Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Oct 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:8328784.5                       9 END     6          40       66                (no blast hit)
     2   2.0    0Xl3.1-IMAGE:5073905.3                       3 END     1           6       33                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-IMAGE:5073905.3                       3 PI      86        442      792                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012778686 Xl3.1-IMAGE:8328784.3 - 15 ESTs
                                                                       -740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8328784.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTACTGGGAAGATAGTGGCCTGTGTTGGTGTTGCCCCACATGGCTTTATGCCTAAGGAAGAATTTACTTTCCCTTTACTTTGAGCAGATAACAGTGTGTTTGAGAGCCCCTTCCCTGAAAGAGGTATGCAGGTATTTAAGCAGATATTGATAGTACTGCACAATATGTATTGACAACGCATTTCACGCCAGTCAGCAGATGGTGTCGCTGGCAGCAGTTACACCTGAAAGCATTAAAGTAAAAGAGGAAACCTTTTGCTCTCTAGCTCTACCTTTTTTACATACAATAGTTACAACCTCTCATGAGACCAGTAGTTCATATCCTTATTAGCGGCATGCTGTATTTTACCTTCAGCGTTGCTCGCATTATGCATACCGCACGGGTTTCCATCATGGAACGAGTTAAAGGCATGCCTCCCTCTAACCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATATACGTGCCATGTTGTTGCAGAACTCAACAATCCCTTGCCACTTCAGTTTTGTATGCTGTTCTGCCATGTGATGAAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGATCTGCAGCAGAGAGTAAAACTAGCCCATAAAAACCACAGATCCACCACCGGGAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGGCTTTTAA
                                                  Xl3.1-CHK-1012691679                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAAGATAGTGGCCTGTGTTGGTGTTGCCCCACATGGCTTTATGCCTAAGGAAGAATTTACTTTCCCTTTACTTTGAGCAGATAACAGTGTGTTTGAGAGCCCCTTCCxxxAxAGAGGTATGCAGGTATTTAAGCAGATATTGATAGTACTGCACAATATGTATTGACAACGCATTTCACGCCAGTCAGCAGATGGTGTCGCTGGCAGCAGTTACACCTGAAAGCATTAAAGTAAAAGAGGAAACCTTTTGCTCTCTAGCTCTACCTTTTTTACATACAATAGTTACAACCTCTCATGAGACCAGTAGTTCATATCCTTATTAGCGGCATGCTGTATTTTACCTTCAGCGTTGCTCGCATTATGCATACCGCACGGGTTTCCATCATGGAACGAGTTAAAGGCATGCCTCCCTCTAACCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATATACGTGCCATGTTGTTGCAGAACTCAACAATCCCTTGCCACTTCAGTTTTGTATGCTGTTCTGCCATGTGATGAAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGATCTGCAGCAGAGAGTAAAACTAGCCCATAAAAACCACAGATCCACCACCGGGAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGGCTTTTAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          2     4     3     5     3     5     3     5     2     4     3     5     3     5     3     5     2     4     2     4     3     5     3     5     3     6     3     6     3     6     4     6     4     6     5     7     5     7     6     8     6     8     6     8     6     8     5     8     5     8     9    11     8    10     9    11     9    11     9    11     9    11     9    11     8    11     9    11     9    11     9    11     8    10     9    11     8    10     8    10     8    10     8    10     8    10     8    11     8    11     8    11     7    11     7    11     7    11     7    11     8    11     5    10     7    10     8    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     8    10     6     9     6     7     5     6     3     4
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------G----
  5   1   0       add Egg1                            IMAGE:4783337.5p TGAGCGGGTGCCAGGGAGCCGGGGGGTCGGACAATAACAGTGGCTGCTGCTGCTGCAACCCCTATCATTACAGCAGGGTCTGCGAACCGGAGTCTCCACCACCACCTTATTCACGACTGTCTCCAAAAATTGAACAGAAGCCTCTAGATCTCTCCGATTCATACACTGAAATGGAAGCCTCCAACTCGCTGTGCATCACAGCCGCAGACATATCAGACACAAGCCTGTCTCCTGACATGAGCAAGCAGGGCCACTGGTGCAGTGTGGCGTACTGGGAGCACCGTACCCGCGTGGGCCGTCTCTACGCAGTATGCCAGCCTTCAGTAAGCATTTTCTATGATCTACCTCAGGGAAGCGGCTTCTGTCTGGGCCAGCTCAATCTGGAAAACCGGAGCGAGGCGGCAGCCAGGACAAGGGGGAAGATTGGACTTGGAATAGTATTGAGCCGAGAGACTGATGGTGTGTGGGCTTACAACCGCAGCGATCATCCCATATTCGTCAACTCGCCCACCTTAGATGCACCTGCCTGCCGCCCCCTAGTGGTGAGAAAGGTGATGCCTGGATATTCCCTCAAAGTGTTTGACTACAAAAAGTCATGTGTTCTGCCGCATCACCCAACTCCCCCA
  5   1   0       add Em10                            IMAGE:7979835.5p                                                                                                                                                                                                                                                                                                                                                                     GGCTTCTGCCTGGGCCAGCTCAATCTGGAAAACCGGAGTGAGGCAGCAGCCAGGACAAGGGGGAAGATTGGACTTGGAATAGTACTGAGCCGAGAGGCTGATGGTGTGTGGGCTTACAACCGCAGCGATCATCCCGTATTCGTCAACTCGCCCACTCTAGATGCACCTGCCTGCCGCCCCCTAGTGGTGAGAAAAGTGATGCCTGGATATTCCCTCAAAGTGTTTGATTACAAAAAATCATGTGTTCTGCGGCATCACCCAACTCCTCCAGAACATACAGACGGACCCTATGATCCCCACAGTGTCCGCATAAGCTTTGCCAAGGGTTGGGGCCCGTGTTATTCCCGCCAGATGATCACCTCTTGCCCCTGCTGGCTCGAGGTCCTACTGGGACGATAGTGACTTTATGCCTAAGGAACAATTTCCTTCACTTTGAGCAGACAGAGTGGATGAGAGCCATTGTTTTACCCTTTTTCCTGAAAGAGAGGTATGTAGGTATTTAAAGGGATACCGTCATGGGGAAAAAAACATTTTTCAAAACACATCAGTTAATAGTGCTGCTCCAGCAGATTTCTGCCCTGAATTCATTTTCTCAAAGGGCAACAGATTTTTTCAATTCAATTTGAAACTGACATGGGCTAGACATATGTCAGTTTCCACCGCTCCCAATCATGTGCCTGAGCCAAAAAACTCCATCCCCTTACTCTGTCTCAGTGGATGATTCACCTACCCCCCCACACCACCACGAATTGGAAGTAACATACGCCCTATATCAAACCCC
  5   1   0       add Ga14                               Ga14-p14h1.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTANAGATTCGTATNTCGCCCACCTTAGATGCACCTGCCTGCCGCCCCCTGAGTGGTGAGAAAGGTGATGCCTGGATATTCCCTCANAGTGTTTGACTACAAAAAGTCATGCGTTCTGCGGCATCACCCAACTCCCCCANAACATACAGACGGACCCTATGATCCCAACAGTGTCCGCATCAGCTTTGCCAAGGGTTGGGGCCCGTGTTATTCCCGCCAGATGATCACCTCTTGCCCCTGCTGGCTGGAGGTCCTANTGGGAAGATAGTGGCCTGTGTTGGTGTTGCCCCACATGGCTTTANGCCTAAGGAANAATTTACTTTCCCTTTACTTTGAGCAGATAACAGTGTGTTTGAGAGC
  3   1   2       bld Ga18      out                      xlk72p02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGCCGCCCCCTAGTGGTGAGAAAGNNNATGCCTGGANNNTCCCTCAAAGTGTTNGNCTNNAAAAANTCATGCGTTCTGCGGCATCACCCAACTCCCCCAGAACATACAGNCGGNCCCTATGNNCCCAACAGTGTCCGCATCANCTTTGCCAAGGGTTGGGGCCCGTGTTATTCCCGCCAGATGATCACCTCTTGCCCCTGCTGGCTGGAGGTCCTACTGGGAAGATAGTGGCCTGTGTTGGTGTTGCCCCACATGNCTTTATGCCTAAGGAAGAATTTACTTTCCCTTTACTTTGAGCAGATAACAGTGTGTTTGAGAGCCCCTTCCCTGAAAGAGAGGTATGCAGGTATTTAAGCAGATATTGATAGTACTGCACAATATGTATTGACAACGCATTTCACGCCAGTCAGCAGATGGTGTCGCTGGCAGCAGTTACACCTGAAAGCATTAAAGTAAAAGAGGAAACCTTTTGCTCTCTAGCTCTACCTTTTTTACATACAATAGTTACAACCTCTCATGAGACCAGTAGTTCATATCCTTATTAGCGGCATGCTGTATTTTACCTTNNNNTTGCTCGCATTATGCATACCGCACGGGTTTCCATCATGGAACGAGTTAAAGGCATGCCTCCCTCTAACCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATATACGTGCCATGTTGTTGCAGAACTCAACAATCCCTTGCCACTTCAGTTTTGTATGCTGTTCTGCCATGTGATGAAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGATCTGCAGCAGAGAGTAAAACTAGCCCATAAAAACCACAGATCCACCACCGGGAAGNNNNNNACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGNTNNNATGTGTATATGAACTAAAATACAATAAA
  3   1   2      skin Ga18      out                       xlk1k20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCANCTTTNCNANGGNTNGGGCCNGnnnnnnnnCCGCNAGANGANCACCNCTNNNCCTGCTGNCNGNAGNNCTACTGGGAAGATAGTGGCCTGTGTNGGTGTTGCCCCACATGGCTTTATGCCTAAGGAAGAATTTACTTTCCCTTTACTTTGAGCAGATAACAGTGTGTTTGAGAGCCCCTTCCCTGAAAGAGAGGTATGCAGGTATTTAAGCAGATATTGATAGTACTGCACAATATGTATTGACAACGCATTTCACGCCAGTCAGCAGATGGTGTCGCTGGCAGCANTTACACCTGAAAGCATTAAAGTAAAAGAGGAAACCTTTTGCTCTCTAGCTCTACCTTTTTTACATACAATAGTTACAACCTCTCATGAGACCAGTAGTTCATATCCTTATTAGCGGCATGCTGTATTTTACCTTNNNNTTGCTCGCATTATGCATACCGCACGGGTCTCCATCATGGAACGAGTTAAAGGCATGCCTCCCTCTAACTACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATATACGTGCCATGTTGTTGCAGAACTCGACAATCCCTTGCCACTTCAGTTTTGTATGCTGTTCTGCCATGTGATGAAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGATCTGCAGCAGAGAGTAAAACTAGCCCATAAAAACCACAGATCCAACACCGGGAAGNNNNTNACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAANGTGTATATGAACNNAA
  5   1   2       bld Egg1      in                    IMAGE:3301062.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTGGCTGGAGGTCCTACTGGGAAAATAGTGGCCTGTGTTGGTGTTGCTCCACATGGCTTTATGCCTAAAGGAAGAATTTACTTTCCCTTTACTTTGAGCAGATAACAGTGTGTTTGAGAGCCCCTTCCCTGAAAGAGAGGTATGCAGGTATTTAAGCAGATATTGATAGTACTGCACAATATGTATTGACAACGCATTTCACGCCAGTCAGCAGATGGTGTCGCTGGCAGCAGTTACACCTGAAAGCATTAAAGTAAAAGAGGAAACCTTTTGCTCTCTAGCTCTACCTTTTTTACATACAATAGTTACAACCTCTCATGAGACCAGTAGTTCATATCCTTATTAGCGGCATGCTGTATTTTACCTTCAGCGTTGCTCGCATTATGCATACCGCACGGGTTTCCATCATGGAACGAGTTAAAGGCATGCCTCCCTCTAACCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATATACGTGCCATGTTGTTGCAGAACTCAACAATCCCTTGCCACTTCAGTTTTGTATGCTGTTCTGCCATGTGATGAAAAGCCTTTAGAAGTTATGGGTTCATTCTTCTGATCTGCAGCAGATAGTAAAACTAGCCCATATAAACCACAGATCCACC
  5   1   2      skin Brn3                            IMAGE:8540274.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTCCTACTGGGAAGATAGTGGCCTGTGTTGGTGTTGCCCCACATGGCTTTATGCCTAAGGAAGAATTTACTTTCCCTTTACTTTGAGCAGATAACAGTGTGTTTGAGAGCCCCTTCCCTGAAAGAGAGGTATGCAGGTATTTAAGCAGATATTGATAGTACTGCACAATATGTATTGACAACGCATTTCACGCCAGTCAGCAGATGGTGTCGCTGGCAGCAGTTACACCTGAAAGCATTAAAGTAAAAGAGGAAACCTTTTGCTCTCTAGCTCTACCTTTTTTACATACAATAGTTACAACCTCTCATGAGACCAGTAGTTCATATCCTTATTAGCGGCATGCTGTATTTTACCTTCAGCGTTGCTCGCATTATGCATACCGCACGGGTCTCCATCATGGAACGAGTTAAAGGCATGCCTCCCTCTAACTACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATATACGTGCCATGTTGTTGCAGAACTCGACAATCCCTTGCCACTTCAGTTTTGTATGCTGTTCTGCCATGTGATGAAAAGCCTCTAGAAGTTATGGGGGTCATTCTTCTGATCTGCAGCAGAGAGTAAAACTAGCCCATAAAAACCACAGATTCAACACCGGGGAGGACTCTCACGAGCATCAGGATTAGATTTATATAAATGTTTTATATATATGGAATAATTTATACTGTAAATATGAGCATTTTACATGTATTATTATGATGGGGCAGTGTTTGACTAATACATAATGCCTTGCTTTaaaaaaaaaaaaaaaaaGAGCCGAGCGATTTTACCGCCACTCCCCAGGTGATTAACAATGAAATAAAT
  3   1   2       bld Ov1  5g3  out                   IMAGE:8328784.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCTGAAAGAGAGGTATGCAGGTATTAAAGCAGATATTGATAGTACTGTACAATATGTATTGACAACGCATTTCACGCCAGTCAGCAGATGGTGTCGCTGGCAGCAGTTACACCTGAAAGCATTAAAGTAAAAGAGGAAACCTTTTGCTCTCTAGCTCTACCTTTTTTACATACAATAGTTACAACCTCTCATGAGACCAGTAGTTCATATCCTTATTAGCGGCATGCTGTATTTTACCTTCAGCGTTGCTCGCATTATGCATACCGCACGGGTCTCCATCATGGAACGAGTTAAAGGCATGCCTCCCTCTAACTACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATATACGTGCCATGTTGTTGCAGAACTCGACAATCCCTTGCCACTTCAGTTTTGTATGCTGTTCTGCCATGTGATGAAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGATCTGCAGCAGAGAGTAAAACTAGCCCATAAAAACCACAGATCCAACACCGGGAAGGACTCTCACGAGCATCGTGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGGCTTTTAAAAAAAAAAAAAAAAG
  3   1   2       bld Egg1      in                    IMAGE:3301062.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAAGCAAGAGATTGATAGACTGCACGATATGTATTGACAAGCATTTCACGCCAGTCAGCAGATGGTGTCACTGGCAGCAGTAACACCTGTAAGCATTAATGTAAAAGAGGAAGCGTTTTGCTCTCTAGCTCTACCTTTCTTACAACATATAGTTCAAACATATCATGAGTCCAGTAGTTCATATCATTATTAGCGGCATGCTGTATTTTACCTTCAGCGTTGCTCGCATTATGCATACCGCACGGGTTTCCATCATGAAACGAGTTAAAGGCATGCCTCCCTCTAACCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATATACGTGCCATGTTGTTGCAGAACTCAACAATCCCTTGCCACTTCAGTTTTGTATGCTGTTCTGCCATGTGATGAAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGATCTGCAGCAGAGAGTAAAACTAGCCCATAATAACCACAGATCCTCCACCGGGAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGGCTTTTAAAAAAAA
  3   1   2       bld Ov1  5g3  out                   IMAGE:5073767.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCGCTGGCAGCAGTTACACCTGAAAGCATTAAAGTAAAAGAGGAAACCTTTTGCTCTCTAGCTCTACCTTTTTTACATACAATAGTTACAACCTCTCATGAGACCAGTAGTTCATATCCTTATTAGCGGCATGCTGTATTTTACCTTCAGCGTTGCTCGCATTATGCATACCGCACGGGTCTCCATCATGGAACGAGTTAAAGGCATGCCTCCCTCTAACTACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATATACGTGCCATGTTGTTGCAGAACTCGACAATCCCTTGCCACTTCAGTTTTGTATGCTGTTCTGCCATGTGATGAAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGATCTGCAGCAGAGAGTAAAACTAGCCCATAAAAACCACAGATCCAACACCGGGAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGGCTTTT
  3   1   2       bld Tbd7      out                        XL067j16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACCTGAAAGCATTAAAGTAAAAGAGGAAACCTTTTGCTCTCTAGCTCTACCTTTTTTACATACAATAGTTACAACCTCTCATGAGACCAGTAGTTCATATCCTTATAAGCGGCATGCTGTATTTTACCTTCAGCGTTGCTCGCATTATGCATACCGCACGGGTTTCCATCATGGAACGAGTTAAAGGCATGCCTCCCTCTAACCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATATACGTGCCATGTTGTTGCAGAACTCAACAATCCCTTGCCACTTCAGTTTTGTATGCTGTTCTGCCATGTGATGAAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGATCTGCAGCAGAGAGTAAAACTAGCCCATAAAAACCACAGATCCACCACCGGGAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAA
  3   1   2      seed Egg1                            IMAGE:3302050.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCTCATGAGACCAGTAGTTCATATCCTTATTAGCGGCATGCTGTATTTTACCTTCAGCGTTGCTCGCATTATGCATACCGCACGGGTTTCCATCATGGAACGAGTTAAAGGCATGCCTCCCTCTAACCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATATACGTGCCATGTTGTTGCAGAACTCAACAATCCCTTGCCACTTCAGTTTTGTATGCTGTTCTGCCATGTGATGAAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGATCTGCAGCAGAGAGTAAAACTAGCCCATAAAAACCACAGATCCACCACCGGGAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGGCTTTTAAAAAA
  3   1   2       bld Emb4 5g3  out                   IMAGE:4957262.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCATGAGACCAGTAGTTCATATCCTTATTAGCGGCATGCTGTATTTTACCTTCAGCGTTGCTCGCATTATGCATACCGCACGGGTTTCCATCATGGAACGAGTTAAAGGCATGCCTCCCTCTAACCACAGAATGGTGCTGTCTTCCTGTTGCCATAATACATATACGTGCCATGTTGTTGCAGAACTCAACAATCCCTTGCCACTTCAGTTTTGTATGCTGTTCTGCCATGTGATGAAAAGCCTCTAGAAGTTATGGGGTTCATTCTTCTGATCTGCAGCAGAGAGTAAAACTAGCCCATAAAAACCACAGATCCACCACCGGGAAGGACTCTCACGAGCATCATGATCTAGATTTAATATAAAATGTTTATATATTATATGGAAATATATATTATACCTGTAAATATGGAGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTATATGAACTAAAATACAATAAAATGCACTTTGAA
  3   1   0       add Tbd7                                 XL067k16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCATGAGACCAGTAGTTCATATCNTTATAAGCGGCATGCTGTATTTTACCTTCAGCGTTGCTCGCATTATGCATACCGCACGGGTTTCCATCATGGAACGAGTTAAAGGCATGCCTCCCTCTAACCACAGAATGGTNCTGTCTTCCTGTTGCCATAATACATAGACGTGCCATGNTGTTGCAGAACTCAA
  3   1   2       bld Ga18      out                      xlk81h16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTTGTAGACTGTTCTGCCATGTGAGGAAAGCCTCTAGACCTTACTGGGATCATTCCTCTGATCTGCAGCAGAGATGAAAACTAAAAACCACAGATCCNCNNCGGAAAAGACNNNTCACGAGCTTCATGATCTAGATTTAATATAAAATGTTTATATGTTATATGGAAATATATATTATACCTGTAAATATGGAGTCCTTTTTACACTGTAATTATTTATGTATAGTGCAATGTGTATANGAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)