Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xl327n06.5                            4 END     3          23       75                Chloride channel 5 [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012778616 Xl3.1-xl327n06.3 - 13 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl327n06.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACGTATGACTGTCTCACTTGTGGTTATTATGTTTGAGTTAACTGGTGGATTGGAATACATTGTACCTCTGATGGCCGCCGCCATGACCAGCAAGTGGGTGGCAGACGCTTTGGGACGGGGGAGTATTTATGATGCCCACATCCATTTAAATGGTTACCCCTTCCTGGAGGCGAAGGAAGAGTTCAGCCATAAAACACTGGCTATGGATGTCATGCGTCCCCGGCGCAACGACCCTATATTAACGGCCATTACTCAAGACAGCATGACGGTGGAGGACATTGAGGCCATTATAAGTGAAACGACCTACAGTGGCTTCCCAATTGTAGTTTCTAGAGAATCCCAAAGACTAATGGGCTTTGTACTGAGAAGAGACTTGATTATCTCTATCGAAAGCGCCCGAAAAAAGCAAGAAGGGATAGTGAGCACATCGCGGATTTACTTTACAGAGCACACGCCAACACAACCCACGACTGCTCCACCCAGCCTAAAGCTTCGTGCAATTATGGACTTAAGCCCCTTCACAATAACAGACCAGACACCTATGGAGATTGTGGTGGATATCTTCCGTAAGCTTGGTCTGCGCCAGTGCCTTGTGACACACAATGGGAGATTGCTTGGCATAATAACAAAGAAAGATGTCCTAAAGCATATAGCACAGATGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAATCTATGCCTTAAATAACAGGAGCTATGGACTCTGCTGAAGCCATATTCAGTATCATTGTAGGGTGTGTTTTGCACCTCCAGACTGTGAAGAGGTGCCTTGCATCATGAAGTGGAGTGACTGAAGCTTTGGTGGCTGATTCACGAAAATGAAGT
                                                  Xl3.1-CHK-1012693012                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGACTGTCTCACTTGTGGTTATTATGTTTGAGTTAACTGGTGGATTGGAATACATTGTACCTCTGATGGCCGCCGCCATGACCAGCAAGTGGGTGGCAGACGCTTTGGGACGGGGGAGTATTTATGATGCCCACATCCATTTAAATGGTTACCCCTTCCTGGAGGCGAAGGAAGAGTTCAGCCATAAAACACTGGCTATGGATGTCATGCGTCCCCGGCGCAACGACCCTATATTAACGGCCATTACTCAAGACAGCATGACGGTGGAGGACATTGAGGCCATTATAAGTGAAACGACCTACAGTGGCTTCCCAATTGTAGTTTCTAGAGAATCCCAAAGACTAATGGGCTTTGTACTGAGAAGAGACTTGATTATCTCTATCGAAAGCGCCCGAAAAAAGCAAGAAGGGATAGTGAGCACATCGCGGATTTACTTTACAGAGCACACGCCAACACAACCCACGACTGCTCCACCCAGCCTAAAGCTTCGTGCAATTATGGACTTAAGCCCCTTCACAATAACAGACCAGACACCTATGGAGATTGTGGTGGATATCTTCCGTAAGCTTGGTCTGCGCCAGTGCCTTGTGACACACAATGGGAGATTGCTTGGCATAATAACAAAGAAAGATGTCCTAAAGCATATAGCACAGATGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAATCTATTCCTTAAATAACAGGAGCTATGGACTCTGCTGAAGCCATATTCAGTATCATTGTAGGGTGTGTTTTGCACCTCCAGACTGTGAAGAGGTGCCTTGCATCATGAAGTGGAGTGACTGAAGCTTTGGTGGCTGATTCACGAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     4     4     3     4     3     4     3     4     4     4     3     4     4     5     4     5     4     5     4     6     4     6     4     6     5     6     5     6     6     9     7    10     7     9     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     8     8     9     8     9     8     9     8     9     7     9     6     8     6     8     3     7     4     6     4     6     3     5
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------C--
                                                                       ...PROTEIN --- Ce ---- 5e-063     NP_495940.1 voltage gated CLC-type chloride channel subunit (88.2 kD) (clh-5)[Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 7e-078     XP_001179695.1 PREDICTED: similar to chloride channel protein 3 [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ag ---- 1e-084     XP_315792.4 AGAP005777-PB [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 2e-085     NP_648834.1 CG5284-PB [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 4e-107     XP_001920783.1 PREDICTED: similar to chloride channel CLC-5 [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 7e-114     XP_420265.2 PREDICTED: similar to chloride channel 5 (nephrolithiasis 2, X-linked, Dent disease) [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 2e-114     NP_001121371.1 chloride channel 5 isoform a [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Bt ---- 1e-114     XP_869706.2 PREDICTED: similar to CLC-5 chloride channel protein isoform 2 [Bos taurus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 1e-114     XP_549002.2 PREDICTED: similar to Chloride channel protein 5 (ClC-5) [Canis familiaris] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 8e-115     NP_057900.2 chloride channel 5 [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 3e-123     NP_001039210.1 chloride channel 5 (nephrolithiasis 2, X-linked, Dent disease) [Xenopus tropicalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 1e-127     AAI57729.1 Chloride channel 5 [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-xl327n06.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATG---------------------ATG---------------------------------------ATG---------ATG---------------------------------------------------------------------------------------------------------------------ATG------ATG------------------------------------------------ATG------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG---------------------------------TGA------------------------------------TGA------------------------------------------------------------------ATG------------TGA------------TGA---------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  5   1   2      skin Int2                            IMAGE:8821728.5p                                                                                                                                                                                                                                                                                                                                                                                                       GCCACCGAGCGTCGGGGAGTGGGGACGGGCTTCGATTCGTCCCGAATATTTGGGGGATTGTGGGGTGCCTTTTTTATCCGTGCCAACATTGCCTGGTGTCACAGACGGAAAACCACCAAACTCGGTCGCTATCCTGTGGCGGAAGTCCTAATGGTGACGGCTATTACAGCCATACTGGCATTTCCCAATGATTACACGAGAATGAGCTCTAGTGAAATGATATCTGAGCTTTTCAATGACTGCGGCCTTCTTGACTCGTCCAAGCTATGTGATTATGTTAATGATTACAACAACACAAAGGGGGGCAACCTCCCTGACCGTGCAGCAGGAAATGGAGTCTACACAGCCATGTGGCAACTGTCCCTGGCGTTGATCTTCAAAGCTGTGATTACCATATTCACATTTGGCATAAAGGTGCCATCAGGCCTTTTCATCCCAAGCATGGCTGTGGGTGCTATAATGGGAAGGCTTTTGGGGGTTGCCATGGAACAGCTTTCCTTCTACCATCACGACTGGCTGATCTTCAGAGGATGGTGCAACCAAGGAGCAGACTGTATCACGCCTGGTCTCTATGCCATGGTTGGAGCAGCGGCCTGCCTAGGTGGCGCCACACGTATGACTGTCTCACTTGTGGTTATTATGTTTGAGTTAACTGGTGGATTGGAATACATTGTACCTCTGATGGCCGCCGCCATGACCAGCAAGTGGGTGGCAGACGCTTTGGGACGGGGAGTATTTATGATGCCCACATCCATTTAAATGGGTTACCCCTTTCCTGGAGGCGAAGAGAGTTCAGCCATAAACACTGGCTATGGATGTCATGCGTCCCAGCGCACGACCTATATACGTCAATTACTCAGAACAGCATGACAGTGGAGGACATTGAGGCCCATTATTAGTGAAACGAACCTTA
  5   1   2       bld Egg1                               PBX0067H08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGCACGAGGGCCTAGGTGGCGCAACACGTATGACTGTCTCACTTGTGGTTATTATGTTTGAGTTAACTGGTGGATTGGAATACATTGTGCCTCTGATGGCCGCCGCCATGACCAGCAAGTGGGTGGCAGACGCTTTGCGACGGGGGAGTATTTATGATGCCCGCATCCATTTAAATGGTTACCCCTTCCTGGAGGCGAACGAAGAGTTCAGGCATAAAACACTGGCTATGGATGTCATGCGTCCCCGGTGCAACGATCCTATATTAACGGCCATTACTCAAGACAGCATGACGGTGGAGGACATTGAGGCCATTATAAGTGAAACGACCTACAGTGGCTTCCCAA
  3   1   2      seed DMZ  5g3  out                        xl327n06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATGACCAGCAAGTGGGTGGCAGACGCTTTGGGACGGGGGAGTATTTATGATGCCCACATCCATTTAAATGGTTACCCCTTCCTGGAGGCGAAGGAAGAGTTCAGCCATAAAACACTGGCTATGGATGTCATGCGTCCCCGGCGCAACGACCCTATATTAACGGCCATTACTCAAGACAGCATGACGGTGGAGGACATTGAGGCCATTATAAGTGAAACGACCTACAGTGGCTTCCCAATTGTAGTTTCTAGAGAATCCCAAAGACTAATGGGCTTTGTACTGAGAAGAGACTTGATTATCTCTATCGAAAGCGCCCGAAAAAAGCAAGAAGGGATAGTGAGCACATCGCGGATTTACTTTACAGAGCACACGCCAACACAACCCACGACTGCTCCACCCAGCCTAAAGCTTCGTGCAATTATGGACTTAAGCCCCTTCACAATAACAGACCAGACACCTATGGAGATTGTGGTGGATATCTTCCGTAAGCTTGGTCTGCGCCAGTGCCTTGTGACACACAATGGGAGATTGCTTGGCATAATAACAAAGAAAGATGTCCTAAAGCATATAGCACAGATGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAATCTATTCCTTAAATAACAGGAGCTATGGACTCTGCTGAAGCCATATTCAGTATCATTGTAGGGTGTGTTTTGCACCTCCAGACTGTGAAGAGGTGCCTTGCATCA
  5   1   2       bld FaBN      in                    IMAGE:8075960.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGCTTTGGGACGGGGGAGTATTTATGATGCCCACATCCATTTAAATGGTTACCCCTTCCTGGAGGCGAAGGAAGAGTTCAGCCATAAAACACTGGCTATGGATGTCATGCGTCCCCGGCGCAACGACCCTATATTAACGGCCATTACTCAAGACAGCATGACAGTGGAGGACATTGAGGCCATTATAAGTGAAACGACCTACAGTGGCTTCCCAATTGTAGTTTCTAGAGAATCCCAAAGACTAATGGGCTTTGTACTGAGAAGAGACTTGATTATCTCTATCGAAAGCGCCCGAAAAAAGCAAGAAGGGATAGTGAGCACGTCGCGGATTTACTTTACAGAGCACACGCCAACACAACCCACGACTGCTCCACCCAGCCTAAAGCTTCGTGCAATTATGGACTTAAGCCCCTTCACAATAACAGACCAGACACCTATGGAGATTGTGGTGGATATCTTCCGTAAGCTTGGTCTGCGCCAGTGCCTTGTGACACACAATGGGAGATTGCTTGGCATAATAACAAAGAAAGATGTCCTAAAGCATATAGCACAGATGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAATCTATGCCTAAAATAACAGGAGCTATGGACCCTGCTGAAGCCATATTCAGTATCATTGTAGGGTGTGTTTTGCCCTCCAGACTGTGAAGAGTGCCTTGATCATGAAGTGGATGACTGAAGCTTGGTGGCTGATTCACAAATGAGTTaaaaaaaaaaaaGCTCCCTGCACGTA
  3   1   2       bld Neu7 5g3  out                        XL045m20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGTTCAGCCATAAAACACTGGCTATGGATGTCATGCGTCCCCGGCGCAACGACCCTATATTAACGGCCATTACTCAAGACAGCATGACGGTGGAGGACATTGAGGCCATTATAAGTGAAACGACCTACAGTGGCTTCCCAATTGTAGTTTCTAGAGAATCCCAAAGACTAATGGGCTTTGTACTGAGAAGAGACTTGATTATCTCTATCGAAAGCGCCCGAAAAAAGCAAGAAGGGATAGTGAGCACATCGCGGATTTACTTTACAGAGCACACGCCAACACAACCCACGACTGCTCCACCCAGCCTAAAGCTTCGTGCAATTATGGACTTAAGCCCCTTCACAATAACAGACCAGACACCTATGGAGATTGTGGTGGATATCTTCCGTAAGCTTGGTCTGCGCCAGTGCCTTGTGACACACAATGGGAGATTGCTTGGCATAATAACAAAGAAAGATGTCCTAAAGCATATAGCACAGATGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAATCTATTCCTTAAATAACAGGAGCTATGGACTNCTGCTGAAGCCATATTCAGTATCATTGTAGGGTGTGTTTTGCACCTNCCAGACTGTGAAGAGGTGCCTTGCTNCATGAAGTGGAGTG
  3   1   2       bld FaBN      in                    IMAGE:8075960.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGTCCCGGAGGAAAGGACCTAAAATAACGGCCATACTCAAGACAGCATGACAGTGGAGGACATTGAGCCCATTATAAGTGAAACGACCTACAGTGGCTTCCCAATTGTAGTTCTTAGAGAATCCCAAAGACTAATGGGCTTTGTACTGAGAAGAGACTTGATTATCTCTATCGAAAGCGCCCGAAAAAAGCAAGAAGGGATAGTGAGCACGTCGCGGATTTACTTTACAGAGCACACGCCAACACAACCCACGACTGCTCCACCCAGCCTAAAGCTTCGTGCAATTATGGACTTAAGCCCCTTCACAATAACAGACCAGACACCTATGGAGATTGTGGTGGATATCTTCCGTAAGCTTGGTCTGCGCCAGTGCCTTGTGACACACAATGGGAGATTGCTTGGCATAATAACAAAGAAAGATGTCCTAAAGCATATAGCACAGATGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAATCTATGCCTAAAATAACAGGAGCTATGGACCCTGCTGAAGCCATATTCAGTATCATTGTAGGGTGTGTTTTGCACCTCCAGACTGTGAAGAGGTGCCTTGCATCTATGAAGTGGAGTGATTGAAGCTTTGTGTGGTTGATTCACAAAAATGAAGTTAAAAAAAAAAAATAAAGCTCTCTTTGCATGTCACTTCAAAGATTGGCCATTGATCCTTTTTTTTGCAGCCATTTGTGGCACATTTTTATGTCTTTTTAATTTTGGTATAGTGGACACTGCATGTGGAGTGAAATATACGTATAGCCGCAAACAGAA
  5   1   2       bld Ooc3                            IMAGE:3472555.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GACATTGAGGCCATTATAAGTGAAACGACCTACAGTGGCTTCCCAATTGTAGTTTCTAGAGAATCCCAAAGACTAATGGGCTTTGTACTGAGAAGAGACTTGATTATCTCTATCGAAAGCGCCCGAAAAAAGCAAGAAGGGATAGTGAGCACATCGCGGATTTACTTTACAGAGCACACGCCAACACAACCCTTTTACTGCTCCACCCAGCCTAAAGCTTCGTGCAATTATGGACTTAAGCCCCTTCACAATAACAGACCAGACACCTATGGAGATTGTGGTGGATATCTTCCGTAAGCTTGGTCTGCGCCAGTGCCTTGTGACACACAATGGGAGATTGCTTGGCATAATAACAAAGAAAGATGTCCTAAAGCATATAGCACAGATGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAATCTATTCCTTAAATAACAGGAGCTATGGACTCTGCTGAAGCCATATTCAGTATCATTGTAGGGTGTGTTTTGCACCTCCAGACTGTGAA
  5   1   2       bld DMZ       in                         xl293k22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GACATTGAGGCCATTATAAGTGAAACGACCTACAGTTGGCTTCCCAATTGTAGTTTCTAGAGAATCCCAAAGACTAATGGGCTTTGTACTGAGAAGAGACTTAATTATCTCTATCGAAAGCGCCCGAAAAAAGCAAGAAGGGATAGTGAGCACATCGCGGATTTACTTTACAGAGCACACGCCAACACAACCCACGACTGCTCCACCCAGCCTAAAGCTTCGTGCAATTATGGACTTAAGCCCCTTCACAATAACNGACCAGACACCTATGGAGATTGTGGTGGATATCTTCCGTAAGCTTGGTCTGCGCCAGTGCCTTGTGACACACAATGGGAGATTGCTTGGCATAATAACAAAGAAAGATGTCCTAAAGCATATAGCACAGATGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAATCTATGCCTAANATAACAGGAGCTATGGACTCTGCTGAAGCCATATTCAGTATCATTGTANGGTGTGTTTTGCACCTCCAGACTGTGAAGAGGTGCCTTGCATCATGAAGTGGAGTGACTGAAGCTTTGGTGGCTGATTCACGAAAATGAAGTTaaaaaaaaaaa
  3   1   2       bld Lu1                             IMAGE:4673974.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GACATTGAGGCCATTATAAGTGAAACGACCTACAGTGGCTTCCCAATTGTAGTTTCTAGAGAATCCCAAAGACTAATGGGCTTTGTACTGAGAAGAGACTTGATTATCTCTATCGAAAGCGCCCGAATAAAGCAATAAGGGATAGTGAGCACATCGCGGATTTACTTTACAGAGCACACGCCAACACAACCCACGACTGCTCCACCCAGCCTAAAGCTTCGTGCAATTATGGACTTAAGCCCCTTCACAATAACAGACCAGACACCTATGGAGATTGTGGTGGATATCTTCCGTAAGCTTGGTCTGCGCCAGTGCCTTGTGACACACAATGGGAGATTGCTTGGCATAATAACAAAGAAAGATGTCCTAAAGCATATAGCACAGATGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAATCTATTCCTTAAATAACAGGAGCTATGGACCCTGCTGAAGCCATATTCAGTATCATTGTAGGGTGTGTTTTGCACCTCCAGACTGTGAAGAGGTGCCTTGCATCATGAAGTGGAGCGACTGAAGCTTTGGTGGCTGATTCACAAAAATGAAGTT
  3   1   2       bld Li1       out                   IMAGE:5129396.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTGAGGCCATTATAAGTGAAACGACTTACAGTGGTTTCCCAATTGTAGTTTCTAGAGAATCCCAAAGACTAATGGGCTTTGTACTGAGAAGAGACTTAATTATCTCTATCGAAAGCGCCCGAAAAAAGCAAGAAGGGATAGTGAGCACATCGCGGATTTACTTTACAGAGCACACGCCAACACAACCCACGACTGCTCCACCCAGCCTAAAGCTTCGTGCAATTATGGACTTAAGCCCCTTCACAATAACAGACCAGACACCTATGGAGATTGTGGTGGATATCTTCCGTAAGCTTGGTCTGCGCCAGTGCCTTGTGACACACAATGGGAGATTGCTTGGCATAATAACAAAGAAAGATGTCCTAAAGCATATAGCACAGATGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAATCTATGCCTAAAATAACAGGAGCTATGGACTCTGCTGAAGCCATATTCAGTATCATTGTAGGGTGTGTTTTGCACCTCCAGACTGTGAAGAGGTGCCTTGCATCATGAAGTGGAGTGACTGAAGCTTTGGTGGCTGATTCACGAAAATGAAGT
  5   1   2       bld DMZ       in                         xl293l22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCTATGGACTCTGCTGAAGCCATATTCAGTATCATTGTAGGGTGTGTTTTGCACCTCCAGACTGTGAAGAGGTGCCTTGCATCATGAAGTGNAGTGACTGANGCTTTGGTGGCTGATTCACGAANATGAAGTTANAANANAAA
  3   1   0       add DMZ       in                         xl293k22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTAAAAAAAAAAAAAGCTCTCCTTGCAGGTCACTTCAAAGATGGCCATTGATCCTTTTTTCTGCAGCCATTTGGGCACATTTCTATGTCCTCTTANCTGTGGTTTAGTGGACACGCCTGTGGAGTGAAATATACGTATAGCCGCAAACAGAATTTCTGGAAGAAANTGCACCTTTACATTAANGAGAAGAATAAATGATATATAT
  3   1   0       add DMZ       in                         xl293l22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGACACGCCTGTGGAGTGAAATATACGTATAGCCGCAAACAGAATTTCTGGAAGAAATNGCACCTTTANTTAAAGNGAAGAATNACTGATATATATATATATTTAAGTAAACACACGTCCTGTCGTCAAAGGTCAGAGATCGGTGGTGTATGGTATATGCATA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)