Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xlk2h21ex.5                           6 END     4          50       66                fidgetin-like 1 [Xenopus laevis]
     2   2.0    0Xl3.1-xlk2h21ex.3                           2 END     1          12       50                (no blast hit)

 This cluster: approximate FL confidence score = 96%

 1012778663 Xl3.1-IMAGE:6865829.5 - 8 ESTs
                                                                       ........-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6865829.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAGGATTATGGGACACACGAGCAGTTACTACATCTACTTCTTCCTGTTTGACTCCATGAGCCAATTGTAGAGTAGCTACCGCGCCTGTGCCAGTCTGCCAGTGACATTTATGTGTGCTATCAACAATCTCCAGCTAGAACACAATGCAGATACCTGAAACTAGTTCAGTTCACCAGAATGAATGGCAAAGAGATGTTTTTGTGCTGAGCTCTGGCACCTGCTTACCTCAACAGAAGGCAGAAGTGTATCGTGCACATCTTGCCCAGATTCAGTATGCATGGGCTAATTCTGAGATCTCCGAGGCATCGGCAGTCCACCTGTTCAAGAAGTATGCTGAGAAGTACTCAGCAATTCTTGACTCTGACAAGTTGGAAATTGGCCTGAATAACTACGCAGACAGCATTTTGACTATGGCAAAATGTCAGAGAAATGAAAGTGACAAGTGGCAGTCTTCCTTGACAACTAATAATGTTTTAAAATTAAAGAGTGTGCAAGAGATGGCTGAGGCAGGCAGAAGAGCCCAGTTGTCTCTGTTGAATTCAACAGATGCCTCAGTTAGAGTTGGGAATGAAATCGGTACATCTGGATATTCCACTGTTCTTGCTAATAATGTCCTTAGAAACCCATCACATGCAGTTCCTCATGCTGCTTCTTCAGATTGTCAAATACCAGAGGGGAGCTCAAACTTTCTGCAAAACTCCAAGGTTTCAGCATTTACTAAAGCAAATACTTCTTCAAACACTTTGATTAACAACA
                                                  Xl3.1-CHK-1012698029                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TATGGGACACACGAGCAGTTACTACATCTACTTCTTCCTGTTTGACTCCATGAGCCAATTGTAGAGTAGCTACCGCGCCTGTGCCAGTCTGCCAGTGACATTTATGTGTGCTATCAACAATCTCCAGCTAGAACACAATGCAGATACCTGAAACTAGTTCAGTTCACCAGAATGAATGGCAAAGAGATGTTTTTGTGCTGAGCTCTGGCACCTGCTTACCTCAACAGAAGGCAGAAGTGTATCGTGCACATCTTGCCCAGATTCAGTATGCATGGGCTAATTCTGAGATCTCCGAGGCATCGGCAGTCCACCTGTTCAAGAAGTATGCTGAGAAGTACTCAGCAATTCTTGACTCTGACAAGTTGGAAATTGGCCTGAATAACTACGCAGACAGCATTTTGACTATGGCAAAATGTCAGAGAAATGAAAGTGACAAGTGGCAGTCTTCCTTGACAACTAATAATGTTTTAAAATTAAAGAGTGTGCAAGAGATGGCTGAGGCAGGCAGAAGAGCCCAGTTGTCTCTGTTGAATTCAACAGATGCCTCAGTTAGAGTTGGGAATGAAATCGGTACATCTGGATATTCCACTGTTCTTGCTAATAATGTCCTTAGAAACCCATCACATGCAGTTCCTCATGCTGCTTCTTCAGATTGTCAAATACCAGAGGGGAGCTCAAACTTTCTGCAAAACTCCAAGGTTTCAGCATTTACTAAAGCAAATACTTCTTCAAACACTTTGATTAACAACAGTATTC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  2     2     3     3     3     3     4     4     4     4     4     5     5     5     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     7     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     6     6     5     6     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     2     3     2     3     2     3     2     3     2     3     2     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -------T----
                                               BLH ATG     143     350                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                               BLH MIN     137      52                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                               BLH OVR     143     773                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                               EST CLI       0       1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                               ORF LNG     143      36                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Bt ---- 1e-020     XP_611641.1 PREDICTED: similar to hypothetical protein [Bos taurus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Dr ==== 3e-034     NP_001122223.1 wu:fb82h05 [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Mm ==== 1e-036     NP_068691.2 fidgetin-like 1 [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Hs ==== 2e-039     NP_001036227.1 fidgetin-like 1 [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Cf ---- 1e-042     XP_540351.2 PREDICTED: similar to fidgetin-like 1 [Canis familiaris] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED = Gg ==== 1e-045     XP_001234039.1 PREDICTED: fidgetin-like 1 [Gallus gallus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - ?? ---- 1e-045     XP_584098.2 PREDICTED: similar to fidgetin-like 1 [Bos taurus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Xt ==== 9e-091     A4IHT0.1 Fidgetin-like protein 1 [Xenopus tropicalis]  ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Xl ==== 6e-112     NP_001086763.1 fidgetin-like 1 [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6865829.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGA------------------------------------------TGA------------------------------TAG------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ...
  5   1   2       bld Oo1  5g3  out                   IMAGE:3405304.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAAGATTGTGCGACTAGGATTATGGGACACACGAGCAGTTACTACATCTACTTCTTCCTGTTTGACTCCATGAGCCAATTGTAGAGTAGCTACCGCGCCTGTGCCAGTCTGCCAGTGACATTTATGTGTGCTATCAACAATCTCCAGCTAGAACACAATGCAGATACCTGAAACTAGTTCAGTTCACCATAATGAATGGCAAAGAGATGTTTTTGTGCTGAGCTCTGGCACCTGCTTACCTCAACAGAAGGCAGAAGTGTATCGTGCACATCTTGCCCAGATTCAGTATGCATGGGCTAATTCTGAGATCTCCGAGGCATCGGCAGTCCACCTGTTCAAGAAGTATGCTGAGAAGTACTCAGCAATTCTTGACTCTGACAAGTTGGAAATTGGCCTGAATAACTACGCAGACAGCATTTTGACTATG
  5   1   2       bld Ov1  5g                         IMAGE:6319281.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAGGATTATGGGACACACGAGCAGTTACTACATCTGCTTCTTCCTGTTTGACTCCATGAGCCAATTGTAGAGTAGCTACCGCGCCTGTGCCAGTCTGCCAGTGACATTTATGTGTGCTATCAACAATCTCCAGCTAGAACACAATGCAGATACCTGAAACTAGTTCAGTTCACCAGAATGAATGGCAAAGAGATGTTTTTGTGCTGAGCTCTGGCACCTGCTTACCTCAACAGAAGGCAGAAGTGTATCGTGCACATCTTGCCCAGATTCAGTATGCATGGGCTAATTCTGAGATCTCCGAGGCATCGGCAGTCCACCTGTTCAAGAAGTATGCTGAGAAGTACTCAGCAATTCTTGACTCTGACAAGTTGGAAATTGGCCTGAATAACTATGCAGACAGCATTTTGACTATGGCAAAATGTCAGAGAAATGAAAGTGACAAGTGGCAGTCTTCCTTGACAACTAATAATGTTTTAAAATTAAAGAGTGTGCAAGAGATGGCTGAGGCAGGCAGAAGAGCCCAGTTGTCTCTGTTGAATTCAACAGATGCCTCAGTTAGAGTTGGGAATGAAATCGGTACATCTGGATATTCCACTGTTCTTGCTAATAATGTCCTTAGAAACCCATCACATGCAGTTCCTCATGCCTGCTTCTTCAGATTGTCAAATACCAGAGGGGGAGCTCAAAACTTTCTGCAAAACTCCAAGGGCTTCCACATTTTACTAAAAGCAAATACTTCTTCCAAACACTTTTGATTAACAACAGGTATTCCTATTAACTACTTCCTTGGATGCAAACCCCAAGGAAGATAAAAGCTCCCCACGGACGGTTCTTTTATTCACGTCCTGGCCCCAAATGGGGTTTTCCATCCAACTAACC
  5   1   2      seed Emb1 5g                         IMAGE:6865829.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GACACACGAGCAGTTACTACATCTACTTCTTCCTGTTTGACTCCATGAGCCAATTGTAGAGTAGCTACCGCGCCTGTGCCAGTCTGCCAGTGACATTTATGTGTGCTATCAACAATCTCCAGCTAGAACACAATGCAGATACCTGAAACTAGTTCAGTTCACCAGAATGAATGGCAAAGAGATGTTTTTGTGCTGAGCTCTGGCACCTGCTTACCTCAACAGAAGGCAGAAGTGTATCGTGCACATCTTGCCCAGATTCAGTATGCATGGGCTAATTCTGAGATCTCCGAGGCATCGGCAGTCCACCTGTTCAAGAAGTATGCTGAGAAGTACTCAGCAATTCTTGACTCTGACAAGTTGGAAATTGGCCTGAATAACTACGCAGACAGCATTTTGACTATGGCAAAATGTCAGAGAAATGAAAGTGACAAGTGGCAGTCTTCCTTGACAACTAATAATGTTTTAAAATTAAAGAGTGTGCAAGAGATGGCTGAGGCAGGCAGAAGAGCCCAGTTGTCTCTGTTGAATTCAACAGATGCCTCAGTTAGAGTTGGGAATGAAATCGGTACATCTGGATATTCCACTGTTCTTGCTCATAATGTCCTTAGAAACCCATCACATGCAGTTCCTCATGCTGCTTCTTCAGATTGTCAAATACCAGAGGGGAGCTCAAACTTTCTGCAAAACTCCCAGGTTTCAGCATTTACTAAAGCAAATACTTCTTCAAACACTTTGATTAACAACAGTATTCCCTATTAATACTTCCTTGGATGCAACGCAATGAAGTCAAAGCTCCCACGACGTTTCTCTACTCAGTCCTGGCCCAAATGTGGTTTTCATCTACTACCCTCTGTATATTCAGGGGAAAAAG
  5   1   2       bld Ga12 5g3  out                        XL191f06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTACATCTACTTCTTCCTGNTTGACTCCATGAGCCAATTGTAGAGTAGCTACCGCGCCTGTGCCAGTCTGCCAGTGACATTTATGTATGCTATCAACAATCTCCAGCTAGAACACAATGCAGATACCTGAAACTAGTTCAGTTCACCAGAATGAATGGCAAAGAGATGTTTTTGTGCTGAGCTCTGGCACCTGCTTACCTCAACAGAAGGCAGAAGTGTATCGTGCACATCTTGCCCAGATTCAGTATGCATGGGCTAATTCTGAGATCTCCGAGGCATCGGCAGTCCACCTGTTCAAGAAGTATGCTGAGAAGTACTCAGCAATTCTTGACTCTGACAAGTTGGAAATTGGCCTGAATAACTACGCAGACAGCATTTTGACTATGGCAAAATGTCAGAAAATGAAAGTGACA
  5   1   2       bld Ov1       out                   IMAGE:5074804.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCGACCCACGCGTCCGGTAGCTACCGCGCCTGTGCCAGTCTGCCAGTGACATTTATGTGTGCTATTAACAATCTCCAGCTAGAACACAATGCAGATACCTGAAACTAGTTCAGTTCACCAGAATGAATGGCAAAGAGATGTTTTTGTGCTGAGCTCTGGCACCTGCTTACCTCAACAGAAGGCAGAAGTGTATCGTGCACATCTTGCCCAGATTCAGTATGCATGGGCTAATTCTGAGATCTCCGAGGCATCGGCAGTCCACCTGTTCAAGAAGTATGCTGAGAAGTACTCAGCAATTCTTGACTCTGACAAGTTGGAAATTGGCCTGAATAACTATGCAGACAGCATTTTGACTATGGCAAAATGTCAGAGAAATGAAAGTGACAAGTGGCAGTCTTCCTTGACAACTAATAATGTTTTAAAATTAAAGAGTGTGCAAGAGATGGCTGAGGCAGGCAGAAGAGCCCAGTTGTCTCTGTTGAATTCAACAGATGCCTCAGTTAGAGTTGGGAATGAAATCGGTACATCTGGATATTCCACTGTTCTTGCTAATAATGTCCTTAGAAACCCATCACATGCAGTTCCTCATGCTGCTTCTTCAGATTGTCAAATACCAGAGGGGAGCTCAAACTTTCT
  5   1   2       bld Oo1  5g3  out                   IMAGE:3404463.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGCCTGTGCCAGTCTGCCAGTGACATTTATGTGTGCTATCAACAATCTCCAGCTAGAACACAATGCAGATACCTGAAACTAGTTCAGTTCACCAGAATGAATGGCAAAGAGATGTTTTTGTGCTGAGCTCTGGCACCTGCTTACCTCAACAGAAGGCAGAAGTGTATCGTGCACATCTTGCCCAGATTCAGTATGCATGGGCTAATTCTGAGATCTCCGAGGCATCGGCAGTCCACCTGTTCAAGAAGTATGCTGAGAAGTACTCAGCAATTCTTGACTCTGACAAGTTGGAAATTGGCCTGAATAACTACGCAGACAGCATTTTGACT
  5   1   2       bld Oo1  5g3  out                   IMAGE:3403381.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCTGCCAGTGACATTTATGTGTGCTATCAACAATCTCCAGCTAGAACACAATGCAGATACCTGAAACTAGTTCAGTTCACCATAATGAATGGCAAAGAGATGTTTTTGTGCTGAGCTCTGGCACCTGCTTACCTCAACAGAAGGCAGAAGTGTATCGTGCACATCTTGCCCAGATTCAGTATGCATGGGCTAATTCTGAGATCTCCGAGGCATCGGCAGTCCACCTGTTCAAGAAGTATGCTGAGAAGTACTCAGCAATTCTTGACTCTGACAAGTTGGAAATTGGCCTGAATAACTACGCAGACAGCATTTTGACTATGGCAAAATGTCAGAGAAATGAAAGTGACAAGTGGCAGTCTTCCTTGACAACTAATAATGTTTTAAAATTAAAGAGTGTGCAAGAGATGGCTGA
  5   1   2       bld Oo1                             IMAGE:5079424.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGGACCGGTCCGGATTTCGGGAGGATCGGAGTCCCCTGTTCAGAAGTATGCTGAGAAGTACTCAGCAATTCTTGACTCTGACAAGTTGGAAATTGGCCTGAATAACTATGCAGACAGCATTTTGACTATGGCAAAATGTCAGAGAAATGAAAGTGACAAGTGGCAGTCTTCCTTGACAACTAATAATGTTTTAAAATTAAAGAGTGTGCAAGAGATGGCTGAGGCAGGCAGAAGAGCCCAGTTGTCTCTGTTGAATTCAACAGATGCCTCAGTTAGAGTTGGGAATGAAATCGGTACATCTGGATATTCCACTGTTCTTGCTAATAATGTCCTTAGAAACCCATCACATGCAGTTCCTCATGCTGCTTCTTCAGATTGTCAAATACCAGAGGGGAGCTCAAACTTTCTGCAAAACTCCAAGGTTTCAGCATTTACTAAAGCAAATACTTCTTCAAACACTTTGATTAACAACAGTATTCCTATTACTACTTCCTTGATGCAACGCAATGAAGTCAAAGCTCCCACGACGTTCTCTACTCAGTCTGGCCCAAATGTGTTTTCATCTACTACCTCTGTATATTCAGGGAAAAGGAAAGCATGTTATACCTTAGGTGATGAGAGCACTGATATTCAACCTAAGCCTTTAGTTCAAAGGCAGCTTGCTAGCAAAGAAGCTACAGGTGGACAGTGACCTTTAAAACCCGCAAAAAAGAGCAAGTTGGTGGGGTTTGATCCAGCCAGGAAGAAAACCACAGGTTAAATCCAGCCCCTCCAGCCGGTTAAATCCCCTGGGGTCCCCTTTTTGGTAATggggggggggCTGGCGCCAAAAAAAGAAGTCTCCACCCTGGGGGGGAAAAGCCTTTGGCCCACACCGGATTTTCCCCTCCCCCGTGGGGGGGTCCCCCTTTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)