAGGAAGAAACTAGAAGGGACTACGAAACAGGTCAGCTGTACGGGCTGGAGAAGTTTTGGGCCTTCTTAAAATATTCCAAAGCCAAAAATCTTGACATAGACCCCACATTGCAGGACTGTCTGAGCAAGTTCCGCAGACTAGAGGATTTCAGGGTTGATCCTCCAATGGGAAAAGATGGAGGATCAAAGAGGCGTCACTCATTCTCAACGGGGGAGGGCAGGAGAAGGTACCCATCCCAGTCTTCCAGTAGAGGATCTGGTCATCCGTCTCAGAATTCAACTCAAAATTCAGCCAAGG
  5   1   2       add Neu2                            IMAGE:2942301.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGGGGAAAGGAAACGGCTGGGCATTGGCCAGTCTCAGGAGATGAACACCCTCTTCCGTTTCTGGTCCTTTTTTCTCCGAGATCATTTCAATAAGAAAATGTATGAGGAGTTCAGACAACTGGCTGTGGAGGATAGCAAAGAGGGATACAGGTACAGGTTGGAGTGCCTATTCAGATACTACAGCTACAGGCTGGAAAAGAAGTTCCGAGTTGATATATTCCGAGATTTCCAGGAAGAAACTAGAAAGGACTACAAAACAAGTCAGCTGTACGGGCTGGAGAAGTTGTGGGCCTTCTTAAAATATTCCAAAGCCAAAAATCTTGACATAGACCCCACATTACAAGACTGTCTAAACAAGTTCCACAGACTAGAAGATTTCAAGGTTGATCCTCCAATGAGAGAAGATGAGAAATCAAAGAAGCATCACTCATTCTCAACAGAAGAAAACAGAAGAAAGTACCCATCCCAGTCTTGCAGTAGAAAATCTAATCATCCGTCTCAGAATTCAACTCAAAATTCAGCCAAGAAAGAAGCCAAANCCCAAANCCAACCTTGCACTACT
  3   1   2       bld Ga12      out                        XL147j23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTATTCAGATACTACAGCTACGGGCTGGAAAAGAAGTTCCGAGTGGATATATTCCGAGATTTCCAGGAAGAAACTAGAAGGGACTACGAAACAGGTCAGCTGTACGGGCTGGAGAAGTTTTGGGCCTTCTTAAAATATTCCAAAGCCAAAAATCTTGACATAGACCCCACATTGCAGGACTGTCTGAGCAAGTTCCGCAGACTAGAGGATTTCAGGGTTGATCCTCCAATGGGAGAAGATGGAGGATCAAAGAGGCGTCACTCATTCTCAACGGGGGAGGGCAGGAGAAGGTACCCATCCCAGTCTTCCAGTAGAGGATCTGGTCATCCGTCTCAGAATTCAACTCAAAATTCAGCCAAGGAAGAGGCCAAAGCCCAAAGCCAACCTTCCACTGCTGCACCGGATTCCCAGTTCCCTGGAGGAGGGAAGTAGACGGAATACAAATTGGAGTTGGAACTAAGGACTTGGCAAAGGGAACATTGTTTCTTGGATATGAAAGGTGGATATATCACACAATAGATTCCGCCTTCTTCCTGCAGGAAACTTCAATTAGCAGAGACTCCAGGTGCTGGAGGCAAAGACNGATTGTTCCCATGCCCTTTGCACCTATAGGGGCAGC
  5   1   2       bld Tbd7      out                        XL056h17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCAGGCAATTCGGCACGAGGGCAAGTTCCGCAGNACTAGNAGGATTTCAGGGTTGATCCTCCAATGGGAGAAGATGGAGGATCAAAGAGGCGTCACTCATTCTCAACGGGGGAGGGCAGGAGAAGGTACCCATCCCAGTCTTCCAGTAGAGGATCTGGTCATCCGTCTCAGAATTCAACTCAAAATTCAGCCAAGGAAGAGGCCAAAGCCCAAAGCCAACCTTCCACTGCTGCACCGGATTCCCAGTTCCCTGGAGGAGGGAAGTAGACGGAATACAAATTGGAGTTGGAACGAAGGACTTGGCAAAGGGAACATTGTTTCTTGGATATGAAAGGTGGATATATCACACAATAGATTCCGCCTTCTTCCTGCAGGAAACTTCAATTAGCAGAGACTCCAGGTGCTGGAGGCAAAGACTGATTGTTCCCATGCCCTTTGCACCTATAGGGGCAGCTGCTCGTGCTAAAGAGGAGGATGATCTTTGGTTAGGGGTATGACATTTAGTTTCATTTGTTTTAGCAGAAACCTGGAGGAAAGCTCTCGCTATGTTCAGTGTGAGAAAAATCttttcttttattttttttttCCC
  5   1   2       bld Neu7      out                        XL048f21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAGAGGATCTGNTCATCCGTCTCAGAATTCAACTCAAAATTCAGCCAAGGAAGAGGCCAAAGCCCAAAGCCAACCTTCCACTGCTGCACCGGATTCCCAGTTCCCTGGAGGAGGGAAGTAGACGGAATACAAATTGGAGTTGGAACGAAGGACTTGGCAAAGGGAACATTGTTTCTTGGATATGAAAGGTGGATATATCACACAATAGATTCCGCCTTCTTCCTGCAGGAAACTTCAATTAGCAGAGACTCCAGGTGCTGGAGGCAAAGACTGATTGTTCCCATGCCCTTTGCACCTATAGGGGCAGCTGCTCGTGCTAAAGAGGAGGATGATCTTTGGTTAGGGGTATGACATTTAGTTTCATTTGTTTTAGCAGAAACCTGGAGGAAAGCTCTCGCTATGTTCAGTGTGAGAAAAATCttttcttttattttttttttcccttgtttttAAATTATTGAATTTGTGCCCTCCCCTTTGAGCAGCANTTCCCCGGNGTGGAATGAAA
  5   1   2       bld Ga15                               XL454d09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGATTCCCAGTTCCCTGGAGGAGGGAAGTAGACGGAATACAAATTGGAGTTGGAACGAAGGACTTGGCAAAGGGAACATTGTTTCTTGGATATGAAAGGTGGATATATCACACAATAGATTCCGCCTTCTTCCTGCAGGAAACTTCAATTAGCAGAGACTCCAGGTGCTGGAGGCAAAGACTGATTGTTCCCATGCCCTTTGCACCTATAGGGGCAGCTGCTCGTGCTAAAGAGGAGGATGATCTTTGGTTAGGGGTATGACATTTAGTTTCATTTGTTTTAGCAGAAACCTGGAGGAAAGCTCTCGCTATGTTCAGTGTGAGAAAAATCttttcttttattttttttttcccttgtttttAAATTATTGAATTTGNGCCCTCCCCTTTGAGCANCAATTCCCCGGNGNGGAATGAAANACTCGCGTCTGCCGTGANATGGCCACAAGCAAANCTTTGCTGTTACAGGCTCACAATGCNATACACAGGGCCTTTCTATGGCTTCTGTCTCTTGCATGANACAAATCAGTTTTCTTCNAAGCAAANATTGGGTTCTGCAGCTTCTCAAATCTAGGACGTTGNCTTTTAAACAATGCCNCTTCCTCGTGATGGAGGGNCCAG
  5  -1   2       bld Bla2                            IMAGE:7299121.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATAATCGCAGAGGCAAGCAAGCACTCATGTGCACGATCAGTCTGAGAGGGAGTGACGATCAAATGAGTGACTAGACTGGGAANGGACATGTTCTGATATGAAGGTGATATATCACACATAGATTCACTTCTCCTGCAGAACTTCAATAGCAGAGATCCAGGTGCGGAGGCAAGGACTGATTGTTCCCATGCCCTTTGCACCTATAGGGGCAGCTGCTCGTGCTAAAGAGGAGGATGATCTTTGGTTAGGGGTATGACATTTAGTTTCATTTGTTTTAGCAGAAACCTGGAGGAAAGCTCTCGCTATGTTCAGTGTGAGAAAAATCTTTTCtttttttttttCCCTTGTTTTTAAATTATTGAATTTGTGCCCTCCCCTTTGAGCAGCAATTCCCCGGTGTGGAATGAAAGACTCGCGTCTGCCGTGAGATGGCCACAAGCAGAGCTTTGCTGTTACAGGCTCACAATGCGATACACAGGGCCTTTCTATGGCTTCTGTCTCTGCCATGAGACAAATCAGTTTTTTTCGAAGCAAAGACTGGGTTCTGCAGCTTCTCAAATTTAGGACGTTGTCTTTTAAACAATGCCTCTTCCTCGTGATGGAGGGTCCAGGGATTGTCCACACGATGGAGCTGCTTCTTCTGGCTTCTTACTTTCTTCCCCCAGTTATTGGTTCCTGGGCATGCAGCTCAGGGTTTCAAGACAACCCGGCAGGGGTATTCCCCCTTCCCCTTTTCAGAGAGATATATATAAATATAtttttattttttctttggttttattatttcagacctgggaatgagaatcccagaaaaaaaaaactagcaaaagacaagagtaaaaaaaaaaaaaaaCTGGAGGGGGGGCCCGTACCCAATCGCCTAAGAATCGTAAA
  3   1   2       bld Ga15      in                       XL468i09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACTNGGCAAAGGGAAACATTGTTTCTTGGATATGAAAGGTGGATATATCACACAATAGATTCCGCCTTNTTCCTGCAGGAAACTTCAATTAGCAGAGACTCCAGGTGCTGGAGGCAAAGACTGATTGTTCCCATGCCCTTTGCACCTATAGGGGCAGCTGCTNGTGNTAAAGAGGAGGATGATCTTTGGTTAGGGGTATGACATTTAGTTTCATTCGTTTTAGCAGAAACCTGGAGGAAAGCTCTCGCTATGTTCAGTGTGAGAAAAATCTTTTCTTTTATTTTTTTTTCCCCTTGTTTTTAAATTATTGAATTNGTGCCCTCCCCTNTGAGCAGCAATTCCCCGGTGTGGAATGAAAGACTCGCGTCTGCCGTGAGATGGCCACAAGCAGAGCTTTGCTGTTACAGGCTCACAATGCGATACACAGGGCCTTTCTATGGCTTCTGTCTCTTGCATGAGACAAATCAGTTTTCTTCGAAGCAAAGATNGGGTTCTGCAGCTTCTCAAATCTAGGACGTTGTCTTTTAAACAATGCCTCTTCCTCGTGATGGAGGGTCCAGGGATTGTCCACACGATGGAGCTGCTTCTTCTTGCTTCTTACTTTCTTCCCCCAGTTATTGGTTCCTCGGCATGCAGCTCATGGCTTCAAGACAACCNTGCAGTGGTATTCCCCCCTCCCCTTCTCAGAGAGATATA
  5   1   2      seed Emb1                            IMAGE:6863596.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGAGGCAAAGACTGATTGTTCCCATGCCCTTTGCACCTATAGGGGCAGCTGCTCGTGCTAAAGAGGAGGATGATCTTTGGTTAGGGGTATGACATTTAGTTTCATTTGTTTTAGCAGAAACCTGGAGGAAAGCTCTCGCTATGTTCAGTGTGAGAAAAATCttttcttttattttttttttcccttgtttttAAATTATTGAATTTGTGCCCTCCCCTTTGAGCAGCAATTCCCCGGTGTGGAATGAAAGACTCGCGTCTGCCGTGAGATGGCCACAAGCAGAGCTTTGCTGTTACAGGCTCACAATGCGATACACAGGGCCTTTCTATGGCTTCTGTCTCTTGCATGAGACAAATCAGTTTTCTTCGAAGCAAAGATTGGGTTCTGCAGCTTCTCAAATCTAGGACGTTGTCTTTTAAACAATGCCTCTTCCTCGTGATGGAGGGTCCAGGGATTGTCCACACGATGGAGCTGCTTCTTCTTGCTTCTTACTTTCTTCCCCCAGTTATTGGTTCCTCGGCATGCAGCTCATGGCTTCAAGACAACCCTGCAGTGGTATTCCCCCCTCCCCTTTTCAGAGAGatatatataaatatatttttattttttcttttgttttattattttcagactgtgaataagaatcccagaaaaaaaaaaaaaaaaaaaaggggggggC
  3   1   2       bld Tbd7                                 XL079o12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTGGTTAGGGGTATGACATTTAGTTTCATTTGTTTTAGCAGAAACCTGGAGGAAAGCTCTCGCTATGTTCAGTGTGAGAAAAATCTTTTCTTTTATTTTTTTTTTCCCTTGTTTTTAAATTATTGAATTTGTGCCCTCCCCTTTGAGCAGCAATTCCCCGGTGTGGAATGAAAGACTCGCGTCTGCCGTGAGATGGCCACAAGCAGAGCTTTGCTGTTACAGGCTCACAATGCGATACACAGGGCCTTTCTATGGCTTCTGTCTCTTGCATGAGACAAATCAGTTTTCTTCGAAGCAAAGATTGGGTTCTGCAGCTTCTCAAATCTAGGACGTTGTCTTTTAAACAATGCCTCTTCCTCGTGATGGAGGGTCCAGGGATTGTCCACACGATGGAGCTGCTTCTTCTTGCTTCTTACTTTCTTCCCCCAGTTATTGGTTCCTCGGCATGCAGCTCATGGCTTCAAGACAACCCTGCAGTGGTATTCCCCCCTCCCCTTTTCAGAG
  3   1   2       bld Emb4 5g3  out                   IMAGE:4202001.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGTTTTTAAATTATTGAATTTGTGCCCTCCCCTTTGAGCAGCAATTCCCCGGTGTGGAATGAAAGACTCGCGTCTGCCGTGAGATGGCCACAAGCAGAGCTTTGCTGTTACAGGCTCACAATGCGATACACAGGGCCTTTCTATGGCTTCTGTCTCTTGCATGAGACAAATCAGTTTTCTTCGAAGCAAAGATTGGGTTCTGCAGCTTCTCAAATCTAGGACGTTGTCTTTTAAACAATGCCTCTTCCTCGTGATGGAGGGTCCAGGGATTGTCCACACGATGGAGCTGCTTCTTCTTGCTTCTTACTTTCTTCCCCCAGTTATTGGTTCCTCGGCATGCAGCTCATGGCTTCAAGACAACCCTGCAGTGGTATTCCCCCCTCCCCTTTTCAGAGANGATATATATAAATATATTTTTATTTTTTATTTTGTTTTATTATTTCAGACTGTGAATAAGAATCCC
  5   1   2       bld Ga15      in                       XL468i09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGTGAGATGGCCACAAGCAGAGCTTTGCTGTTACAGGCTCACAATGCGATACACAGGGCCTTTCTATGGCTTCTGTCTCTTGCATGAGACAAATCAGTTTTCTTCGAAGCAAAGATTGGGTTCTGCAGCTTCTCAAATCTAGGACGTTGTCTTTTAAACAATGCCTCTTCCTCGTGATGGAGGGTCCAGGGATTGTCCACACGATGGAGCTGCTTCTTCTTGCTTCTTACTTTCTTCCCCCAGATTATTGGTTCCTCGGCATGCANCTCATGGCTTCAAGACAACCCTGCAGTGGTATTCCCCCCTCCCCTTTTCNNAGAgatatatataaaatatatttttattttttat
  5   1   2       bld Tbd7      out                        XL102i05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCTGTCTCTTGCATGAGACAAATAGTTTTCTTCGAAGCAAAGATTGGGTTCTGCAGCTTCTCAAATCTAGGACGTTGTCTTTTAAACAATGCCTCTTCCTCGTGATGGAGGGTCCAGGGATTGTCCACACGATGGAGCTGCTTCTTCTTGCTTCTTACTTTCTTCCCCCAGTTATTGGTTCCTCGGCATGCAGCTCATGGCTTCAAGACAACCCTGCAGTGGTATTCCCCCCTCCCCTTTTCAGAGAGATATATATAAATATAtttttattttttcttttgttttattatttcagactgtgaataagaatcccagaaaaaaaaaactagcaaaagacaagagttaaaaaaaaaactgaaaacaaaaCTGCCTTTTATTTCCCTTTTAAAAATATTAATCTATTCAGCATTGNGAGAACAAAGATGACGAANCGTTGCCTTATAGTAACCTANAAGCTTGCCGAACAAGCTGCCATCTTGGAATAAAGNGGCAGCCAATCATAAAGCAGTTTGGAGCAGCCACTGACTGAAGACAAATCACCTGGCCCCACATCCCATGCTGCTGTTTATCTTCATTCTGTT
  3   1   2       bld Emb4                            IMAGE:4957547.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTTGTCTTTTAAACAATGCCTCTTCCTCGTGATGGAGGGTCCAGGGATTGTCCACACGATGGAGCTGCTTCTTCTTGCTTCTTACTTTCTTCCCCCAGTTATTGGTTCCTCGGCATGCAGCTCATGGCTTCAAGACAACCCTGCAGTGGTATTCCCCCCTCCCCTTTTCAGAGAGATATATATAAATATATTTTTATTTCTTATTTTGTTTTATTATTTCAGACTGTGAATAAGAATCCCAGCATAGGGGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)