Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 73%

 1012778680 Xl3.1-IMAGE:7209781.5 - 6 ESTs
                                                                       ..-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7209781.5                                                                                                                                                                                                                                                                                 GAGAAAGAAGTCGCCAACCATTGCGATGTCCCAGCAAGTTTCTTCCATGAATAGGAAAAACCTGCAGAAGCAGGCAGAAGCCCTGAGCCGACTCATCAAGCATTTTAGTAAGAGTGAAGTGGAGAGCCTCATCCGGCTCTATCATACGTTGGTGGGGCGCCCTGGTGATCCTAATACAAGGCGCGGCATTGACCGGAACACTTTCAGAAACATCCTGCACAATACATTTGGCATGACTGATGATATGATCATGGACAGAGTATTTCGAGGATTTGACAAAGATAATGACAGCTTCATCAGTGTTACAGAATGGGTGGAAGGATTGTCTGTATTTTTACATGGGACTCTAGAAGAAAAGATCAAATATTGTTTTGGTGTTTATGACCTGAATGGTGATGGCTATATCTCCAGAGAAGAGATGTTCCACATGTTAAAGAACAGCCTACTAAAGCAGCCAAGTGAAGAAGACCCTGATGAAGGTGTAAAGGACTTGGTTGAAATAGCATTAAAAAAGATGGATTATGACCATGACAGCAAATTGTCCTATACAGATTTTGAAAAAGCTGTACAAGAAGAAAATCTCCTGCTAGAAGCATTTGGGACTTGTCTTCCAGATAGCAAATGCATTATGGCTTTTGAAAGACAAGCTTTTACAGAAATGAATGATATATAGAAATGCTATGCAATCAGTACTGCAATTTCTTCGGCCACATACGGGAATGAATGGTGCCGGTCCACTGATTG
                                                  Xl3.1-CHK-1012702562                                                                                                                                                                                                                                                                                       GAAGTCGCCAACCATTGCGATGTCCCAGCAAGTTTCTTCCATGAATAGGAAAAACCTGCAGAAGCAGGCAGAAGCCCTGAGCCGACTCATCAAGCATTTTAGTAAGAGTGAAGTGGAGAGCCTCATCCGGCTCTATCATACGTTGGTGGGGCGCCCTGGTGATCCTAATACAAGGCGCGGCATTGACCGGAACACTTTCAGAAACATCCTGCACAATACATTTGGCATGACTGATGATATGATCATGGACAGAGTATTTCGAGGATTTGACAAAGATAATGACAGCTTCATCAGTGTTACAGAATGGGTGGAAGGATTGTCTGTATTTTTACATGGGACTCTAGAAGAAAAGATCAAATATTGTTTTGGTGTTTATGACCTGAATGGTGATGGCTATATCTCCAGAGAAGAGATGTTCCACATGTTAAAGAACAGCCTACTAAAGCAGCCAAGTGAAGAAGACCCTGATGAAGGTGTAAAGGACTTGGTTGAAATAGCATTAAAAAAGATGGATTATGACCATGACAGCAAATTGTCCTATACAGATTTTGAAAAAGCTGTACAAGAAGAAAATCTCCTGCTAGAAGCATTTGGGACTTGTCTTCCAGATAGCAAATGCATTATGGCTTTTGAAAGACAAGCTTTTACAGAAATGAATGATATATAGAAATGCTATGCAATCAGTACTGCAATTTCTTCGGCCACATACGGGAATGAATGGTGCCGGTCCAC
                                                      consensus depths                                                                                                                                                                                                                                                                                      2     5     3     5     4     6     4     6     5     6     5     6     5     6     5     6     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     3     4     3     4     3     4     3     4     2     4     2     4     2     4
                                               BLH ATG      25     167                                                                                                                                                                                                                                                                                 
                                               BLH MIN      25     101                                                                                                                                                                                                                                                                                 
                                               EST CLI     -36       1                                                                                                                                                                                                                                                                                 
                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ce ---- 2e-011     NP_508201.2 neuronal Calcium Sensor (ncs-3) [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 8e-042     NP_572437.1 CG2256-PB [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Ag ==== 9e-045     XP_310844.3 AGAP000276-PA [Anopheles gambiae str. PEST] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Sp ---- 1e-057     XP_001193804.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Ci ==== 1e-066     NP_001027760.1 calcineurin-like protein [Ciona intestinalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Hs ==== 6e-080     NP_078869.1 hypothetical protein FLJ11767 [Homo sapiens] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                    PREDICTED - Cf ---- 4e-080     XP_535064.2 PREDICTED: similar to EF hand calcium binding domain 1 [Canis familiaris] ------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Bt ==== 6e-081     NP_001032674.1 hypothetical protein LOC505272 [Bos taurus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Gg ==== 2e-081     XP_418657.2 PREDICTED: similar to EF hand calcium binding domain 1 isoform 2 [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Dr ==== 3e-082     NP_001038325.1 hypothetical protein LOC558421 [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Mm ==== 1e-082     NP_080045.1 RIKEN cDNA 5430404L10 [Mus musculus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Xt ==== 4e-117     CAJ83954.1 novel protein containing three EF hand domains [Xenopus tropicalis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Xl ==== 4e-119     NP_001089695.1 hypothetical protein LOC734757 [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:7209781.5                                                                                                                                                                                                                                                                                                          ATG------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG---------------------------ATG---------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                          ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  3   1   2       bld Te2  5g3  in                    IMAGE:7390962.3p                                                                                                                                                                                           GGTTTGCTATCGGCTCATTTGCTCTACCGCGATCGTCGTTGCTAGCGGAGTACATTCCCAGACAGTTGCATAGCTATAGGACCATGACAGTTCGTCNGATCCCGGAGTGGAGAGAGTCGCAACATGGAGTCCAGCAGTTCTCCATGATAGGAAACCGCAGAGCAGGCAGAGCCCTGAGCCGATCTCAAGCATTTAGTAGAGTGAAGTGAGAGCCTCATCCGGCTCTATCATACGTTGGTGGGGCGCCCTGGTGATCCTAATACAAGGCGCGGCATTGACCGGAACACTTTCAGAAACATCCTGCACAATACATTTGGCATGACTGATGATATGATCATGGACAGAGTATTTCGAGGATTTGACAAAGATAATGACAGCTTCATCAGTGTTACAGAATGGGTGGAAGGATTGTCTGTATTTTTACATGGGACTCTAGAAGAAAAGATCAAATATTGTTTTGGTGTTTATGACCTGAATGGTGATGGCTATATCTCCAGAGAAGAGATGTTCCACATGTTAAAGAACAGCCTACTAAAGCAGCCAAGTGAAGAAGACCCTGATGAAGGTGTAAAGGACTTGGTTGAAATAGCATTAAAAAAGATGGATTATGACCATGACAGCAAATTGTCCTATACAGATTTTGAAAAAGCTGTACAAGAAGAAAATCTCCTGCTAGAAGCATTTGGGACTTGTCTTCCAGATAGCAAATGCATTATGGCTTTTGAAAGACAAGCTTTTACAGAAATGAATGATATATAGAAATGCTATGCAATCAGTACTGCAATTTCTTCGGCCACATACGGGAATGAATGGTGCCGGTCCACTGATTGCATCAGAACTGACAATGATCTGTACAACGGGCACACTT
  5   1   2       bld Te2N 5g                         IMAGE:7767736.5p                                                                                                                                                                                                                                             ATTGTGTCTACACACAGGTCGACTTAGAGCAGTTGAGAGAAAGAAGTCGCCAACCATTGCGATGTCCCAGCAAGTTTCTTCCATGAATAGGAAAAACCTGCAGAAGCAGGCAGAAGCCCTGAGCCGACTCATCAAGCATTTTAGTAAGAGTGAAGTGGAGAGCCTCATCCGGCTCTATCATACGTTGGTGGGGCGCCCTGGTGATCCTAATACAAGGCGCGGCATTGACCGGAACACTTTCAGAAACATCCTGCACAATACATTTGGCATGACTGATGATATGATCATGGACAGAGTATTTCGAGGATTTGACAAAGATAATGACAGCTTCATCAGTGTTACAGAATGGGTGGAAGGATTGTCTGTATTTTTACATGGGACTCTAGAAGAAAAGATCAAATATTGTTTTGGTGTTTATGACCTGAATGGTGATGGCTATATCTCCAGAGAAGAGATGTTCCACATGTTAAAGAACAGCCTACTAAAGCAGCCAAGTGAAGAAGACCCTGATGAAGGTGTAAAGGACTTGGTTGAAATAGCATTAAAAAAGATGGATTATGACCATGACAGCAA
  5   1   2      seed Neu7 5g                              XL022n13.5p                                                                                                                                                                                                                                                               GTCGACTTAGAGCAGTTGAGAGAAAGAAGTCGCCAACCATTGCGATGTCCCAGCAAGTTTCTTCCTGAATAGGAAAAACCTGCAGAAGCAGGCAGAAGCCCTGAGCCGACTCATCAAGCATTTTAGTAAGAGTGAAGTGGAGAGCCTCATCCGGCTCTATCATACGTTGGTGGGGCGCCCTGGTGATCCTAATACAAGGCGCGGCATTGACCGGAACACTTTCAGAAACATCCTGCACAATACATTTGGCATGACTGATGATATGATCATGGACAGAGTATTTCGAGGATTTGACAAAGATAATGACAGCTTCATCAGTGTTACAGAATGGGTGGAAGGATTGTCTGTATTTTTACATGGGACTCTAGAAGAAAAGATCAAATATTGTTTTGGTGTTTATGACCTGAATGGTGATGGCTATATCTCCAGAGAAGAGATGTTCCACATGTTAAAGAACAGCCTACTAAAGCAGCCAAGTGAAGAAGACCCTGATGAAGGTGTAAAGGACTTGGTTGAAATAGCATTAAAAAAGATGGATTATGACCATGACAGCAAATTGTCCTATACAGATTTTGAAAAAGCTGTACAAGAAGAAAATCTCCTGCTAGAAGCATTTGGGACTTGTCTTCCAGATAGCAAATGCATTATGGCTTTTGAAAGAC
  5   1   2       bld Te2N 5x3                        IMAGE:7768483.5p                                                                                                                                                                                                                                                                          CAGTTGAGAGAAAGAAGTCGCCAACCATTGCGATGTCCCAGCAAGTTTCTTCCATGAATAGGAAAAACCTGCAGAAGCAGGCAGAAGCCCTGAGCCGACTCATCAAGCATTTTAGTAAGAGTGAAGTGGAGAGCCTCATCCGGCTCTATCATACGTTGGTGGGGCGCCCTGGTGATCCTAATACAAGGCGCGGCATTGACCGGAACACTTTCAGAAACATCCTGCACAATACATTTGGCATGACTGATGATATGATCATGGACAGAGTATTTCGAGGATTTGACAAAGATAATGACAGCTTCATCAGTGTTACAGAATGGGTGGAAGGATTGTCTGTATTTTTACATGGGACTCTAGAAGAAAAGATCAAATATTGTTTTGGTGTTTATGACCTGAATGGTGATGGCTATATCTCCAGAGAAGAGATGTTCCACATGTTAAAGAACAGCCTACTAAAGCAGCCAAGTGAAGAAGACCCTGATGAAGGTGTAAAGGACTTGGTTGAAATAGCATTAAAAAAGATGGATTATGACCATGACAGCAAATTGTCCTATACAGATTTTGAAAAAGCTGTACAAGAAGAAAATCTCCTGCTAGAAGCATTTGGGACTTGTCTTCCAGATAGCAAATGCATTATGGCTTTTGAAAGACAAGCTTTTACAGAAATGAATGATATATAGAAATGCTATGNCATCAGTACTGCAATTTCTCGGNCACATACGGGAATGAATGGGTGCCGTCACTGATGCATCAGACT
  5   1   2       bld Te2  5g3  in                    IMAGE:7390962.5p                                                                                                                                                                                                                                                                              TTGAGAGAAGAAGTCGCCAACCATTGCGATGTCCCAGCAAGTTTCTTCCATGAATAGGAAAAACCTGCAGAAGCAGGCAGAAGCCCTGAGCCGACTCATCAAGCATTTTAGTAAGAGTGAAGTGGAGAGCCTCATCCGGCTCTATCATACGTTGGTGGGGCGCCCTGGTGATCCTAATACAAGGCGCGGCATTGACCGGAACACTTTCAGAAACATCCTGCACAATACATTTGGCATGACTGATGATATGATCATGGACAGAGTATTTCGAGGATTTGACAAAGATAATGACAGCTTCATCAGTGTTACAGAATGGGTGGAAGGATTGTCTGTATTTTTACATGGGACTCTAGAAGAAAAGATCAAATATTGTTTTGGTGTTTATGACCTGAATGGTGATGGCTATATCTCCAGAGAAGAGATGTTCCACATGTTAAAGAACAGCCTACTAAAGCAGCCAAGTGAAGAAGACCCTGATGAAGGTGTAAAGGACTTGGTTGAAATAGCATTAAAAAAGATGGATTATGACCATGACAGCAAATTGTCCTATACAGATTTTGAAAAAGCTGTACAAGAAGAAAATCTCCTGCTAGAAGCATTTGGGACTTGTCTTCCAGATAGCAAATGCATTATGGCTTTTGAAAGACAAGCTTTTACAGAAATGATGATATATAGAAATGCTATGCNATCAGTACTGCAATTTCTCGGCACATACGGAATGAATGGTGCNGTCACTGATGCATCAGACTGACATGTCTGTACACGGGCACACTTTTCTGATAAGCATCACATTTaaaaaaaaaa
  5   1   2       bld Te2  5x3                        IMAGE:7209781.5p                                                                                                                                                                                                                                                                                                    ATTGCGATGTCCCAGCAAGTTTCTTCCATGAATAGGAAAAACCTGCAGAAGCAGGCAGAAGCCCTGAGCCGACTCATCAAGCATTTTAGTAAGAGTGAAGTGGAGAGCCTCATCCGGCTCTATCATACGTTGGTGGGGCGCCCTGGTGATCCTAATACAAGGCGCGGCATTGACCGGAACACTTTCAGAAACATCCTGCACAATACATTTGGCATGACTGATGATATGATCATGGACAGAGTATTTCGAGGATTTGACAAAGATAATGACAGCTTCATCAGTGTTACAGAATGGGTGGAAGGATTGTCTGTATTTTTACATGGGACTCTAGAAGAAAAGATCAAATATTGTTTTGGTGTTTATGACCTGAATGGTGATGGCTATATCTCCAGAGAAGAGATGTTCCACATGTTAAAGAACAGCCTACTAAAGCAGCCAAGTGAAGAAGACCCTGATGAAGGTGTAAAGGACTTGGTTGAAATAGCATTAAAAAAGATGGATTATGACCATGACAGCAAATTGTCCTATACAGATTTTGAAAAAGCTGTACAAGAAGAAAATCTCCTGCTAGAAGCATTTGGGACTTGTCTTCCAGATAGCAAATGCATTATGGCTTTTGAAAGACAAGCTTTTACAGAAATGAATGATATATAGAAATGCTATGCAATCAGTACTGCAATTTCTTCGGCCACATACGGNAATGAATGGTNGCGGTCCACTGATTGCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)