Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 05 Jun 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:7982118.5                       4 PI      94        428     1332                homeo box protein [Xenopus laevis]
     2   0.0    0Xl3.1-IMAGE:6880520.5                       3 PI      84        444      618                homeobox protein [Xenopus laevis]
     3   0.0    0Xl3.1-IMAGE:7979275.5                       2 PI      95        428      677                homeo box protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 91%

 1012778772 Xl3.1-IMAGE:4757374-IMAGp.5 - 8 ESTs
                                                                       .......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:4757374-IMAGp.5                                      AATCTTCCAGGCAGGTAAAGGAGAAGATATGAATTCCTATTTCACTAACCCTTCCTTATCCTGCCATTTAGCCAGTGGCCAAGAAGTTCTCCCCAATGTGGCCCTTAATTCCACAGCCTATGACCCAGTTAGGCATTTTTCCACTTATGGAGCAGCGGTGGCTCAGAATAGGATCTACTCGTCTCCATTCTATACCCCGCAAGATAATGTTGTGTTTGGCTCCAGCCGGGGCCCCTATGAATATGGATCCAACGCATTTTACCAGGACAAGGACATGCTCACTAGCTGCAGGCAGAACTCAATGGGACACAACACGCAGAGCTCCCTTGCACAGGATTTTAGCAGTGAACAAAACAGAGGCAATGGGCAGGAGCAGAAAGGCAGCATTCAGATCTACCCATGGATGCAGCGCATGAACTCCCACAGTGGCGTGGGCTACGGGACGGACAGGAGGAGAGGACGCCAGATCTATTCCCGTTACCAAACTCTGGAGCTGGAGAAAGAATTTCACTTCAATCGCTACCTGACCCGGCGCAGGAGGATCGAGATCGCCAATGCACTTTGTCTGACAGAGCGGCAGATCAAAATCTGGTTCCAGAACAGGAGGATGAAATGGAAAAAGGAGAGCAACCTCACATCGACCCTGTCTGGGGGCACTGGGGCAGCGGCTGACAGTTTAGCCGGGGGCAAGGAGGAAAAGCGAGAGGACTCAGAGGGACAAGGCAAAGAGTGAATGGAGAGACACCCCACTAAGGCTTCCTCTTCCCCCCTGCGCAAGTCTGCTCCCCTCCTCCTTTAAGCTGGCACAATTGATTTGGTTGGGCTGCATTAAAAACAAACAGATATTTCTACCCACATTTATCCAGAGCCAGACGTGGACTATTCATTCAGGGGCTGCCTCCCTGCCATGTACTAGACTTGGCTATTGCCTCCTCTCAGTCTCTGTGTTATTCCTGGAACTCTGAATAAAAGACTGGGTTCCACAGCCACACATTTCCTTGTATAGAAACATTGCCTGCAAACTAAAGGGACAGACCCCGACAGACTTTGCCTGCGCGTGTGTTTGGGACTATGGACCTGGCACAATTTTAATGTCAAGAAATTCCAAGCTGCTCCCAAGTTCTCCTCCGTCCCCTTCACCCTTTAAGCTGCGGCCAAGTGAAATCTAGCATTCCATTGTGCACAAAGTCCTGACTGTATCTAAAGCCACACTCTCTGGGCCATCATCTTCCATGCTCCATACTGTGACAGTTACCCTGTGAACCTCAGTTTTTAGCCATTGTGTCCGTGGTATCAGTATTTTATTTATGGTAGCGCTGCAGTGTTCATTTG
                                                  Xl3.1-CHK-1012699023                                            CCAGGCAGGTAAAGGAGAAGATATGAATTCCTATTTCACTAACCCTTCCTTATCCTGCCATTTAGCCAGTGGCCAAGAAGTTCTCCCCAATGTGGCCCTTAATTCCACAGCCTATGACCCAGTTAGGCATTTTTCCACTTATGGAGCAGCGGTGGCTCAGAATAGGATCTACTCGTCTCCATTCTATACCCCGCAAGATAATGTTGTGTTTGGCTCCAGCCGGGGCCCCTATGAATATGGATCCAACGCATTTTACCAGGACAAGGACATGCTCACTAGCTGCAGGCAGAACTCAATGGGACACAACACGCAGAGCTCCCTTGCACAGGATTTTAGCAGTGAACAAAACAGAGGCAATGGGCAGGAGCAGAAAGGCAGCATTCAGATCTACCCATGGATGCAGCGCATGAACTCCCACAGTGGCGTGGGCTACGGGACGGACAGGAGGAGAGGACGCCAGATCTATTCCCGTTACCAAACTCTGGAGCTGGAGAAAGAATTTCACTTCAATCGCTACCTGACCCGGCGCAGGAGGATCGAGATCGCCAATGCACTTTGTCTGACAGAGCGGCAGATCAAAATCTGGTTCCAGAACAGGAGGATGAAATGGAAAAAGGAGAGCAACCTCACATCGACCCTGTCTGGGGGCACTGGGGCAGCGGCTGACAGTTTAGCCGGGGGCAAGGAGGAAAAGCGAGAGGACTCAGAGGGACAAGGCAAAGAGTGAATGGAGAGACACCCCACTAAGGCTTCCTCTTCCCCCCTGCGCAAGTCTGCTCCCCTCCTCCTTTAAGCTGGCACAATTGATTTGGTTGGGCTGCATTAAAAACAAACAGATATTTCTACCCACATTTATCCAGAGCCAGACGTGGACTATTCATTCAGGGGCTGCCTCCCTGCCATGTACTAGACTTGGCTATTGCCTCCTCTCAGTCTCTGTGTTATTCCTGGAACTCTGAATAAAAGACTGGGTTCCACAGCCACACATTTCCTTGTATAGAAACATTGCCTGCAAACTAAAGGGACAGACCCCGACAGACTTTGCCTGCGCGTGTGTTTGGGACTATGGACCTGGCACAATTTTAATGTCAAGAAATTCCAAGCTGCTCCCAAGTTCTCCTCCGTCCCCTTCACCCTTTAAGCTGCGGCCAAGTGAAATCTAGCATTCCATTGTGCACAAAGTCCTGACTGTATCTAAAGCCACACTCTCTGGGCCATCATCTTCCATGCTCCATACTGTGACAGTTACCCTGTGAACCTCAGTTTTTAGCCATTGTGTCCGTGGTATCAGTATTTTATTTATGGTAGCGCTGCAGTGTTCATTTGTAGTCA
                                                      consensus depths                                           4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     6     4     6     5     6     5     6     5     6     5     6     5     6     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     4     4     4     3     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     3     4     3     4     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG      29     617                                      
                                               BLH MIN      29      98                                      
  5   1   2       bld Eye1 5x3                        IMAGE:6948047.5p GCTGGGTACCGGTCCGGGAATTCCCGGGGATTAAAGAAATCTTCCAGGCAGGTAAAGGAGAAGATATGAATTCCTATTTCACTAACCCTTCCTTATCCTGCCATTTAGCCAGTGGCCAAGAAGTTCTCCCCAATGTGGCCTTTAATTCCACAGCCTATGACCCAGTTAGGCATTTTTCCACTTATGGAGCAGCGGTGGCTCAGAATAGGATCTACTCGTCTCCATTCTATACCCCGCAAGATAATGTTGTGTTTGGCTCCAGCCGGGGCCCCTATGAGTATGGATCCAACGCATTTTACCAGGACAAGGACATGCTCACTAGCTGCAGGCAGAACTCAATGGGACACAACACGCAGAGCTCCCTTGCACAGGATTTTAGCAGTGAACAAAACAGAGGCAATGGGCAGGAGCAGAAAGGCAGCATTCAGATCTACCCATGGATGCAGCGCATGAACTCCCACAGTGGCGTGGGCTATGGGACGGACAGGAGGAGAGGACGCCAGATCTATTCCCGTTACCAAACTCTGGAGCTGGAGAAAGAATTTCACTTCAATCGCTACCTGACCCGGCGCAGGAGGATCGAGATCGCCAATGCACTTTGTCTGACAGAGCGGCAGATCAAAATCTGGTTCCAGAACAGGAGGATGAAATGGAAAAAGGAGAGCAACCTCACATCGACCCTGTCTGGGGGCACTGGGGCAGCGGCTGACAGTTTAGCCGGGGGGCAAAGGAGGAAAAGCGAAGAGGACTCAGAAGGGACAAGGGCAAAAAGTGAATGGGGAGAGACAACCCCACTAAAGgcttccctctttccccccttgcgcaaagtcttgcctcccccttcctcccttTTAAGCTTGGGCACCAAATTGGATTTTTGGGTTTGGGGCCTGGGCATTTTAAAAAACCCAACCCCGGAATATTTT
  5   1   2      seed Eye1 5x3               IMAGE:4757374-IMAGp.IMAGp              GGAGACAGAAATAAATATTAAAGAAATCTTCCAGGCAGGTAAAGGAGAAGATATGAATTCCTATTTCACTAACCCTTCCTTATCCTGCCATTTAGCCAGTGGCCAAGAAGTTCTCCCCAATGTGGCCCTTAATTCCACAGCCTATGACCCAGTTAGGCATTTTTCCACTTATGGAGCAGCGGTGGCTCAGAATAGGATCTACTCGTCTCCATTCTATACCCCGCAAGATAATGTTGTGTTTGGCTCCAGCCGGGGCCCCTATGAATATGGATCCAACGCATTTTACCAGGACAAGGACATGCTCACTAGCTGCAGGCAGAACTCAATGGGACACAACACGCAGAGCTCCCTTGCACAGGATTTTAGCAGTGAACAAAACAGAGGCAATGGGCAGGAGCAGAAAGGCAGCATTCAGATCTACCCATGGATGCAGCGCATGAACTCCCACAGTGGCGTGGGCTACGGGACGGACAGGAGGAGAGGACGCCAGATCTATTCCCGTTACCAAACTCTGGAGCTGGAGAAAGAATTTCACTTCAATCGCTACCTGACCCGGCGCAGGAGGATCGAGATCGCCAATGCACTTTGTCTCACAGAGCGGCAGATCAAAATCTGGTTCCAGAACAGGAGGATGAAATGGAAAAAGGAGAGCAACCTCTCATCTACCCTTCCTGGTGGCACTGGGGCAGCGGCTGACAGTTTAGCCGAGGGTAAGGAGGAAAAGCAAGAGGACTCAGAGGGACAAGGCAAAGAGTGAATGGAGAGACACCCCACTAAGGCTTCCTCTTCCCCCCTGCG
  5   1   2       bld Ov1  5g                         IMAGE:8331988.5p                            ATATTANAGAAATCTTCCAGGCAGGTAAAGGAGAAGATATGAATTCCTATTTCACTAACCCTTCCTTATCCTGCCATTTAGCCAGTGGCCAAGAAGTTCTCCCCAATGTGGCCCTTAATTCCACAGCCTATGACCCAGTTAGGCATTTTTCCACTTATGGAGCAGCGGTGGCTCAGAATAGGATCTACTCGTCTCCATTCTATACCCCGCAAGATAATGTTGTGTTTGGCTCCAGCCGGGGCCCCTATGAATATGGATCCAACGCATTTTACCAGGACAAGGACATGCTCACTAGCTGCAGGCAGAACTCAATGGGACACAACACGCAGAGCTCCCTTGCACAGGATTTTAGCAGTGAACAAAACAGAGGCAATGGGCAGGAGCAGAAAGGCAGCATTCAGATCTACCCATGGATGCAGCGCATGAACTCCCACAGTGGCGTGGGCTACGGGACGGACAGGAGGAGAGGACGCCAGATCTATTCCCGTTACCAAACTCTGGAGCTGGAGAAAGAATTTCACTTCAATCGCTACCTGACCCGGCGCAAGAGGATCGAGATCGCCAATGCACTTTGTCTCACAGAGCGGCAGATCAAAATCTGGTTCCAGAACAGGAGGATGAAATGGAAAAAGGAGAGCAACCTCTCATCTACCCTTCCTGGTGGCACTGGGGCAGCGGCTGACAGTG
  5   1   2       bld Eye1 5g                         IMAGE:4757374.5p                                    GAAATCTTCCAGGCAGGTAAAGGAGAAGATATGAATTCCTATTTCACTAACCCTTCCTTATCCTGCCATTTAGCCAGTGGCCAAGAAGTTCTCCCCAATGTGGCCCTTAATTCCACAGCCTATGACCCAGTTAGGCATTTTTCCACTTATGGAGCAGCGGTGGCTCAGAATAGGATCTACTCGTCTCCATTCTATACCCCGCAAGATAATGTTGTGTTTGGCTCCAGCCGGGGCCCCTATGAATATGGATCCAACGCATTTTACCAGGACAAGGACATGCTCACTAGCTGCAGGCAGAACTCAATGGGACACAACACGCAGAGCTCCCTTGCACAGGATTTTAGCAGTGAACAAAACAGAGGCAATGGGCAGGAGCAGAAAGGCAGCATTCAGATCTACCCATGGATGCAGCGCATGAACTCCCACAGTGGCGTGGGCTACGGGACGGACAGGAGGAGAGGACGCCAGATCTATTCCCGTTACCAAACTCTGGAGCTGGAGAAAGAATTTCACTTCAATCGCTACCTGACCCGG
  5   1   2       bld Tbd7      in                         XL106o11.5p                                                                                                                       AGAAGTTCTCCCCAATGTGGCCCTTAATTCCACAGCCTATGACCCAGTTAGGCATTTTTCCACTTATGGAGCAGCGGTGGCTCAGAATAGGATCTACTCGTCTCCATTCTATACCCCGCAAGATAATGTTGTGTTTGGCTCCAGCCGGGGCCCCTATGAGTATGGATCCAACGCATTTTACCAGGACAAGGACATGCTCACTAGCTGCAGGCAGAACTCAATGGGACACAACACGCAGAGCTCCCTTGCACAGGATTTTAGCAGTGAACAAAACAGAGGCAATGGGCAGGAGCAGAAAGGCAGCATTCAGATCTACCCATGGATGCAGCGCATGAACTCCCACAGTGGTAAGTTGCACTGCTACGCGCACAGATAAATTAAATAAACTCAACCATCTTTACGATCGTCTCCCCCAGCAGAACAAGCTCAGCTCCTTTTTTTATGGCCTCATAAAAGCAATAAACTAGTTCCTTTCCCAGTTGCTCTTATAGGCCCTTTTATTTGTTAAGTTGTTGCAAGCAAATATGGCTTATGTGCTTTCTAATTAAAAGAGGAAAATATAGGTAAT
  5   1   2       bld Neu7      in                         XL035n10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTGGGACGGACAGGAGGAGAGGACGCCAGNATCTATTCCCGTTACCAAACTCTGGAGCTGGAGAAAGAATTTCACTTCAATCGCTACCTGACCCGGCGCAGGAGGATCGAGATCGCCAATGCACTTTGTCTGACAGAGCGGCAGATCAAAATCTGGTTCCAGAACAGGAGGATGAAATGGAAAAAGGAGAGCAACCTCACATCGACCCTGTCTGGGGGCACTGGGGCAGCGGCTGACAGTTTAGCCGGGGGCAAGGAGGAAAAGCGAGAGGACTCAGAGGGACAAGGCAAAGAGTGAATGGAGAGACACCCCACTAAGGCTTCCTCTTCCCCCCTGCGCAAGTCTGCTCCCCTCCTCCTTTAAGCTGGCACAATTGATTTGGTTGGGCTGCATTAAAAACAAACAGATATTTCTACCCACATTTATCCAGAGCCAGACGTGGACTATTCATTCAGGGGCTGCCTCCCTGCCATGTACTAGACTT
  3   1   2      skin Tbd7      in                         XL106o11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGGCTTCCTCTTCCCCCCTGCGCAAGTCTGCTCCCCTCCTCCTTTAAGCTGGCACAATTGATTTGGTTGGGCTGCATTAAAAACAAACAGATATTTCTACCCACATTTATCCAGAGCCAGACGTGGACTATTCATTCAGGGGCTGCCTCCCTGCCATGTACTAGACTTGGCTATTGCCTCCTCTCAGTCTCTGTGTTATTCCTGGAACTCTGAATAAAAGACTGGGTTCCACAGCCACACATTTCCTTGTATAGAAACATTGCCTGCAAACTAAAGGGACAGACCCCGACAGACTTTGCCTGCGCGTGTGTTTGGGACTATGGACCTGGCACAATTTTAATGTCAAGAAATTCCAAGCTGCTCCCAAGTTCTCCTCCGTCCCCTTCACCCTTTAAGCTGCGGCCAAGTGAAATCTAGCATTCCATTGTGCACAAAGTCCTGACTGTATCTAAAGCCACACTCTCTGGGCCATCATCTTCCATGCTCCATACTGTGACAGTTACCCTGTGAACCTCAGTTTTTAGCCATTGTGTCCGTGGTATCAGTATTTTATTTATGGTAGCGCTGCAGTGTTCATTTGTAGTCAGTAAATGAAGTCTCATAGCAGTAGAAATGGTTACATCTTGTGTTTCACTATTATGTATAAAGTTCACGTCCTANGACAAAGTGT
  3   1   2       bld Neu7      in                         XL035n10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCTACCCACATTTATCCAGAGCCAGACGTGGACTATTCATTCAGGGGCTGCCTCCCTGCCATGTACTAGACTTGGCTATTGCCTCCTCTCAGTCTCTGTGTTATTCCTGGAACTCTGAATAAAAGACTGGGTTCCACAGCCACACATTTCCTTGTATAGAAACATTGCCTGCAAACTAAAGGGACAGACCCCGACAGACTTTGCCTGCGCGTGTGTTTGGGACTATGGACCTGGCACAATTTTAATGTCAAGAAATTCCAAGCTGCTCCCAAGTTCTCCTCCGTCCCCTTCACCCTTTAAGCTGCGGCCAAGTGAAATCTAGCATTCCATTGTGCACAAAGTCCTGACTGTATCTAAAGCCACACTCTCTGGGCCATCATCTTCCATGCTCCATACTGTGACAGTTACCCTGTGAACCTCAGTTTTTAGCCATTGTGTCCGTGGTATCAGTATTTTATTTATGGTAGCGCTGCAGTGTTCATTTGTAGTCAGAAATAAGTCTCATAGCAGTAGAAATGGTTACATCTTGTGTTTCACTATTATGTATAAAGTTCACGTCCTAGGACAAAGTGTNAGATTTAATAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)