Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 18 Jul 2019 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:8328784.5                       9 END     6          40       66                (no blast hit)
     2   2.0    0Xl3.1-IMAGE:5073905.3                       3 END     1           6       33                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-IMAGE:5073905.3                       3 PI      86        442      792                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012778686 Xl3.1-IMAGE:8328784.3 - 15 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8328784.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTACTGGGAAGATAGTGGCCTGTGTTGGTGTTGCCCCACATGGCTTTATGCCTAAGGAAGAATTTACTTTCCCTTTACTTTGAGCAGATAACAGTGTGTTTGAGAGCCCCTTCCCTGAAAGAGGTATGCAGGTATTTAAGCAGATATTGATAGTACTGCACAATATGTATTGACAACGCATTTCACGCCAGTCAGCAGATGGTGTCGCTGGCAGCAGTTACACCTGAAAGCATTAAAGTAAAAGAGGAAACCTTTTGCTCTCTAGCTCTACCTTTTTTACATACAATAGTTACAACCTCTCATGAGACCAGTAGTTCATATCCTTATTAGCGGCATGCTGTATTTTACCTTCAGCGTTGCTCGCATTATGCATACCGCACGGGTTTCCATCATGGAACGAGTTAAAGGCATGCCTCCCTCTAACCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATATACGTGCCATGTTGTTGCAGAACTCAACAATCCCTTGCCACTTCAGTTTTGTATGCTGTTCTGCCATGTGATGAAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGATCTGCAGCAGAGAGTAAAACTAGCCCATAAAAACCACAGATCCACCACCGGGAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGGCTTTTAA
                                                  Xl3.1-CHK-1012691679                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAAGATAGTGGCCTGTGTTGGTGTTGCCCCACATGGCTTTATGCCTAAGGAAGAATTTACTTTCCCTTTACTTTGAGCAGATAACAGTGTGTTTGAGAGCCCCTTCCxxxAxAGAGGTATGCAGGTATTTAAGCAGATATTGATAGTACTGCACAATATGTATTGACAACGCATTTCACGCCAGTCAGCAGATGGTGTCGCTGGCAGCAGTTACACCTGAAAGCATTAAAGTAAAAGAGGAAACCTTTTGCTCTCTAGCTCTACCTTTTTTACATACAATAGTTACAACCTCTCATGAGACCAGTAGTTCATATCCTTATTAGCGGCATGCTGTATTTTACCTTCAGCGTTGCTCGCATTATGCATACCGCACGGGTTTCCATCATGGAACGAGTTAAAGGCATGCCTCCCTCTAACCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATATACGTGCCATGTTGTTGCAGAACTCAACAATCCCTTGCCACTTCAGTTTTGTATGCTGTTCTGCCATGTGATGAAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGATCTGCAGCAGAGAGTAAAACTAGCCCATAAAAACCACAGATCCACCACCGGGAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGGCTTTTAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          2     4     3     5     3     5     3     5     2     4     3     5     3     5     3     5     2     4     2     4     3     5     3     5     3     6     3     6     3     6     4     6     4     6     5     7     5     7     6     8     6     8     6     8     6     8     5     8     5     8     9    11     8    10     9    11     9    11     9    11     9    11     9    11     8    11     9    11     9    11     9    11     8    10     9    11     8    10     8    10     8    10     8    10     8    10     8    11     8    11     8    11     7    11     7    11     7    11     7    11     8    11     5    10     7    10     8    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     8    10     6     9     6     7     5     6     3     4
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------G----
  5   1   0       add Ga14                               Ga14-p14h1.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTANAGATTCGTATNTCGCCCACCTTAGATGCACCTGCCTGCCGCCCCCTGAGTGGTGAGAAAGGTGATGCCTGGATATTCCCTCANAGTGTTTGACTACAAAAAGTCATGCGTTCTGCGGCATCACCCAACTCCCCCANAACATACAGACGGACCCTATGATCCCAACAGTGTCCGCATCAGCTTTGCCAAGGGTTGGGGCCCGTGTTATTCCCGCCAGATGATCACCTCTTGCCCCTGCTGGCTGGAGGTCCTANTGGGAAGATAGTGGCCTGTGTTGGTGTTGCCCCACATGGCTTTANGCCTAAGGAANAATTTACTTTCCCTTTACTTTGAGCAGATAACAGTGTGTTTGAGAGC
  5   1   2       bld Egg1      in                    IMAGE:3301062.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTGGCTGGAGGTCCTACTGGGAAAATAGTGGCCTGTGTTGGTGTTGCTCCACATGGCTTTATGCCTAAAGGAAGAATTTACTTTCCCTTTACTTTGAGCAGATAACAGTGTGTTTGAGAGCCCCTTCCCTGAAAGAGAGGTATGCAGGTATTTAAGCAGATATTGATAGTACTGCACAATATGTATTGACAACGCATTTCACGCCAGTCAGCAGATGGTGTCGCTGGCAGCAGTTACACCTGAAAGCATTAAAGTAAAAGAGGAAACCTTTTGCTCTCTAGCTCTACCTTTTTTACATACAATAGTTACAACCTCTCATGAGACCAGTAGTTCATATCCTTATTAGCGGCATGCTGTATTTTACCTTCAGCGTTGCTCGCATTATGCATACCGCACGGGTTTCCATCATGGAACGAGTTAAAGGCATGCCTCCCTCTAACCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATATACGTGCCATGTTGTTGCAGAACTCAACAATCCCTTGCCACTTCAGTTTTGTATGCTGTTCTGCCATGTGATGAAAAGCCTTTAGAAGTTATGGGTTCATTCTTCTGATCTGCAGCAGATAGTAAAACTAGCCCATATAAACCACAGATCCACC
  3   1   2       bld Ov1  5g3  out                   IMAGE:8328784.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCTGAAAGAGAGGTATGCAGGTATTAAAGCAGATATTGATAGTACTGTACAATATGTATTGACAACGCATTTCACGCCAGTCAGCAGATGGTGTCGCTGGCAGCAGTTACACCTGAAAGCATTAAAGTAAAAGAGGAAACCTTTTGCTCTCTAGCTCTACCTTTTTTACATACAATAGTTACAACCTCTCATGAGACCAGTAGTTCATATCCTTATTAGCGGCATGCTGTATTTTACCTTCAGCGTTGCTCGCATTATGCATACCGCACGGGTCTCCATCATGGAACGAGTTAAAGGCATGCCTCCCTCTAACTACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATATACGTGCCATGTTGTTGCAGAACTCGACAATCCCTTGCCACTTCAGTTTTGTATGCTGTTCTGCCATGTGATGAAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGATCTGCAGCAGAGAGTAAAACTAGCCCATAAAAACCACAGATCCAACACCGGGAAGGACTCTCACGAGCATCGTGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGGCTTTTAAAAAAAAAAAAAAAAG
  3   1   2       bld Egg1      in                    IMAGE:3301062.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAAGCAAGAGATTGATAGACTGCACGATATGTATTGACAAGCATTTCACGCCAGTCAGCAGATGGTGTCACTGGCAGCAGTAACACCTGTAAGCATTAATGTAAAAGAGGAAGCGTTTTGCTCTCTAGCTCTACCTTTCTTACAACATATAGTTCAAACATATCATGAGTCCAGTAGTTCATATCATTATTAGCGGCATGCTGTATTTTACCTTCAGCGTTGCTCGCATTATGCATACCGCACGGGTTTCCATCATGAAACGAGTTAAAGGCATGCCTCCCTCTAACCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATATACGTGCCATGTTGTTGCAGAACTCAACAATCCCTTGCCACTTCAGTTTTGTATGCTGTTCTGCCATGTGATGAAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGATCTGCAGCAGAGAGTAAAACTAGCCCATAATAACCACAGATCCTCCACCGGGAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGGCTTTTAAAAAAAA
  3   1   2       bld Ov1  5g3  out                   IMAGE:5073767.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCGCTGGCAGCAGTTACACCTGAAAGCATTAAAGTAAAAGAGGAAACCTTTTGCTCTCTAGCTCTACCTTTTTTACATACAATAGTTACAACCTCTCATGAGACCAGTAGTTCATATCCTTATTAGCGGCATGCTGTATTTTACCTTCAGCGTTGCTCGCATTATGCATACCGCACGGGTCTCCATCATGGAACGAGTTAAAGGCATGCCTCCCTCTAACTACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATATACGTGCCATGTTGTTGCAGAACTCGACAATCCCTTGCCACTTCAGTTTTGTATGCTGTTCTGCCATGTGATGAAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGATCTGCAGCAGAGAGTAAAACTAGCCCATAAAAACCACAGATCCAACACCGGGAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGGCTTTT
  3   1   2       bld Tbd7      out                        XL067j16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACCTGAAAGCATTAAAGTAAAAGAGGAAACCTTTTGCTCTCTAGCTCTACCTTTTTTACATACAATAGTTACAACCTCTCATGAGACCAGTAGTTCATATCCTTATAAGCGGCATGCTGTATTTTACCTTCAGCGTTGCTCGCATTATGCATACCGCACGGGTTTCCATCATGGAACGAGTTAAAGGCATGCCTCCCTCTAACCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATATACGTGCCATGTTGTTGCAGAACTCAACAATCCCTTGCCACTTCAGTTTTGTATGCTGTTCTGCCATGTGATGAAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGATCTGCAGCAGAGAGTAAAACTAGCCCATAAAAACCACAGATCCACCACCGGGAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAA
  3   1   2      seed Egg1                            IMAGE:3302050.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCTCATGAGACCAGTAGTTCATATCCTTATTAGCGGCATGCTGTATTTTACCTTCAGCGTTGCTCGCATTATGCATACCGCACGGGTTTCCATCATGGAACGAGTTAAAGGCATGCCTCCCTCTAACCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATATACGTGCCATGTTGTTGCAGAACTCAACAATCCCTTGCCACTTCAGTTTTGTATGCTGTTCTGCCATGTGATGAAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGATCTGCAGCAGAGAGTAAAACTAGCCCATAAAAACCACAGATCCACCACCGGGAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGGCTTTTAAAAAA
  3   1   2       bld Emb4 5g3  out                   IMAGE:4957262.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCATGAGACCAGTAGTTCATATCCTTATTAGCGGCATGCTGTATTTTACCTTCAGCGTTGCTCGCATTATGCATACCGCACGGGTTTCCATCATGGAACGAGTTAAAGGCATGCCTCCCTCTAACCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATATACGTGCCATGTTGTTGCAGAACTCAACAATCCCTTGCCACTTCAGTTTTGTATGCTGTTCTGCCATGTGATGAAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGATCTGCAGCAGAGAGTAAAACTAGCCCATAAAAACCACAGATCCACCACCGGGAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGAA
  3   1   0       add Tbd7                                 XL067k16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCATGAGACCAGTAGTTCATATCNTTATAAGCGGCATGCTGTATTTTACCTTCAGCGTTGCTCGCATTATGCATACCGCACGGGTTTCCATCATGGAACGAGTTAAAGGCATGCCTCCCTCTAACCACAGAATGGTNCTGTCTTCCTGTTGCCATAATACATAGACGTGCCATGNTGTTGCAGAACTCAA
  3   1   2       bld Ga18      out                      xlk81h16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTTGTAGACTGTTCTGCCATGTGAGGAAAGCCTCTAGACCTTACTGGGATCATTCCTCTGATCTGCAGCAGAGATGAAAACTAAAAACCACAGATCCNCNNCGGAAAAGACNNNTCACGAGCTTCATGATCTAGATTTAATATAAAATGTTTATATGTTATATGGAAATATATATTATACCTGTAAATATGGAGTCCTTTTTACACTGTAATTATTTATGTATAGTGCAATGTGTATANGAA

In case of problems mail me! (